ID: 962087191

View in Genome Browser
Species Human (GRCh38)
Location 3:132204166-132204188
Sequence ACCCAAGAACACGTGTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 99}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962087190_962087191 6 Left 962087190 3:132204137-132204159 CCAATGAGAAGAGTAAGAAGGAA 0: 1
1: 0
2: 5
3: 46
4: 518
Right 962087191 3:132204166-132204188 ACCCAAGAACACGTGTGCCCAGG 0: 1
1: 0
2: 0
3: 12
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962087191 Original CRISPR ACCCAAGAACACGTGTGCCC AGG Intronic
900934596 1:5757169-5757191 CCCCAAGACCACATGAGCCCCGG + Intergenic
901458517 1:9377548-9377570 ACCCCAGATCACCTGGGCCCTGG - Intergenic
903781633 1:25823715-25823737 ACCCTTGAAGCCGTGTGCCCGGG + Exonic
916597295 1:166256925-166256947 ACCCATGAGCACCTGTGCCCTGG - Intergenic
916886909 1:169078306-169078328 ATCACAGAACAGGTGTGCCCAGG - Intergenic
923194939 1:231656678-231656700 ACACAAGTAAACGTGTGCCATGG + Intronic
1065126973 10:22583431-22583453 ACCGGAGAGCAGGTGTGCCCAGG + Intronic
1070284411 10:75072774-75072796 ACCCAAGAACAGTTGGGCCCGGG - Intergenic
1070789323 10:79180233-79180255 ACCCAAGCACACCCGTGACCAGG + Intronic
1074998475 10:118777849-118777871 ACCAGAGACCACGTGGGCCCTGG - Intergenic
1076109786 10:127851633-127851655 ATCCAAGAACTGGTGTGACCTGG + Intergenic
1076663259 10:132069325-132069347 CCCCAAGGACACGTTTTCCCAGG + Intergenic
1077195300 11:1276883-1276905 ACCCAAGAACAGGTGTGGACGGG + Exonic
1077234762 11:1475312-1475334 TCCCAATCACACGTGTGCACAGG + Intronic
1079292271 11:19199103-19199125 GCCCCAGGACAGGTGTGCCCAGG + Intronic
1080891592 11:36413251-36413273 ACCCAAGAACCCTTGTTCTCAGG - Intronic
1082687801 11:56260836-56260858 ACCCAAGCACAGGAATGCCCAGG + Intergenic
1083663579 11:64263174-64263196 AACCAAGAACACACATGCCCAGG - Intronic
1089317548 11:117602266-117602288 ACTCCAGGCCACGTGTGCCCAGG - Intronic
1089540262 11:119185588-119185610 CCCCAAAATCAAGTGTGCCCTGG - Intronic
1096626315 12:52898338-52898360 TCCCAAGAACATGAGTGCTCAGG + Intronic
1098167605 12:67714390-67714412 TGCCAGGAACACGTGTGCCAAGG - Intergenic
1105475429 13:20724504-20724526 ACACATGAACACGTGTGGACAGG + Intergenic
1106843275 13:33709040-33709062 ACCCAGAAACAAGTGTGCCAGGG + Intergenic
1109335628 13:60990552-60990574 CCCCAAGCACAGGTGTGGCCTGG + Intergenic
1109417698 13:62064515-62064537 ACACAGGTATACGTGTGCCCTGG - Intergenic
1109762640 13:66849918-66849940 ACTGAAGAACAGCTGTGCCCAGG - Intronic
1111826691 13:93276586-93276608 ACCCAGGCACACATGTGGCCGGG - Intronic
1113786407 13:113004175-113004197 CCCCGAGGACACTTGTGCCCCGG - Intronic
1123087081 14:105721643-105721665 TCCCAAGAACGGGTGTACCCTGG + Intergenic
1123129554 14:105974288-105974310 AGGCAAGAACACCTGTCCCCAGG + Intergenic
1129766661 15:78173875-78173897 ACCCAACAAGACGTAAGCCCTGG + Intronic
1130858216 15:87861043-87861065 GCCTCAGAACAGGTGTGCCCAGG + Intronic
1130988582 15:88860970-88860992 ACCCAGCAGCACGTCTGCCCAGG + Intronic
1133088543 16:3384925-3384947 CCCCAGCAACAGGTGTGCCCTGG - Exonic
1139195927 16:64918508-64918530 ACCCAAGATCACATCTTCCCAGG + Intergenic
1141731938 16:85828807-85828829 ACCCAAAAACACCTGCACCCAGG - Intergenic
1141775091 16:86117690-86117712 TCCCAAGAAGGCGTGTCCCCAGG - Intergenic
1141940791 16:87274603-87274625 ACACATGAACACGTGTGTACTGG + Intronic
1152118119 17:78401250-78401272 AGCAATGAACACGTGTGCCTGGG + Intronic
1156972304 18:43170985-43171007 ACCCAAGAACAAGAGAGGCCAGG - Intergenic
1157375120 18:47156501-47156523 CCCCAAGAACATGAGTGCACTGG + Intronic
1160664196 19:315864-315886 ACACACGAAGACGTGTGCACAGG + Intronic
1160952181 19:1672909-1672931 ACACAGGACCACGTGTGCCTCGG - Intergenic
1165894468 19:39133418-39133440 TCCTAAGAACACGTGTGTCTTGG - Intronic
1167885769 19:52498776-52498798 ACGCAAGATCACTTGAGCCCGGG - Intronic
925343007 2:3149629-3149651 CCCCAAGCCCAGGTGTGCCCAGG - Intergenic
927497570 2:23561128-23561150 ACCCACCACCACTTGTGCCCTGG + Intronic
932434686 2:71696056-71696078 ACTGAACAACACCTGTGCCCAGG + Intergenic
933164865 2:79064850-79064872 ACCCAGGAACAAATGTGCCCTGG - Intergenic
936628205 2:114171587-114171609 ACACAGGTACACGTGTGCCATGG - Intergenic
937314550 2:120922732-120922754 ACCCACTAACACGTGTTCCCAGG + Intronic
938297227 2:130185806-130185828 ACCCAAGGACAGGAGTGGCCTGG + Intronic
940116977 2:150219908-150219930 ACCCAAGAACAGGAGAGACCAGG + Intergenic
940439935 2:153702402-153702424 ACACAGGTACACGTGTGCCATGG - Intergenic
942313534 2:174678572-174678594 ACCCAATAACACTTGGCCCCAGG - Intronic
943888047 2:193248483-193248505 ACACAGGTACACGTGTGCCATGG + Intergenic
944369564 2:198966083-198966105 GCCCAAGAACAAGTGTGGGCTGG - Intergenic
945753885 2:213822660-213822682 ACGTAAGTACACGTGTGCCATGG + Intronic
947616137 2:231557935-231557957 GCCCAAGAACACGCATGCCTAGG + Intergenic
1168796955 20:616974-616996 CCGCAAGAACAAGTGTTCCCAGG - Intergenic
1171085711 20:22236466-22236488 AACCAAGACCACGTGAGGCCCGG + Intergenic
1174068834 20:47885818-47885840 AGCCAAGAACACTTGTGGCCGGG - Intergenic
1183553797 22:38509215-38509237 ACACAAGAAAACGTGTGTCATGG + Intergenic
1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG + Intronic
1184715849 22:46281404-46281426 ACCCATGAGCTGGTGTGCCCGGG + Intronic
1185150942 22:49163701-49163723 ACCCAAGAACTCCAGTGCCCAGG - Intergenic
949345111 3:3069176-3069198 AACCAAGCACAGGTGTGCCCTGG - Intronic
953779783 3:45857461-45857483 ACACAAGTAAACGTGTGCCATGG - Intronic
954535226 3:51354882-51354904 AACAAAGAATACGTGTGCCGTGG + Exonic
956089460 3:65650377-65650399 TCCTAAAAACACGTGTGCACAGG - Intronic
957390903 3:79567333-79567355 ACCCAGGAAAACATGTGTCCTGG - Intronic
957430315 3:80096441-80096463 ACCCAAGATCACTTGAACCCAGG + Intergenic
962087191 3:132204166-132204188 ACCCAAGAACACGTGTGCCCAGG + Intronic
963417566 3:145017059-145017081 ACCCAAGAATACGTCTAACCAGG + Intergenic
966121615 3:176528058-176528080 ATACAAGCACACGTGTGGCCTGG - Intergenic
966944711 3:184769748-184769770 TCCCAAGAACAGGTGTGACCAGG - Intergenic
967544816 3:190712667-190712689 ACTAAAGAAGATGTGTGCCCTGG + Intergenic
974673548 4:65061957-65061979 TCACAGAAACACGTGTGCCCAGG - Intergenic
976546131 4:86337737-86337759 ACCCAAGAACAGATGTGCTGAGG + Intronic
981324445 4:143429545-143429567 TCCCAAGAACATGTGGGTCCTGG + Intronic
982585130 4:157226836-157226858 AACCATGAACACATGTGCCAGGG + Intronic
982663497 4:158232934-158232956 ACCAAATAACACGTGTTCCATGG + Exonic
986321720 5:6637076-6637098 ACCCAAGAACCCAAGCGCCCTGG - Intronic
989397417 5:40972614-40972636 ATCCAAGGACACTTGTACCCAGG + Intronic
997669780 5:135661281-135661303 AAGCAAGAACACCTGTGCCCAGG + Intergenic
1001672097 5:173482014-173482036 AGCCAAGAGCAGGTATGCCCAGG - Intergenic
1002723204 5:181278277-181278299 ACCCTTGCACAAGTGTGCCCTGG + Intergenic
1002775149 6:322298-322320 TCCCAAGATCACGTGTTCACAGG - Intronic
1003774795 6:9348266-9348288 ACCCAAGAATATGTATGCACAGG + Intergenic
1007717808 6:43867447-43867469 ACCCTAGAGCAGGTTTGCCCTGG + Intergenic
1008584227 6:52934458-52934480 ACCACAGAACTCGTGTGCCCTGG - Intergenic
1012571677 6:100737281-100737303 ACATAAGAAAACGTGTGCCATGG + Intronic
1013022442 6:106233020-106233042 ACCAAAGGACAAGAGTGCCCAGG - Intronic
1019135959 6:169907848-169907870 ACCCCAGAACACTTGCCCCCAGG - Intergenic
1021134887 7:16953573-16953595 ACCCAAGAATAGGTGTCACCTGG - Intergenic
1025211400 7:57021075-57021097 ACCCAGGAACACCCGTCCCCAGG - Intergenic
1029022232 7:97376985-97377007 ACCCAAGAACATGTTCACCCAGG + Intergenic
1029363229 7:100101627-100101649 ACAAAAGAACGCGTGTGCGCTGG - Exonic
1031814652 7:126418336-126418358 ACCCATAAGCATGTGTGCCCTGG - Intergenic
1033320630 7:140336331-140336353 GCCCAAGATCACCTGAGCCCAGG + Intronic
1038833288 8:31087623-31087645 ACAAAAGAACATGTGTGCTCCGG - Intronic
1047588657 8:126302763-126302785 ACCCCAGAACAGGAGTGTCCAGG - Intergenic
1047588672 8:126302818-126302840 ACCCCAGAACAAGAGTGTCCAGG - Intergenic
1049403215 8:142440105-142440127 CCCCAAGACCTCGTGAGCCCTGG - Intergenic
1049488537 8:142878939-142878961 ACCCAAAAGCACATCTGCCCTGG - Intronic
1049493432 8:142916959-142916981 ACCCAAAAGCACATCTGCCCTGG - Intronic
1049654191 8:143790621-143790643 TCCCAATAAAACGTGTGCCCCGG + Intergenic
1051653009 9:19349031-19349053 ACCTAGGAACACTTGAGCCCAGG - Intronic
1052379583 9:27755615-27755637 ACCCAGGTAAACCTGTGCCCTGG - Intergenic
1188721359 X:33527328-33527350 ACCCAGGAAAACTTGTGCCATGG - Intergenic
1196634203 X:117982095-117982117 ACAAAAGAACACATGTTCCCTGG + Intronic