ID: 962100588

View in Genome Browser
Species Human (GRCh38)
Location 3:132338172-132338194
Sequence TTGTATATGCATAAGGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 326}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962100588_962100590 25 Left 962100588 3:132338172-132338194 CCAATTTCCTTATGCATATACAA 0: 1
1: 0
2: 0
3: 23
4: 326
Right 962100590 3:132338220-132338242 CTTCTTTTGTTACACGAAAATGG 0: 1
1: 0
2: 0
3: 18
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962100588 Original CRISPR TTGTATATGCATAAGGAAAT TGG (reversed) Intronic
900836989 1:5012617-5012639 TTGTATTTGCATAAGGAAGGGGG + Intergenic
904993009 1:34608879-34608901 TTGAATAGGAATAAGGAAAACGG - Intergenic
905705003 1:40049094-40049116 TTGAATAGGCAGAAGGAATTGGG + Intronic
906443928 1:45876782-45876804 TTGTATAGGTGTAAGGAAGTCGG + Intronic
907848701 1:58233608-58233630 CTGTAATTGTATAAGGAAATAGG + Intronic
909191759 1:72561436-72561458 TTAAATATGCATAACGTAATTGG - Intergenic
910504835 1:87938293-87938315 TTTCATATGCTGAAGGAAATGGG + Intergenic
910904738 1:92163457-92163479 TTGTATATGCATAAAATAACTGG + Intergenic
911503502 1:98718741-98718763 TTGCATATGCATAAAGAAAGTGG - Intronic
916404009 1:164479169-164479191 TTGTATATAAATAAGGTAAATGG + Intergenic
916862271 1:168818852-168818874 TTATAAATGTATAAGGAAAAAGG + Intergenic
916920246 1:169459200-169459222 TTTTATTTGCATTATGAAATAGG + Intronic
921173721 1:212572928-212572950 TTGTATATACAAAAGGTACTTGG + Intronic
922113101 1:222581937-222581959 TTGTATATACATAATGAGACTGG + Intronic
922375295 1:224957933-224957955 TTGGATATGCAAAAGAAAAAAGG + Intronic
923890699 1:238212344-238212366 TTGTATATTCCCAAAGAAATAGG - Intergenic
923891239 1:238217046-238217068 TTGTATATTCCCAAAGAAATAGG - Intergenic
924726271 1:246674108-246674130 TTGATTATTCATAAGGAGATGGG + Intergenic
1063052858 10:2471903-2471925 GTGGATATGCATATGGAATTAGG - Intergenic
1063103266 10:2970118-2970140 TTGCATCTGCAAAAAGAAATAGG + Intergenic
1063738310 10:8788061-8788083 TTCTATATGCATCAAGCAATGGG - Intergenic
1064959342 10:20946237-20946259 TTGTTTCTGCACATGGAAATTGG + Intronic
1065560240 10:26956798-26956820 TTCTATTTGCATAAGGGAAATGG - Intergenic
1065597169 10:27325634-27325656 TTCTATTTGCATAAGGGAAGTGG - Intergenic
1066487103 10:35857051-35857073 TTGATTATTCATAAGGAAAATGG - Intergenic
1067264582 10:44727855-44727877 TTCTAAATTCATAAGGATATTGG + Intergenic
1067304851 10:45053278-45053300 TTGTATATACATGAGGTAAAAGG + Intergenic
1068033016 10:51726636-51726658 GACTATATTCATAAGGAAATTGG - Intronic
1068666820 10:59685065-59685087 TTATAAATGCATAAAGAAACTGG - Intronic
1069203291 10:65650820-65650842 TTGTTTAGGAATAAGGAAAAAGG - Intergenic
1069254201 10:66311755-66311777 TTGTATATGGAAAAGGAATATGG + Intronic
1070759898 10:79017573-79017595 TTGTATATGACTAAGAATATTGG - Intergenic
1072240752 10:93493452-93493474 TTGTGTTTGCATTGGGAAATAGG + Intergenic
1072926077 10:99618776-99618798 TAGAATGTGGATAAGGAAATGGG - Intronic
1073890444 10:108095471-108095493 CTTTAAAAGCATAAGGAAATTGG - Intergenic
1073994186 10:109296305-109296327 CAGTTTATGGATAAGGAAATGGG - Intergenic
1074809344 10:117087303-117087325 TTTAAAATGCATAAGGAAAGGGG + Intronic
1075450120 10:122545315-122545337 TTGAATATGCATGAAGGAATGGG + Intergenic
1077990474 11:7405739-7405761 TAGTATATGTATGAGAAAATGGG + Intronic
1078769336 11:14333550-14333572 TTATATATGCATAGGAAAACAGG - Intronic
1078969152 11:16386509-16386531 GTGTATATGTGTCAGGAAATAGG - Intronic
1079568604 11:21914924-21914946 TTGTGTATGCATTGGGAAAAGGG + Intergenic
1080014006 11:27486174-27486196 TTGTATTTACAGAAGGCAATGGG + Intergenic
1080348630 11:31355971-31355993 CGGTATATCCAAAAGGAAATGGG + Intronic
1082291532 11:50379534-50379556 TAGTATCTGCATAATGATATTGG + Intergenic
1083007986 11:59366978-59367000 TTGTATATTAATAAGCAATTTGG - Intergenic
1083513972 11:63238684-63238706 TTGTGTATGTAGGAGGAAATTGG + Intronic
1084723148 11:70922177-70922199 TAGGAGATGGATAAGGAAATTGG + Intronic
1085393619 11:76194997-76195019 TGGTATATTCAGAAGGAATTGGG - Intronic
1085923934 11:80991808-80991830 TTGTCTATGCACCAGGAAACAGG - Intergenic
1086461973 11:87015022-87015044 GTGTAAATGCATAAAGAAAATGG + Intergenic
1087038440 11:93775899-93775921 TTGTGTATAAATCAGGAAATGGG + Intronic
1088433659 11:109786265-109786287 TGGTACAAGCATAAGGAAATAGG - Intergenic
1088514207 11:110611733-110611755 TTGTATTTCCATAAGGCAATGGG + Intronic
1088636250 11:111823102-111823124 TTTCATTTGCATCAGGAAATGGG + Intronic
1088959214 11:114644537-114644559 TTGTACATGCAGTAGCAAATAGG - Intergenic
1089127605 11:116188002-116188024 TTGTGTATGGATGGGGAAATGGG - Intergenic
1089684899 11:120140383-120140405 ATGAATATGAATAAGGAAATGGG + Intronic
1089815077 11:121165653-121165675 TTTTAGATGCGCAAGGAAATAGG + Intronic
1090451306 11:126808727-126808749 CTATATATGCATGTGGAAATTGG - Intronic
1091565686 12:1646330-1646352 TTATATTTGTATAAGTAAATGGG + Exonic
1092367321 12:7887730-7887752 TAGGATTTGCATAAGGCAATAGG - Intronic
1092868643 12:12786675-12786697 TTATCTCTGCATATGGAAATAGG - Intronic
1093067153 12:14670037-14670059 GTGTATGAGCATAAAGAAATAGG - Intronic
1093375613 12:18423705-18423727 TTGTATATGGATAAGAAATAAGG - Intronic
1094232066 12:28117515-28117537 TCATATGTGCAGAAGGAAATTGG + Intergenic
1094260125 12:28485782-28485804 TTGTAGGTACATATGGAAATAGG - Intronic
1095148983 12:38768236-38768258 TTGTATATGATTAAGAAAGTAGG - Intronic
1096008616 12:48193445-48193467 TTGTACATAACTAAGGAAATGGG + Intergenic
1097763739 12:63499355-63499377 TTGTGTATTCATAGGGCAATAGG - Intergenic
1098414465 12:70216916-70216938 ATGTAAAAGCAAAAGGAAATGGG + Intergenic
1098632049 12:72735643-72735665 TTAGATATCCAAAAGGAAATAGG + Intergenic
1099200078 12:79665952-79665974 TTGCATTTTCACAAGGAAATAGG + Intronic
1099493315 12:83312809-83312831 TTGTATATGCATATATAATTAGG - Intergenic
1103049784 12:117769004-117769026 TAGGAAATGCAGAAGGAAATTGG + Intronic
1104119871 12:125789022-125789044 ATGTATATGTATAAGAAAAAGGG + Intergenic
1107649741 13:42533182-42533204 TTGTATAAGCATGAGTAAAGGGG - Intergenic
1108452846 13:50584867-50584889 TTGTTCATGGATAAGTAAATTGG - Intronic
1109065888 13:57689650-57689672 CTGTATATGCATAATGCAATCGG + Intronic
1109714532 13:66204352-66204374 TTGGAGATGAATAAGGAAGTTGG - Intergenic
1110153445 13:72283663-72283685 TTGTATAGAAATAAAGAAATAGG - Intergenic
1110312323 13:74065084-74065106 GTGTATATGAATCAGGATATGGG - Intronic
1111085651 13:83372515-83372537 TTGTTTATGCAAATGGCAATAGG + Intergenic
1111255651 13:85664009-85664031 TAGTAAATGCATACAGAAATGGG - Intergenic
1112229714 13:97576505-97576527 TTTTAAATTCATAAGGGAATAGG - Intergenic
1112655857 13:101451953-101451975 TTATTTATGCATTAGCAAATGGG - Intergenic
1113008319 13:105733965-105733987 TTGAATATGCATAACAAGATGGG + Intergenic
1113288251 13:108877878-108877900 TTGTATGTAAACAAGGAAATAGG - Intronic
1115503325 14:34068520-34068542 TTGTTTATGAATAAGAAAGTGGG - Intronic
1116149413 14:41120107-41120129 TGGGAAATGCATAAGAAAATAGG - Intergenic
1116581618 14:46649633-46649655 TTGTTTATGCATATAGATATGGG - Intergenic
1117833921 14:59782108-59782130 CTGTCTATGAATCAGGAAATGGG + Intronic
1118654694 14:67934031-67934053 TTGTAGATGTGAAAGGAAATGGG + Intronic
1119178478 14:72587489-72587511 TTTTACCTGCATCAGGAAATGGG - Intergenic
1119434905 14:74592166-74592188 TTAAATATCCAAAAGGAAATCGG + Intronic
1122878900 14:104681172-104681194 TGGCATATGCAGGAGGAAATGGG + Intergenic
1124100522 15:26688933-26688955 TAGGATCTGCATAAGAAAATGGG - Intronic
1124167624 15:27342251-27342273 TTGCATCTGTAAAAGGAAATTGG - Intronic
1124378230 15:29141954-29141976 CTGTAATTGCATAAGGAAATAGG + Intronic
1126343564 15:47669639-47669661 ATATCTATGCATAAGGAGATCGG - Intronic
1126497185 15:49304739-49304761 TTGTATATGAGAAAGTAAATTGG - Intronic
1127105731 15:55612411-55612433 TAGTATATGGATAAGAAAAAAGG + Exonic
1128885858 15:71287246-71287268 TTGTCTTTACAGAAGGAAATGGG + Intronic
1130136424 15:81185277-81185299 TTGTATATTGAAAAGTAAATAGG - Intronic
1130754761 15:86751347-86751369 TTGTATATGCTGTAAGAAATGGG - Intronic
1131789792 15:95951667-95951689 TTGTATTTACAAAAGGAATTTGG - Intergenic
1131948829 15:97657875-97657897 ATGTATTTGCATACAGAAATGGG - Intergenic
1135231196 16:20709666-20709688 CTGTATAAGGATAAGGAAGTGGG - Intronic
1135819661 16:25672045-25672067 TTGTATAATCAAGAGGAAATGGG + Intergenic
1135883369 16:26280931-26280953 TTTTATATGTACAAGGAAGTTGG + Intergenic
1137434186 16:48442113-48442135 TTGTAAAATCATATGGAAATAGG + Intronic
1140290429 16:73649451-73649473 GTGTATATGCATAAAGAGTTTGG + Intergenic
1140656634 16:77147750-77147772 TTATATATGCTTAATGACATAGG + Intergenic
1140960805 16:79910635-79910657 TTCTACATGCATAAGGCAAGGGG - Intergenic
1144023907 17:11260988-11261010 TTGAATATGCCGGAGGAAATGGG - Intronic
1150822737 17:68448590-68448612 TGGTATATTCATTAGCAAATGGG - Intronic
1153445702 18:5170446-5170468 TTATTTAAACATAAGGAAATTGG - Intronic
1154062609 18:11077107-11077129 CTTTATATTCATAATGAAATAGG - Intronic
1155013569 18:21808233-21808255 TTTTATATGCATTAGGAAGTAGG + Intronic
1156131668 18:33983417-33983439 TGGTATGTGCATGTGGAAATAGG + Intronic
1156627840 18:38931192-38931214 TTGTATCTGCATGAGGGATTTGG - Intergenic
1156673995 18:39505706-39505728 GTGTGTATGCATAAGGAATCAGG - Intergenic
1157627790 18:49065879-49065901 TTTTATATGCAAATGGAAAGAGG + Intronic
1157895077 18:51458335-51458357 TAGTTTATAAATAAGGAAATGGG + Intergenic
1157907700 18:51584394-51584416 TTTTTTAAGCACAAGGAAATTGG - Intergenic
1158125729 18:54098020-54098042 TGGATTATGCATAATGAAATTGG + Intergenic
1158510502 18:58086307-58086329 TTGTAGATCCATAAGAAACTTGG + Intronic
925650267 2:6081906-6081928 TTTTATAAGCATTAGGAAACTGG - Intergenic
927220096 2:20698891-20698913 TTTTATATGCTTGAGGAAAATGG - Intronic
927308908 2:21605935-21605957 TGGTTTATAAATAAGGAAATTGG + Intergenic
928790432 2:34944973-34944995 TTGTTTAGGTATAAGGAAAAAGG + Intergenic
928791946 2:34967973-34967995 TTATATATGAATAAAGAAAATGG - Intergenic
930045670 2:47169733-47169755 TTCTATATGCTTATGGAAGTGGG + Intronic
931897666 2:66750914-66750936 ATGTATGTGCATATGTAAATGGG - Intergenic
933244801 2:79963171-79963193 TTTTATTTGCAAAAGTAAATTGG - Intronic
933681006 2:85100700-85100722 GTCTATATGCATAGGGATATTGG - Intergenic
935004615 2:99059986-99060008 ATATATAGCCATAAGGAAATAGG - Intronic
937171973 2:119881463-119881485 TGGTATATGCAGAAAGAAGTGGG - Intronic
937179629 2:119980467-119980489 TTTTATCGGCATTAGGAAATAGG + Exonic
937232657 2:120407308-120407330 TTTTATATGCCTATGTAAATTGG - Intergenic
938968738 2:136411933-136411955 CTTTTTATGCATAAGGAAACAGG + Intergenic
939188051 2:138883480-138883502 TTGTATATAGCTAAGAAAATGGG - Intergenic
939611560 2:144316926-144316948 TTGTTTCCTCATAAGGAAATTGG + Intronic
939785201 2:146501175-146501197 CTGCATATGCATAAAGCAATGGG - Intergenic
939953633 2:148505628-148505650 TTAAATAAGAATAAGGAAATAGG + Intronic
940605592 2:155920449-155920471 TTTTATATATATTAGGAAATGGG - Intergenic
941700809 2:168602739-168602761 TTGTGTATGCATAAAGGAATGGG + Intronic
942652541 2:178183806-178183828 TTTTATATGTATAAGGCAACTGG + Intergenic
943379621 2:187127943-187127965 TTGTCTATGAACCAGGAAATGGG + Intergenic
943626228 2:190203273-190203295 TTGTATTTGAATAACTAAATAGG + Exonic
943694588 2:190911594-190911616 TGGGATATGCAAAAGTAAATGGG + Intronic
945647218 2:212512651-212512673 TGATATATGCAGAATGAAATAGG - Intronic
946459951 2:219860083-219860105 TTTTATATGAATAAATAAATGGG - Intergenic
946511512 2:220361844-220361866 TTTTATATGCAAATGGAAAGAGG - Intergenic
947436423 2:230076729-230076751 TTGTATATGAACCGGGAAATGGG - Intergenic
947779830 2:232749284-232749306 TTGTAGATCCTTAAGGACATTGG + Intronic
948429093 2:237907920-237907942 TAGTATTTACATATGGAAATGGG + Intronic
948546937 2:238739347-238739369 GTGTATATGCAAAAGAAGATAGG - Intergenic
1169612491 20:7397620-7397642 TTGTCTATGGACCAGGAAATGGG + Intergenic
1170079411 20:12455546-12455568 TAGTATCTGCTTAAGGAAACTGG - Intergenic
1171469005 20:25355031-25355053 TTGTATTTGGATCAGGAAACAGG + Intronic
1173372495 20:42449902-42449924 TTTTATATGCATAAAAAGATTGG - Intronic
1174294559 20:49536339-49536361 ATATATAAGCAAAAGGAAATGGG + Intronic
1176901443 21:14446945-14446967 TTTTGTATGCAGAATGAAATGGG - Intergenic
1177823497 21:26057826-26057848 TTGTAAAAGCCAAAGGAAATGGG - Intronic
1178409964 21:32355214-32355236 TTGTTTTTGCATAGGGGAATAGG - Intronic
1178467456 21:32860769-32860791 TTTTATAAGCATTAGGAAATTGG - Intergenic
1178868010 21:36346386-36346408 TATTTTATGCATAAGGAAGTTGG + Intronic
1179374622 21:40839017-40839039 TTGTATATACTTAAGGAACCTGG + Intronic
1179430992 21:41321087-41321109 TTGTATTTGGAGAAGGAAACTGG - Intronic
1180236786 21:46465768-46465790 TTGTCTTTTCATGAGGAAATGGG + Intronic
1180474715 22:15691965-15691987 ATGTATCTGCATATGTAAATAGG - Intronic
1181916787 22:26287841-26287863 TTGTGTATGATTAAGGAAAAGGG + Intronic
1182143338 22:27981414-27981436 TTGTATATGGATAAACAACTTGG - Exonic
949131295 3:504610-504632 TTTTATATCCATAAGCAGATAGG - Intergenic
949523610 3:4880268-4880290 TTTTCTAAGAATAAGGAAATGGG - Intronic
949768152 3:7549987-7550009 TTGGATATGCAAAAAGAAACTGG - Intronic
952285067 3:31960501-31960523 TTGGATCTGAATAAGGAATTTGG - Intronic
952670729 3:35964621-35964643 TTTTATATCCAGAAGGCAATTGG - Intergenic
953266369 3:41392968-41392990 TTGGATATGCATATGGATAGAGG - Intronic
953827781 3:46268984-46269006 TATTATATGGATGAGGAAATTGG - Intergenic
953837037 3:46355824-46355846 TATTTTATGCATAAAGAAATCGG + Intronic
956108771 3:65850127-65850149 TTTTATATATATAAAGAAATAGG - Intronic
956144250 3:66176321-66176343 TTATATAAGCATAAAGAACTAGG + Intronic
957479477 3:80772795-80772817 TTGTATGTGCATTAGGCAAAGGG + Intergenic
957938339 3:86972121-86972143 TTGAATATGCATGCGCAAATGGG + Intronic
958628749 3:96660804-96660826 TTGAATATTTAAAAGGAAATGGG + Intergenic
958815002 3:98904786-98904808 TTCTATATACATAAAGCAATAGG - Intergenic
959647312 3:108717825-108717847 TTGTGGATGTGTAAGGAAATGGG - Intergenic
959769443 3:110074849-110074871 TTGAAGAAGGATAAGGAAATGGG - Intergenic
960480298 3:118179797-118179819 TTATGTATACATTAGGAAATTGG - Intergenic
961126441 3:124422729-124422751 TTCAATATGCATAAGAAAACTGG - Intronic
962100588 3:132338172-132338194 TTGTATATGCATAAGGAAATTGG - Intronic
962528339 3:136255613-136255635 TGGAAGATGAATAAGGAAATAGG - Intronic
963580612 3:147122548-147122570 CTGTATATGCAGAAGGAGAGTGG - Intergenic
964065402 3:152571905-152571927 TTGTGTATGTATAAGTACATTGG - Intergenic
965468084 3:169057355-169057377 ATGTCAATGCAAAAGGAAATAGG + Intergenic
965666422 3:171098434-171098456 TTTTCTATGCATGAGGAATTGGG + Intronic
966509950 3:180751031-180751053 TGGTATATGCACAAGGAGAGAGG - Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967544151 3:190703591-190703613 TTATATATGCATAGTGAAAAAGG - Intergenic
971112603 4:23605842-23605864 CTGTCTATGCATCAGGAAGTGGG - Intergenic
971439931 4:26673352-26673374 TAGAATATGCATAAGAAATTTGG + Intronic
971860568 4:32097824-32097846 ATGTGTAAGCAAAAGGAAATAGG - Intergenic
973344065 4:49035695-49035717 AAGTATATGTATAAGGAAAGAGG - Intronic
973892320 4:55379540-55379562 TGTTATCTGCATAAGTAAATAGG + Intergenic
974284160 4:59842113-59842135 TTATATATATATAAAGAAATTGG + Intergenic
977008940 4:91611146-91611168 TTGTATATTCATTAAAAAATGGG - Intergenic
977095000 4:92730504-92730526 TTGTAAATACATAAAGAAAATGG - Intronic
977211600 4:94224406-94224428 TTGCATATACATAATGAGATTGG + Intronic
977967214 4:103167462-103167484 TTGTATATACATATGAAAAATGG + Intronic
979568091 4:122179688-122179710 ATATATATGCATACAGAAATGGG + Intronic
979806296 4:124976089-124976111 GTGTATTTGCATATGGAAAGTGG - Intergenic
979828364 4:125268631-125268653 TTGTATATGGCGAAAGAAATGGG - Intergenic
980479491 4:133369319-133369341 TTATATATGCATAAGGAACAAGG + Intergenic
980679193 4:136134209-136134231 TTGTACATACATATGAAAATAGG + Intergenic
981269239 4:142824682-142824704 TTGTATCTGAATAAAGAAATGGG - Intronic
981946952 4:150358809-150358831 ATCTATATGGATAAGCAAATGGG - Intronic
982907587 4:161095494-161095516 TTGTATATACTTAAATAAATAGG + Intergenic
983733463 4:171028167-171028189 TTGTGTATGTTCAAGGAAATAGG + Intergenic
984035097 4:174657407-174657429 TTGTATAAGGAGAAGGAAAAAGG + Intronic
984550481 4:181153373-181153395 TTGGATATACAGTAGGAAATGGG - Intergenic
984672053 4:182501583-182501605 TTGCTTCTGGATAAGGAAATGGG - Intronic
985364723 4:189216370-189216392 TTGTGTTTGAATAAGTAAATGGG - Intergenic
987470040 5:18316806-18316828 TTGTATAATCATAAGGCAATTGG - Intergenic
987691853 5:21277174-21277196 TTGTATATGCATATGTATGTAGG - Intergenic
987824783 5:23016507-23016529 TTTTATATGCTTAAAGAAAAAGG - Intergenic
989275568 5:39584440-39584462 TTGTATATGCTTAGGATAATAGG - Intergenic
989766698 5:45093912-45093934 TTGTATATGCATCATAAAAAAGG + Intergenic
989783312 5:45296919-45296941 CTTTATATCCACAAGGAAATTGG + Intronic
989995644 5:50826824-50826846 TTACATATGCATACAGAAATGGG + Intronic
989999359 5:50875132-50875154 TTATAAATGAATGAGGAAATGGG + Intergenic
990690301 5:58356188-58356210 TTACATTTGCAGAAGGAAATAGG - Intergenic
991253126 5:64585748-64585770 TTGTTTATGGATAATGTAATAGG - Intronic
991346020 5:65668984-65669006 TTGTTTATTAATAATGAAATTGG - Exonic
991481751 5:67088757-67088779 TTCTCTATCCATAAAGAAATGGG + Intronic
991574139 5:68085094-68085116 TTTTATATGGAAAAGGAAAGAGG + Intergenic
991748531 5:69772934-69772956 TTGTATATGCATATGTATGTAGG + Intergenic
991800111 5:70352779-70352801 TTGTATATGCATATGTATGTAGG + Intergenic
991828489 5:70657260-70657282 TTGTATATGCATATGTATGTAGG - Intergenic
991892466 5:71352206-71352228 TTGTATATGCATATGTATGTAGG + Intergenic
993357147 5:86928412-86928434 TTTTATATGCATGAGAAAATGGG + Intergenic
993642339 5:90420494-90420516 TTGAATATGAATTAGGAATTCGG + Intergenic
994870395 5:105341714-105341736 TAGTATATGCACAAAGAAAAAGG - Intergenic
994959898 5:106586213-106586235 TTATAAATGCATTAGGAAAAGGG - Intergenic
994994364 5:107041039-107041061 TTGTTTATGATTCAGGAAATGGG - Intergenic
995175383 5:109170520-109170542 TTGTATATGGATACAGAAACAGG - Intronic
996768083 5:127055443-127055465 TTATATAAGCATAAGTAATTTGG - Intronic
998573243 5:143284599-143284621 TTTTATATGCATATTGAATTGGG - Intronic
999642495 5:153685984-153686006 TAGTATTTGCCTAAAGAAATAGG + Intronic
1000516716 5:162244784-162244806 TTGTATATGTACAAGAAAATAGG + Intergenic
1000541296 5:162543262-162543284 TTGCATATGCATCTGGAGATGGG + Intergenic
1001195622 5:169670918-169670940 TTGTATTTGCATAATGTAGTTGG + Intronic
1002870115 6:1159419-1159441 TAATATAAGCATAAGGTAATAGG + Intergenic
1004236127 6:13875664-13875686 TTGTAAATCAATAAGGACATGGG + Intergenic
1005129415 6:22487975-22487997 GTGCATATGCATACAGAAATTGG - Intergenic
1007263536 6:40580577-40580599 TTGTATATGGATGAGGAAACTGG - Intronic
1008112955 6:47512833-47512855 TTGTTTATGCACAGGCAAATAGG - Intronic
1009283747 6:61785539-61785561 GTGTATATGCATATGAAAATTGG + Intronic
1009738132 6:67705804-67705826 TTCTATATGCTAAAGAAAATTGG - Intergenic
1010457518 6:76075364-76075386 TTGTATATTCTTAAAGAGATAGG + Intergenic
1011623414 6:89263838-89263860 GTGTAGCTGCAGAAGGAAATTGG - Intronic
1012272755 6:97235250-97235272 AGGTTTTTGCATAAGGAAATAGG + Intronic
1012310945 6:97723289-97723311 ATGTATATGCCTAAGAATATGGG + Intergenic
1012942320 6:105428283-105428305 ATGTATTTGCATAAGGGAAATGG - Intergenic
1014153201 6:118082776-118082798 TTGGATTTGCTTAAGGGAATAGG - Intronic
1014437739 6:121438961-121438983 TTTTAAAAGCATAGGGAAATTGG - Intronic
1014457972 6:121659392-121659414 TTATATATGCATATGTATATAGG - Intergenic
1014480445 6:121929203-121929225 TTGTTTATAGAAAAGGAAATAGG - Intergenic
1014488103 6:122025913-122025935 TTGTATTTGTTTAAGGAAATTGG + Intergenic
1015147134 6:129999888-129999910 TTGTATCTTCAGAAGGAAAAGGG + Intergenic
1015706956 6:136098562-136098584 TTTTATATGGATAAGTAACTTGG - Intronic
1015884172 6:137899406-137899428 TTGGAGATGCAAAAGTAAATAGG + Intergenic
1015940839 6:138450305-138450327 ATGTGTATGTATCAGGAAATTGG - Intronic
1017119483 6:151010296-151010318 TTGTATAACCATATGGTAATGGG + Intronic
1018813890 6:167316862-167316884 TCATATGTGCAGAAGGAAATGGG + Intergenic
1021120835 7:16793690-16793712 TTATATATACATAATGAAACAGG + Intronic
1021354967 7:19642863-19642885 TTGTTGATACATAAGGATATGGG - Intergenic
1021479974 7:21104953-21104975 TTGTATATGCACTTGGGAATGGG + Intergenic
1021807891 7:24374977-24374999 TCTTATATGAATGAGGAAATTGG - Intergenic
1021809675 7:24391249-24391271 TTGTATATGCAATTGGCAATTGG + Intergenic
1021835451 7:24668478-24668500 TTCTAAATGAAAAAGGAAATGGG - Exonic
1021958106 7:25846683-25846705 TTTTATATCAATAAGGAAAGTGG - Intergenic
1022323701 7:29310698-29310720 CTGTTTATGAATCAGGAAATGGG - Intronic
1022920712 7:35011207-35011229 CTATATATGCATAATAAAATGGG + Intronic
1024607657 7:51035644-51035666 TTGAAAATGTATAAAGAAATAGG + Intronic
1025286012 7:57661772-57661794 ATGTATATGTATATGGAAAAGGG - Intergenic
1025834731 7:65083585-65083607 ATGTATATGCTTAAAGAAATAGG - Intergenic
1025904504 7:65773106-65773128 ATGTATATGCTTAAAGAAATAGG - Intergenic
1026523950 7:71138662-71138684 TTGTACAAGCATTAGGAAAGTGG + Intronic
1028021374 7:85779031-85779053 ATAAATATGCATATGGAAATAGG + Intergenic
1028256556 7:88605519-88605541 TTGTATATGCATAAACAATGTGG + Intergenic
1028720202 7:94021610-94021632 TTCCATATACATAAGGAATTAGG - Intergenic
1029894049 7:103962874-103962896 TTGAATATGCCTGAGAAAATAGG + Intronic
1029958105 7:104660629-104660651 GTATAGAGGCATAAGGAAATAGG + Intronic
1030789082 7:113701068-113701090 GTGTATATCCATAAGAAAAGAGG - Intergenic
1031171451 7:118297130-118297152 TTGTAAATGCATTAGAGAATGGG - Intergenic
1031199765 7:118666270-118666292 GTGTGTATGCACAAGGAAAAAGG + Intergenic
1031204017 7:118730378-118730400 TAGTCTATGCATAAAGAAATTGG + Intergenic
1031318051 7:120282169-120282191 TCGTATTTACATAAGGAACTGGG - Intronic
1031575290 7:123408836-123408858 TTGTATATGCAAAATACAATGGG + Intergenic
1032271133 7:130407382-130407404 TTTGATATGTATGAGGAAATAGG + Intronic
1032338274 7:131046376-131046398 TTTTATAAGCATAGGGTAATAGG - Intergenic
1033728134 7:144143878-144143900 ATCTATATTCATAAAGAAATTGG - Intergenic
1035828827 8:2672840-2672862 TTGTATATTCATAGAGATATAGG + Intergenic
1036058174 8:5283866-5283888 TTGTTTATCCTTTAGGAAATAGG - Intergenic
1037076435 8:14725403-14725425 TAGTATAGTCATAAGGAAAACGG - Intronic
1037177958 8:15968715-15968737 GTGTATATGCCTAAGGATAGTGG - Intergenic
1037600718 8:20391601-20391623 TGGCATATGGATAAGGAAAAAGG + Intergenic
1038078855 8:24109241-24109263 TTATATATGTATGATGAAATAGG - Intergenic
1039074961 8:33681951-33681973 TTATATTTGCAAAAGGAGATTGG + Intergenic
1040750939 8:50706595-50706617 TTGTGAATGGGTAAGGAAATAGG - Intronic
1041432268 8:57795830-57795852 TGGTATAGGCAGAAGTAAATGGG + Intergenic
1042564867 8:70101293-70101315 GTGGATGTGCATATGGAAATGGG - Intergenic
1042808480 8:72798008-72798030 TTGTATATGAAGAAGGGAAATGG - Intronic
1044113967 8:88311448-88311470 GTGTGAATGCATAAGGAGATAGG + Intronic
1045441689 8:102219730-102219752 TTATATATGTCTAAGGAAAAAGG + Intronic
1045927924 8:107592329-107592351 TTTAATATGCAGAAGGAAAAAGG + Intergenic
1046121618 8:109854861-109854883 TTCTGTATGCATAAGCAAATGGG - Intergenic
1046723156 8:117644600-117644622 TTGTATATGCTTGAGGCTATTGG + Intergenic
1046964189 8:120145047-120145069 TTGTAGATCAATAAGAAAATGGG + Intronic
1046976965 8:120290004-120290026 TGGAATATGCATTAGGAATTAGG + Intronic
1048962003 8:139587819-139587841 TAGTATATGCATACATAAATTGG + Intergenic
1049910451 9:261119-261141 TTGTCTATGCAGAGGGAACTGGG + Intronic
1050822740 9:9901432-9901454 TTGTAAAAGCATAATGAAAGAGG - Intronic
1051390964 9:16562668-16562690 TTTTATATGCTTAATGAAAGAGG - Intronic
1052072244 9:24095503-24095525 TTGTATATACAGGAGGAATTTGG + Intergenic
1052141143 9:24986088-24986110 TTGTATAAGCATAGGCAAGTTGG + Intergenic
1056774417 9:89500366-89500388 TTCTGTATGCATTAGGAAACAGG - Intergenic
1057748097 9:97767953-97767975 TACTATATTCATAAAGAAATAGG + Intergenic
1058995350 9:110293597-110293619 TTTTATATGTATAAATAAATTGG - Intergenic
1059727529 9:117024052-117024074 TGGTTTGTGCAAAAGGAAATTGG - Intronic
1059914233 9:119080749-119080771 TAGTATATGCCTAAGCACATAGG + Intergenic
1203378357 Un_KI270435v1:3026-3048 TTGAATCTGCAAGAGGAAATTGG + Intergenic
1203684010 Un_KI270757v1:23148-23170 TTGAATCTGCAATAGGAAATTGG + Intergenic
1186365045 X:8883451-8883473 TTGTAAATGTAAAAGGAAAATGG - Intergenic
1187811399 X:23181356-23181378 GTGTTTATGGATAAGGAAAGGGG + Intergenic
1187992307 X:24888218-24888240 TAGTATATGCATATGGTAGTAGG - Intronic
1188783999 X:34321698-34321720 TTGTATGTAAATAATGAAATTGG - Intergenic
1189180376 X:38998729-38998751 TTGTATATACATAAAGAATTAGG + Intergenic
1189967805 X:46392279-46392301 TTGTACATGCATAAGGGCAGGGG + Intergenic
1190891157 X:54569153-54569175 TTGCATCTACATAAGGATATTGG + Intergenic
1191128818 X:56986369-56986391 TAATATTTGCATAAAGAAATGGG - Intronic
1193935657 X:87616920-87616942 TTGCATAACCATAAGGAAAAGGG - Intronic
1196205158 X:112931094-112931116 TTATATATGAATGAGGAAACGGG + Intergenic
1196327423 X:114423655-114423677 TTAGATTTGCATAATGAAATTGG + Intergenic
1196676870 X:118429286-118429308 TAATATAAGGATAAGGAAATAGG + Intronic
1197755007 X:129987258-129987280 ATATTTATCCATAAGGAAATAGG + Intronic
1198563260 X:137875918-137875940 TTCTATATTCATAATAAAATTGG - Intergenic
1199472835 X:148213587-148213609 TTCTATCTGCATAAAGGAATGGG - Intergenic