ID: 962090815

View in Genome Browser
Species Human (GRCh38)
Location 3:132242350-132242372
Sequence GTGGCATCCCAGACAGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 279}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962090815 Original CRISPR GTGGCATCCCAGACAGTGGG TGG Intronic
900006233 1:54977-54999 GTGGCATCCAGGAAAGTAGGAGG - Intergenic
900497365 1:2982134-2982156 GTGGCAGGCCAGCCAGTGTGCGG + Intergenic
900719828 1:4168346-4168368 GTGCCAACCCAGACTGAGGGTGG + Intergenic
901100597 1:6715814-6715836 CTCACATCCCAGACAATGGGCGG + Intergenic
902213459 1:14920376-14920398 GGGGCAGTCCAGACAGGGGGTGG - Intronic
902465155 1:16613080-16613102 GTGGCATCCCAGGGGGTGGAGGG - Intronic
902492059 1:16790084-16790106 GAGGCATCCCTGAGAGAGGGAGG - Intronic
902827797 1:18989033-18989055 TTGGCCTCCCTCACAGTGGGTGG + Intergenic
903155652 1:21440591-21440613 GTGGCATCCCAGGGGGTGGAGGG + Intronic
904464787 1:30701352-30701374 CTGGGATCCCAGACAGCAGGAGG - Intergenic
905022130 1:34825366-34825388 GTGGAAAACAAGACAGTGGGTGG + Intronic
905224179 1:36468289-36468311 GTGGCTTCCCAGACACTGTGGGG + Intronic
905626813 1:39494891-39494913 GTGGAAGCCCAGGCTGTGGGTGG + Intronic
905670129 1:39785928-39785950 GTGGAAGCCCAGGCTGTGGGTGG - Intronic
905920354 1:41715096-41715118 GAAGCAGCCCAGGCAGTGGGGGG - Intronic
906049158 1:42856472-42856494 GTGGCAATCCAGAGAGAGGGTGG - Intergenic
906147878 1:43570643-43570665 CTGGCATCCCAGGGAGTGGGAGG - Intronic
906922982 1:50084585-50084607 GTGGCATACAAGACAGAAGGGGG - Intronic
907216697 1:52870285-52870307 CTCACATCCCAGACAATGGGCGG + Intronic
907736006 1:57112816-57112838 GTGGCATACTAGACAGTAGGGGG + Intronic
908850042 1:68366680-68366702 GGGGCATCCAGGGCAGTGGGAGG + Intergenic
913246080 1:116871236-116871258 TAGGCACTCCAGACAGTGGGCGG - Intergenic
913582973 1:120245582-120245604 GTGGCCTCTCAAACAGTGAGGGG - Intergenic
913600306 1:120415523-120415545 GTGGCATCCCAGGGGGTGGAGGG + Intergenic
913625199 1:120652778-120652800 GTGGCCTCTCAAACAGTGAGGGG + Intergenic
914192650 1:145425081-145425103 GTGGCATCCCAGGGGGTGGAGGG - Intergenic
914361463 1:146939232-146939254 GTGGCATCCCAGGGGGTGGAGGG + Intronic
914491143 1:148151478-148151500 GTGGCATCCCAGGGGGTGGAGGG - Intronic
914564904 1:148857078-148857100 GTGGCCTCTCAAACAGTGAGGGG - Intronic
914590560 1:149103030-149103052 GTGGCATCCCAGGGGGTGGAGGG - Intronic
914607922 1:149273164-149273186 GTGGCCTCTCAAACAGTGAGGGG + Intergenic
914940071 1:152014727-152014749 GTGGCAGCCCAGAGGATGGGAGG + Intergenic
914951759 1:152121775-152121797 GAGGCATTCCAGGCAGTGTGAGG + Intergenic
915992527 1:160531861-160531883 CTGACATCCCAGACAATGGGCGG - Intergenic
916687335 1:167159130-167159152 GTGCCATCAGAAACAGTGGGCGG - Intergenic
917207112 1:172587939-172587961 GTGGCATACAGGAGAGTGGGGGG - Intronic
918702003 1:187617111-187617133 CTCACATCCCAGACAATGGGTGG - Intergenic
921132597 1:212232583-212232605 GTGCCAACCCAGACTGAGGGTGG + Intergenic
921901453 1:220455769-220455791 GTGGCTTCACAGCCACTGGGAGG + Intergenic
922436888 1:225615498-225615520 CTCACATCCCAGACAATGGGCGG - Intronic
923528387 1:234792453-234792475 GAGGCATCCCTGAGAGAGGGAGG + Intergenic
923710700 1:236386368-236386390 CTCACATCCCAGACAATGGGCGG - Intronic
923722320 1:236477551-236477573 GTGGAATTCCAGACAGGGGCCGG + Intronic
923793068 1:237127769-237127791 CTCACATCCCAGACAATGGGCGG + Intronic
924831567 1:247600978-247601000 GGGGCCTCCCAGAGAGTGGAGGG + Intergenic
1062777305 10:163229-163251 GTTGCTTCCCAGGTAGTGGGGGG - Intronic
1062893802 10:1087266-1087288 GTGGCACCCCAGCCAGTCTGTGG - Intronic
1065703065 10:28444261-28444283 GTGTCAGGCCAGCCAGTGGGTGG + Intergenic
1066026239 10:31362587-31362609 GTCGCTTCCCAGACAGGGCGGGG + Intronic
1066425029 10:35300296-35300318 GTGGCATCTCAGGCAGGGCGTGG - Intronic
1067333928 10:45346634-45346656 CTCACATCCCAGACAATGGGCGG - Intergenic
1067389738 10:45852166-45852188 CTGTAATCCCAGACTGTGGGAGG - Intronic
1067689679 10:48493725-48493747 CTGGGATCCCCGCCAGTGGGAGG + Intronic
1067873526 10:49983890-49983912 CTGTAATCCCAGACTGTGGGAGG + Intronic
1068967634 10:62929061-62929083 CTCACATCCCAGACAATGGGTGG + Intergenic
1072013539 10:91323830-91323852 CTCGCATCCCAGACGATGGGCGG + Intergenic
1073419086 10:103409440-103409462 GAGGACTCCCAGAGAGTGGGAGG + Intronic
1073603384 10:104868596-104868618 ATGGCATCTCAGCCAGTGGCAGG + Intronic
1073713067 10:106067908-106067930 GTGGCTTACCAGAGACTGGGTGG + Intergenic
1074268055 10:111925401-111925423 GTGGCATACCAGACTGTAGCGGG + Intergenic
1075108620 10:119559975-119559997 CTCGCATCCCAGACAATGGGCGG + Intergenic
1075157471 10:119990017-119990039 GTGGCATCAGAGGCTGTGGGAGG + Intergenic
1075157505 10:119990177-119990199 GTGGCATCAGAGGCTGTGGGGGG + Intergenic
1076518395 10:131062877-131062899 GAGGCATCCCAGGCAGAGGAGGG + Intergenic
1076687452 10:132204494-132204516 CTGGCCTCCCAGACAGTGCCGGG - Intronic
1076914411 10:133414706-133414728 CTCACATCCCAGACAATGGGCGG + Intronic
1077192160 11:1260139-1260161 AGGGCATCCCAGACAGGGGTTGG - Intronic
1077367277 11:2166288-2166310 GTGGCAGCACAGGCCGTGGGAGG + Intronic
1080942567 11:36936311-36936333 TTGGGAGCCCAGCCAGTGGGAGG + Intergenic
1081726108 11:45330503-45330525 GAGGCATCACAGACTGTGGCTGG - Intergenic
1083235106 11:61346124-61346146 GTCACATCCCAGGCAGTGTGCGG - Intronic
1083255344 11:61491952-61491974 GTGACAGCCCAGACCGTGGGTGG + Intergenic
1084088193 11:66864388-66864410 GTGGGCTCCCAGACAGCGAGGGG + Intronic
1089008689 11:115114367-115114389 GCGGCTTCCCAGACACTTGGAGG - Intergenic
1089568761 11:119388251-119388273 GTGACAGCACAGACAGTGGTGGG - Intergenic
1089844078 11:121444708-121444730 GAGGCATCCAAGACAGATGGGGG + Intergenic
1090322820 11:125862663-125862685 CTCACATCCCAGACAATGGGCGG - Intergenic
1090364027 11:126191507-126191529 CTGGCATCCCAGGCAGTGACTGG - Intergenic
1095225437 12:39672343-39672365 GTGGCAGCAGAGGCAGTGGGTGG + Intronic
1095239773 12:39843712-39843734 GTGGCATCCCAGAATGGTGGAGG + Intronic
1095402546 12:41831699-41831721 CTGTAATCCCAGACATTGGGAGG + Intergenic
1096748691 12:53745143-53745165 GTTGCATACCAGGCAGCGGGGGG - Intergenic
1097138438 12:56879191-56879213 CTCACATCCCAGACAATGGGTGG - Intergenic
1098375152 12:69807183-69807205 CTCACATCCCAGACAGTGGGCGG + Intronic
1099088433 12:78276579-78276601 TTGGCATTCCTGAAAGTGGGGGG - Intergenic
1099935495 12:89119997-89120019 GTGGCTTGCAAGACACTGGGTGG + Intergenic
1101345614 12:103883327-103883349 GTGGCATTCCAGAGAGAGGAGGG - Intergenic
1103704749 12:122865480-122865502 GTGGCATCCCCGACAGCGGCCGG + Exonic
1104187815 12:126449338-126449360 GTGGCTTCCAAGATGGTGGGTGG + Intergenic
1105921852 13:24970728-24970750 CTCACATCCCAGACAATGGGTGG + Intergenic
1106101499 13:26697682-26697704 GTGGCATCCCAGGGTTTGGGGGG - Intergenic
1107165754 13:37280108-37280130 CTCACATCCCAGACAATGGGCGG - Intergenic
1112682962 13:101788127-101788149 CTGTCATCCCAGACTTTGGGAGG - Intronic
1113662312 13:112116078-112116100 GTCGCGTCCCAGACATTTGGAGG + Intergenic
1115547377 14:34475916-34475938 CTCACATCCCAGACAATGGGCGG - Intergenic
1115622400 14:35152931-35152953 CTCGCATCCCAGACGATGGGCGG + Intronic
1118440180 14:65804936-65804958 GTGGAAGCCAAGGCAGTGGGTGG - Intergenic
1118613525 14:67559764-67559786 GAGGCACCCTAGACAGTAGGGGG - Intronic
1118730063 14:68659701-68659723 GTCGCTTCCCAGGCAGAGGGAGG - Intronic
1119737877 14:76995527-76995549 GGGGCTTCCCAGGCAGTTGGGGG - Intergenic
1119764970 14:77182285-77182307 GTCCCAGCCCAGAGAGTGGGCGG - Intronic
1121605559 14:95237524-95237546 CTGGCCTCCCGGACAGTGGATGG - Intronic
1122262480 14:100531225-100531247 GGGGTATCCCAGACAGAGGGAGG + Intergenic
1122502574 14:102211029-102211051 GTGGCTTCCTCGGCAGTGGGAGG + Intronic
1123429767 15:20204321-20204343 CTCACATCCCAGACAATGGGCGG + Intergenic
1123527926 15:21120477-21120499 GTGACACCCCAGGCAGGGGGGGG + Intergenic
1126597574 15:50397630-50397652 GTGGAGTGCCTGACAGTGGGGGG + Intergenic
1126980839 15:54241003-54241025 GAGGCTTACCATACAGTGGGAGG + Intronic
1127072820 15:55302529-55302551 CTCGCATCCCAGACGATGGGCGG - Intronic
1132410158 15:101571389-101571411 GTGGCTTCCCAGCCAGGGTGGGG - Intergenic
1132447287 15:101935981-101936003 GTGGCATCCAGGAAAGTAGGAGG + Intergenic
1134096266 16:11420936-11420958 CTGTCATCCCAGAGGGTGGGTGG - Intronic
1137350829 16:47712744-47712766 CTGGTGTCCCAGGCAGTGGGTGG - Intergenic
1137671475 16:50281999-50282021 GTGGCGTCCCAGGCAGGGTGTGG + Intronic
1138426018 16:56932433-56932455 GTGGCATCCCCAGCAGAGGGCGG - Intronic
1140744079 16:77965629-77965651 GTGGCATCCCAGACTGGGTGTGG + Intronic
1141205897 16:81932912-81932934 GTGGCATCAGAGACACTGGAGGG - Intronic
1141728809 16:85808515-85808537 CTCGCATCCCAGACGATGGGCGG + Intergenic
1143634445 17:8156374-8156396 GTGGCAGCCCGGCCCGTGGGCGG - Intronic
1144113776 17:12065689-12065711 CTGTAATCCCAGACTGTGGGAGG - Intronic
1144360842 17:14490624-14490646 GGGGCCTGTCAGACAGTGGGGGG - Intergenic
1144509947 17:15867240-15867262 CTCACATCCCAGACAATGGGCGG - Intergenic
1144536292 17:16095020-16095042 CTCACATCCCAGACGGTGGGCGG - Intronic
1144573929 17:16417171-16417193 CTGGGCTCCCACACAGTGGGTGG + Intronic
1145002806 17:19317396-19317418 GTCCCAGCCCAGGCAGTGGGCGG - Intronic
1145717108 17:27033568-27033590 CTCACATCCCAGACAATGGGCGG - Intergenic
1145927492 17:28659115-28659137 CTCACATCCCAGACAATGGGCGG + Intronic
1145990110 17:29074241-29074263 GCTGCATCCCTGAGAGTGGGAGG - Exonic
1146731373 17:35195554-35195576 CTCACATCCCAGACAATGGGCGG + Intergenic
1146849771 17:36212070-36212092 GTGGCAGCCGAGACAGAAGGGGG + Intronic
1147170753 17:38617425-38617447 GTGCCCTCCCAGCCTGTGGGTGG + Intergenic
1147285638 17:39401234-39401256 CTGGCAGCCCCGCCAGTGGGTGG + Intronic
1149258157 17:54850257-54850279 GTGGGATTCCACACATTGGGAGG - Intergenic
1150780353 17:68116520-68116542 CTCGCATCCCAGACGATGGGCGG + Intergenic
1151962025 17:77410555-77410577 GCGGCAGCCCAGGCAGTGTGAGG - Intronic
1152590485 17:81209151-81209173 GTGGCCTCAAAGGCAGTGGGTGG + Intronic
1152672617 17:81618112-81618134 GTCACATCCCAGACGATGGGCGG - Intronic
1153181727 18:2442660-2442682 ATGGAAACCCAGACAGTGGGAGG - Intergenic
1154420170 18:14222629-14222651 CTCACATCCCAGACAATGGGCGG - Intergenic
1154943515 18:21137865-21137887 CTCACATCCCAGACAATGGGTGG + Intergenic
1157557152 18:48620311-48620333 GTGGCATCCCTGACCTTGGAGGG + Intronic
1157778573 18:50417816-50417838 CTCACATCCCAGACAATGGGCGG + Intergenic
1158906546 18:62018708-62018730 AAGGCCTCCCAGACTGTGGGTGG + Intergenic
1159518479 18:69488361-69488383 GTAGCAGCCCAAACAGAGGGAGG - Intronic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1160228472 18:77028951-77028973 GCTCCATCCCAGACAATGGGCGG + Intronic
1160465492 18:79072937-79072959 GTCACATCCCAGACGATGGGCGG + Intronic
1160465551 18:79073169-79073191 CTCACATCCCAGACAATGGGTGG + Intronic
1160637989 19:96552-96574 GTGGCATCCAGGAAAGTAGGAGG - Intergenic
1160979845 19:1811927-1811949 GGGGCATCCCAGTTAGTGAGGGG - Intronic
1161667921 19:5588218-5588240 CTAGCATCCCAGCCAGGGGGAGG - Intronic
1161678892 19:5669072-5669094 GTGGCATCCCTGTCAGGGTGTGG + Intergenic
1161977995 19:7616660-7616682 GTGGCTTCCCAGAGCCTGGGAGG + Intronic
1162053745 19:8050702-8050724 GTGGGATTTAAGACAGTGGGCGG - Intronic
1162059458 19:8085954-8085976 GAGGGCTCCCAGACAGTGGGAGG + Intronic
1162753177 19:12841113-12841135 ATGGCGGCCCAGACAGTGGTTGG - Intronic
1164016481 19:21259827-21259849 CTCACATCCCAGACAATGGGCGG + Intronic
1165434656 19:35789352-35789374 GAGGCTTCCCACACACTGGGAGG - Intergenic
1166611621 19:44203784-44203806 CTCACATCCCAGACAATGGGCGG - Intergenic
1166740018 19:45108895-45108917 CTGTCATCCCAGACTTTGGGAGG - Intronic
1167579791 19:50334677-50334699 GTGACATGCCAGAGAGTGGTGGG - Intronic
1167924427 19:52811347-52811369 CTCACATCCCAGACAATGGGCGG - Intronic
925752092 2:7097793-7097815 CAGGCATCACAGCCAGTGGGAGG + Intergenic
926188063 2:10707167-10707189 GTGGCTTCCAAGGCAGTGGCAGG + Intergenic
927737441 2:25535669-25535691 CTCACATCCCAGACAATGGGCGG + Intronic
927737603 2:25536244-25536266 CTCACATCCCAGACAATGGGCGG + Intronic
927755564 2:25705540-25705562 CTCACATCCCAGACAATGGGCGG - Intergenic
928118466 2:28564710-28564732 CTGGCCTCCCAGGCAGTTGGGGG - Intronic
929600962 2:43204285-43204307 GAGGCTGCCCAGCCAGTGGGTGG + Intergenic
931442172 2:62297815-62297837 GTGGCATTCCAGAGAGAGCGTGG + Intergenic
931693248 2:64852990-64853012 TTGGCAACCCAGTCTGTGGGAGG - Intergenic
931923224 2:67043543-67043565 ATGCCATGCCAGTCAGTGGGTGG - Intergenic
932624845 2:73289261-73289283 GAGGAAACGCAGACAGTGGGTGG - Intergenic
933588561 2:84206698-84206720 GTGGCATCGCAAACAGTGATTGG - Intergenic
933665737 2:84963461-84963483 GTGGTATCCCAGAAAATGAGAGG + Intergenic
937670471 2:124532688-124532710 GTCACATCTCAGACTGTGGGCGG - Intronic
938082205 2:128376268-128376290 GTGGCAGTCCAGAAGGTGGGAGG + Intergenic
938579907 2:132636377-132636399 GTGGGCTCCCAGACCCTGGGAGG - Intronic
938941797 2:136176079-136176101 TTGGCATGCCAGGAAGTGGGTGG + Intergenic
940673399 2:156698384-156698406 GTGGCTTCCCTGACAGTGAGTGG - Intergenic
943275667 2:185864715-185864737 AGGGAATGCCAGACAGTGGGCGG + Intergenic
943411641 2:187556355-187556377 CTCACATCCCAGACAATGGGCGG - Intronic
943451195 2:188044373-188044395 GTGCCCACCCAGACAGAGGGTGG - Intergenic
944789044 2:203105111-203105133 CTGGGATCCCAGACTTTGGGAGG - Intronic
945530731 2:210950596-210950618 CTCGCATCCCAGACCATGGGTGG - Intergenic
945864910 2:215163800-215163822 CTCACATCCCAGACAATGGGTGG + Intergenic
948884036 2:240874191-240874213 TTGGCCTCCCAGAGGGTGGGCGG - Intronic
948911948 2:241009316-241009338 GTGGACACCCAGACAGTGTGGGG + Intronic
1169125497 20:3124578-3124600 CTCACATCCCAGACAATGGGTGG - Intronic
1171189803 20:23150937-23150959 GTGCCATGACAGCCAGTGGGTGG + Intergenic
1172562747 20:35904064-35904086 GTGGAATTTCAGACAGTGTGGGG + Intronic
1172910706 20:38407293-38407315 CTCACATCCCAGACAATGGGCGG - Intergenic
1172916251 20:38446264-38446286 ATGGCAGCCCAGACAGGGGTCGG - Intergenic
1174595188 20:51678311-51678333 GTGGCATTCCTGAGAGTGAGGGG - Intronic
1175195552 20:57240977-57240999 GTGGCAGCCAGGCCAGTGGGAGG - Intronic
1175291627 20:57879731-57879753 TTGGGACCCCAGAGAGTGGGAGG + Intergenic
1175874670 20:62223717-62223739 GTGGCAGCCCAGACCCTGGTGGG - Intergenic
1177147266 21:17420294-17420316 CTGGCAACCAAGACAGTGGTAGG - Intergenic
1177897556 21:26872362-26872384 GTGACTTCCCAGACACTGGTGGG + Intergenic
1180218158 21:46339673-46339695 GTGGCAACCCAGATTGAGGGTGG + Intronic
1181296897 22:21847451-21847473 TTCACATCCCAGACAATGGGCGG - Intronic
1181350815 22:22256666-22256688 GTGACACCCCAGGCAGTGGGGGG + Intergenic
1181729417 22:24833798-24833820 AAGGCATGCTAGACAGTGGGAGG + Intronic
1184428865 22:44429331-44429353 GAGGCATCCCAAACAGAGGTAGG + Intergenic
1184736223 22:46399225-46399247 GTGGTATCCCAGACAATGTTCGG - Intronic
1185283785 22:49990132-49990154 CTCACATCCCAGACAATGGGCGG + Intergenic
949106879 3:210391-210413 GTGGTATCTCAGAGAGTGGCTGG + Intronic
949655039 3:6208156-6208178 GTGGCATCCCAGAGAGGGCATGG + Intergenic
952088264 3:29853145-29853167 GTGGCCTCTCAGAGAGTGGAGGG + Intronic
953640564 3:44703311-44703333 GTGGCATTCCAGAGAGGCGGGGG - Intergenic
955256664 3:57338739-57338761 CTCACATCCCAGACAATGGGTGG - Intronic
958020629 3:87990830-87990852 GTGCCAGCCCAGACAGAGTGAGG - Exonic
960861924 3:122164147-122164169 CTCACATCCCAGACAATGGGCGG - Intergenic
962090815 3:132242350-132242372 GTGGCATCCCAGACAGTGGGTGG + Intronic
965644385 3:170864792-170864814 AGGGCATTCCAGACAGAGGGAGG - Intergenic
965938338 3:174144067-174144089 GTGGCATGTCAGAGGGTGGGAGG - Intronic
967973035 3:195013152-195013174 GTGGCATCCCAGGCAGTCCCCGG + Intergenic
968517522 4:1021148-1021170 GTGGGGACCCAGACAGGGGGTGG + Intronic
969947653 4:10801029-10801051 GAGGAATCCCAGACATTGTGAGG - Intergenic
970692545 4:18636050-18636072 GTGGCATCCTACACAGTTAGAGG - Intergenic
972304660 4:37820286-37820308 CTCACATCCCAGACAATGGGCGG - Intergenic
972690481 4:41392772-41392794 CTGTCATCCCAGCCTGTGGGAGG + Intronic
972939671 4:44181702-44181724 CTGGCATCCCAGACAATGGGCGG - Intronic
973593336 4:52464559-52464581 CTCACATCCCAGACAATGGGCGG - Intergenic
974848728 4:67381241-67381263 CTCACATCCCAGACAATGGGCGG - Intergenic
974848813 4:67381541-67381563 CTCACATCCCAGACAATGGGCGG - Intergenic
976340947 4:83944202-83944224 CTCACATCCCAGACAATGGGCGG + Intergenic
979482809 4:121238437-121238459 CTCACATCCCAGACAATGGGCGG - Intergenic
981994761 4:150963640-150963662 CTCGCATCCCAGACGATGGGCGG - Intronic
985591337 5:766974-766996 GTGGTCTCCCTGACAGTGGGTGG - Intergenic
985791586 5:1931113-1931135 CTGGCATTTCAGCCAGTGGGAGG + Intergenic
988950580 5:36254984-36255006 TTGGCATCCCAGACATGGGATGG - Intronic
989534296 5:42546305-42546327 GTTGGATCCCAGACAATGAGGGG - Intronic
990025065 5:51178085-51178107 GTAGCATTTCAGACAGTGTGGGG - Intergenic
991672675 5:69063236-69063258 CTCACATCCCAGACAATGGGCGG + Intergenic
991935412 5:71794807-71794829 CTCACATCCCAGACAATGGGCGG + Intergenic
992226206 5:74621584-74621606 CTGGCATCCCACACAGTTGGAGG + Intergenic
992977927 5:82139297-82139319 CTCACATCCCAGACAATGGGCGG - Intronic
997565379 5:134882383-134882405 CTCACATCCCAGACAATGGGCGG + Intronic
997879476 5:137576594-137576616 GTGGCAGGCAAGACAGTGTGTGG + Intronic
998133085 5:139660870-139660892 CTGGCCTCCCAGCCAGTGGGTGG - Intronic
998990028 5:147805523-147805545 CTGTAATCCCAGACATTGGGAGG - Intergenic
999177045 5:149639007-149639029 GTAGCATCTCTGACAGTGGCCGG + Intergenic
1000519389 5:162278763-162278785 GTGGCATCCCGCACAGATGGGGG + Intergenic
1004507448 6:16258523-16258545 GTGGCTTCCCAGACAGCTGTGGG - Intronic
1006014233 6:31067552-31067574 CTCACATCCCAGACAATGGGCGG + Intergenic
1007243532 6:40443788-40443810 GTGGCATAGCACCCAGTGGGTGG + Intronic
1007337267 6:41162743-41162765 GTGGCATCCCAGGCACTAGCTGG - Intronic
1008936700 6:56999869-56999891 CTCACATCCCAGACAATGGGCGG - Intronic
1009385320 6:63079744-63079766 GGGGCATCCAAGGAAGTGGGAGG + Intergenic
1009844783 6:69121804-69121826 CTCACATCCCAGACAATGGGCGG + Intronic
1012616466 6:101284374-101284396 GTGCCATCCCAGAGAGATGGAGG - Intergenic
1016837116 6:148488906-148488928 AAGGCATCCCACAGAGTGGGAGG - Intronic
1018015001 6:159704257-159704279 GGGGCTTGTCAGACAGTGGGTGG + Intronic
1018196685 6:161361594-161361616 GTGGTATCCCTGACAGTGGTGGG + Intronic
1018295238 6:162338707-162338729 CTCACATCCCAGACAATGGGCGG - Intronic
1020831633 7:13102409-13102431 CTCGCATCCCAGACGATGGGCGG - Intergenic
1021493517 7:21246649-21246671 CTCACTTCCCAGACAGTGGGGGG + Intergenic
1022542724 7:31153509-31153531 CTCACATCCCAGACAATGGGCGG - Intergenic
1023621106 7:42074110-42074132 TTGGCATTCCAGGCAGTGGGGGG - Intronic
1024094019 7:45970131-45970153 GTGGCTGCCCAGGCAGGGGGTGG + Intergenic
1024910719 7:54444247-54444269 CTCACATCCCAGACAGTGGGCGG - Intergenic
1026007956 7:66614524-66614546 CTCGCATCCCAGACGATGGGCGG - Intergenic
1027826739 7:83125209-83125231 CTCACATCCCAGACAATGGGCGG - Intronic
1029525637 7:101092243-101092265 CTCACATCCCAGACAATGGGCGG - Intergenic
1030692621 7:112551471-112551493 CTCACATCCCAGACAATGGGCGG - Intergenic
1032056589 7:128689256-128689278 CTCGCATCCCAGACGATGGGCGG - Intergenic
1032129506 7:129216573-129216595 CTCACATCCCAGACGGTGGGTGG - Intergenic
1032179529 7:129663439-129663461 CTCACATCCCAGACAATGGGCGG + Intronic
1034135228 7:148761830-148761852 TTGGCATCACAGACGGTGGCTGG + Intronic
1035280221 7:157773658-157773680 GAGGCAACACAGACAGAGGGAGG - Intronic
1036527764 8:9551139-9551161 GTGGCAGCCCAGGCAGTGAGAGG - Intergenic
1036696561 8:10979000-10979022 GAGGCATTCCAGGCAGGGGGTGG - Intronic
1037549490 8:19956605-19956627 GGGGCCTCCCAGAGGGTGGGAGG - Intronic
1040043590 8:42940023-42940045 CTCACATCCCAGACGGTGGGCGG + Intronic
1042324762 8:67517051-67517073 CTGGAATCCCAGACTTTGGGAGG - Intronic
1044529896 8:93294991-93295013 GTGGCATCCCAGACAGAACAGGG + Intergenic
1047740771 8:127804660-127804682 GTGGCATCCCAGCTACTCGGAGG - Intergenic
1047848238 8:128827007-128827029 CTCACATCCCAGACAATGGGCGG + Intergenic
1048206603 8:132420409-132420431 GTGGCAGCCCAGAAGGTGGATGG - Intronic
1048385474 8:133908741-133908763 GTGGCATCCCACACTGTGAGTGG - Intergenic
1049482956 8:142835384-142835406 GGGGAATCACAGACAGTGTGGGG - Intronic
1052236281 9:26215438-26215460 CTCACATCCCAGACAATGGGCGG + Intergenic
1052703170 9:31961691-31961713 TTGGCATCCCTGAAAGGGGGAGG + Intergenic
1055582897 9:77726800-77726822 GAGGCAACACAGACAGTGAGTGG + Intronic
1055730483 9:79275390-79275412 CTGGCATGGCAGCCAGTGGGGGG + Intergenic
1056089639 9:83192544-83192566 GTGGCCTACCAGACAGTGAAGGG + Intergenic
1056097743 9:83272561-83272583 CTGACATCCCAGACGATGGGCGG - Intronic
1058049716 9:100393256-100393278 CTCACATCCCAGACAATGGGCGG - Intergenic
1059118189 9:111617762-111617784 CTCGCATCCCAGACGATGGGCGG + Intergenic
1059421703 9:114196356-114196378 ACGGCCTCTCAGACAGTGGGTGG - Intronic
1060238381 9:121882685-121882707 GAGGCATCCCAGACACAGAGAGG - Intronic
1061143011 9:128779973-128779995 CTCACATCCCAGACAATGGGCGG - Intergenic
1185533675 X:840711-840733 GTGACACCCCAGGCAGTGGGGGG - Intergenic
1186760104 X:12714209-12714231 GTGGCCTCCAAAACTGTGGGAGG - Intronic
1189516462 X:41717798-41717820 GAGGGATCCAAGACAGAGGGTGG + Intronic
1192350008 X:70349258-70349280 CTCACATCCCAGACAATGGGCGG + Intronic
1192350225 X:70350027-70350049 CTCACATCCCAGACAATGGGCGG + Intronic
1193164703 X:78265980-78266002 CTCACATCCCAGACAATGGGTGG + Intergenic
1197724819 X:129769216-129769238 GGGGCATCCAAGAATGTGGGAGG - Exonic
1198021441 X:132662385-132662407 GTGGAATTCCAGACAGTGCCTGG + Intronic
1199452791 X:147992957-147992979 CTCACATCCCAGACAATGGGCGG + Intronic
1199601971 X:149546405-149546427 GTAGCTTCCCAGGCAGTGGCTGG + Intronic
1199648415 X:149933079-149933101 GTAGCTTCCCAGGCAGTGGCTGG - Intronic