ID: 962105781

View in Genome Browser
Species Human (GRCh38)
Location 3:132387469-132387491
Sequence AGGGGTATTATCTACAGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 1, 2: 1, 3: 5, 4: 72}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962105772_962105781 27 Left 962105772 3:132387419-132387441 CCTGCTCTTCACTACGGTCATGG 0: 1
1: 0
2: 2
3: 4
4: 66
Right 962105781 3:132387469-132387491 AGGGGTATTATCTACAGTTCAGG 0: 1
1: 1
2: 1
3: 5
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962105781 Original CRISPR AGGGGTATTATCTACAGTTC AGG Intergenic
908365314 1:63416718-63416740 AGGTGCATTTTCTACAGTTTAGG + Intronic
913305191 1:117422373-117422395 AGTGGAATTATTTACAGTTTTGG + Intronic
914473055 1:147999860-147999882 AGGGGTAGTAGCTACAGTGAAGG - Intergenic
924259594 1:242215690-242215712 AGGGTTATTTTCTTCATTTCTGG - Intronic
1067399276 10:45956149-45956171 AGGGTTATTATCTAAAGACCTGG - Intergenic
1067867596 10:49925365-49925387 AGGGTTATTATCTAAAGACCTGG - Intronic
1073623560 10:105073615-105073637 TGGGGAACTATCTTCAGTTCTGG + Intronic
1079370999 11:19852141-19852163 AGATGTATTATCTACAGTTCTGG - Intronic
1085034119 11:73289886-73289908 AGATGTTTTATCTGCAGTTCTGG - Intronic
1089621268 11:119723770-119723792 AAGGGTGTTATCTCCAGCTCAGG + Intronic
1096750417 12:53755475-53755497 GGAGGTATTATCTAAAGTCCAGG + Intergenic
1096761306 12:53844206-53844228 AGGGGTATAATCAACACTTGGGG - Intergenic
1100030174 12:90177631-90177653 TGGGGGCTTATCTGCAGTTCAGG + Intergenic
1102321842 12:111942725-111942747 AGGAGTATTATTTACAGTGCTGG - Intronic
1108026871 13:46187165-46187187 AAGGGTATTATAAACTGTTCTGG - Intronic
1110439983 13:75516964-75516986 AGGTGTATTTCTTACAGTTCTGG - Intergenic
1115179135 14:30601873-30601895 AGGGGTATTATCTACAATTCAGG + Exonic
1115437929 14:33397676-33397698 ACAGGTATTATCTACATTTTGGG + Intronic
1116056604 14:39871848-39871870 AGATTTATTATCTACAGTTCTGG - Intergenic
1121033624 14:90680617-90680639 ATGGGTATTATATAAAATTCTGG - Intronic
1124859756 15:33427513-33427535 ATGGGTATTCTCTTCAGTGCAGG + Intronic
1125242931 15:37597513-37597535 AGGGTTTTTATCTAGAGTTTGGG - Intergenic
1126693527 15:51306815-51306837 AGGGAAATTATCTAGAGTCCAGG + Intronic
1140957968 16:79884840-79884862 AAATGTATTCTCTACAGTTCTGG - Intergenic
1149649622 17:58268735-58268757 AGGGGTATTAGCTTCAGCTGCGG - Intergenic
1162945747 19:14042459-14042481 AGGGGTATGGTCTTCAGCTCCGG - Exonic
926008401 2:9390168-9390190 AGGGGTATGACCTACATTACTGG - Intronic
928289911 2:30028008-30028030 AGGGGCATAATCAACTGTTCCGG + Intergenic
929236941 2:39615564-39615586 AGGGGAATTGTCAAGAGTTCAGG + Intergenic
933644401 2:84798820-84798842 AGGGGAAAAATCCACAGTTCTGG + Intronic
936491704 2:112978046-112978068 AGGGTCTTTATCTACAGTCCAGG - Exonic
939409364 2:141804316-141804338 TGAGATATTATCTACATTTCAGG + Intronic
940959969 2:159774441-159774463 AGGTGGATTATGTATAGTTCGGG - Intronic
945012979 2:205484467-205484489 TGGGGTATTATTTACAGCTCTGG + Intronic
945910551 2:215644108-215644130 AGGGGTATTTTCTAAATTCCTGG - Intergenic
946822870 2:223648105-223648127 AGTGGTAACATCTACGGTTCTGG - Intergenic
947213366 2:227728017-227728039 GGGGGTATTATCAACAGTTTTGG - Intergenic
1169828811 20:9799560-9799582 ATGGGTCTTATATTCAGTTCTGG + Intronic
1172716043 20:36964514-36964536 AGGAGTATTATTTTCAGTTTGGG + Intergenic
1172718489 20:36981665-36981687 AGGAGTATTATTTTCAGTTTGGG - Intergenic
1175534944 20:59703212-59703234 TGGTGAATTATCTACAGTTAGGG + Intronic
1183772320 22:39937682-39937704 AGGATTATTATCTGCATTTCTGG + Intronic
961545472 3:127629826-127629848 ATGGGTATTCTCTCCTGTTCTGG + Intronic
962105781 3:132387469-132387491 AGGGGTATTATCTACAGTTCAGG + Intergenic
965422854 3:168483722-168483744 AGGAGTATAATGTACAGTTAGGG + Intergenic
967367461 3:188703846-188703868 AGGGGTAGAATCTAAATTTCTGG + Intronic
972151732 4:36099387-36099409 ATGGGCCTTATCTACAGTGCTGG + Intronic
972322908 4:37989282-37989304 AGCGTTATTATCTAAAGATCTGG - Intronic
977730653 4:100347283-100347305 AAGGATATTATTAACAGTTCTGG - Intergenic
981092380 4:140744997-140745019 AGAGTTATTATCTATAGATCTGG - Intronic
986135425 5:4973191-4973213 AGAGGCATTATCTCCAATTCAGG - Intergenic
989345895 5:40429069-40429091 AGGTGTATTCTATACATTTCTGG - Intergenic
990330830 5:54723700-54723722 AGGGGTTTTAGCTATAATTCAGG + Intergenic
990333901 5:54753699-54753721 GGGGGTCTTATCCTCAGTTCTGG - Intergenic
990377330 5:55184781-55184803 AAGTGTAATATCTACAGTTAGGG - Intergenic
999555183 5:152733771-152733793 AGAGCTATTATCTAAAGGTCTGG + Intergenic
999857259 5:155608326-155608348 AAATGTATTATTTACAGTTCTGG - Intergenic
1002617218 5:180463471-180463493 AAGTTTATTCTCTACAGTTCTGG - Intergenic
1008236529 6:49057945-49057967 AGGGGTATTTTCAGCAGCTCTGG + Intergenic
1010520703 6:76831797-76831819 AGAGTTATTAGCTAGAGTTCAGG + Intergenic
1014905590 6:127023256-127023278 AGGGCTATTATCAATAGTTTGGG - Intergenic
1016357306 6:143232557-143232579 AGGATTATTATCTAGAGTTTAGG - Intronic
1018335214 6:162779365-162779387 ATGGGCCTTATCTACAGTGCTGG + Intronic
1018455995 6:163952568-163952590 AGGGGTAGTTTCTACAGTCATGG - Intergenic
1020929174 7:14371852-14371874 TGAGGTATTTTCCACAGTTCTGG + Intronic
1021612742 7:22474025-22474047 AGGGGTAATATAAACAGTTATGG + Intronic
1029802886 7:102968298-102968320 AGGAGTTTTATCTAAAGTACTGG + Intronic
1030489392 7:110213088-110213110 AGGGATATTATATACAGCTCTGG + Intergenic
1042377177 8:68065031-68065053 GGGTGTATAAACTACAGTTCGGG - Intronic
1044143101 8:88678828-88678850 AGAGGCAGTATCTACAGATCAGG + Intergenic
1046228921 8:111327174-111327196 AGGGAAATTAGCTACATTTCTGG - Intergenic
1047094420 8:121608647-121608669 GGAGGTATTTTCAACAGTTCAGG + Intergenic
1052591659 9:30503987-30504009 AGGGGAATAAGCTTCAGTTCTGG + Intergenic
1058395773 9:104552370-104552392 CAATGTATTATCTACAGTTCTGG + Intergenic
1060087950 9:120718413-120718435 ATGGGCCTTAGCTACAGTTCTGG - Intergenic
1060187930 9:121575193-121575215 GGGGGTGTTAAGTACAGTTCAGG - Intronic
1061038414 9:128126135-128126157 AGGGGGATGGTCTACAGTTGTGG - Intronic
1187935926 X:24335839-24335861 ATGGGTATCATCTACGTTTCAGG + Intergenic
1189099042 X:38170395-38170417 AGGGGTATTATTTACTTTTTTGG - Intronic
1193416249 X:81228393-81228415 AGAGTTACTATCTACAGATCTGG + Intronic