ID: 962108189

View in Genome Browser
Species Human (GRCh38)
Location 3:132415520-132415542
Sequence CTGTAGCAGGGGTAGTTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962108189 Original CRISPR CTGTAGCAGGGGTAGTTAGA AGG Intergenic
901647351 1:10723802-10723824 AGGTTGCAGGGGGAGTTAGAGGG - Intronic
904744594 1:32702979-32703001 CCGTTGCAGGGGGAGTCAGAAGG + Exonic
907431715 1:54416040-54416062 CTGTAGGAGGGGTGGCTAGATGG - Intergenic
908378403 1:63570435-63570457 TTGTAACAGAGGTATTTAGAAGG - Intronic
909926240 1:81440864-81440886 CAGTAGCAGTGGGAATTAGAAGG - Intronic
910426888 1:87127535-87127557 ATGGAGCAGCTGTAGTTAGAGGG + Intronic
912681249 1:111730342-111730364 CAGGAGCAGGGGTAGTTGAATGG - Intronic
915069431 1:153253981-153254003 CTGTGGCAGGGGTACTGAGCTGG + Intergenic
915648163 1:157288621-157288643 CTGTGGCAAGGGGAGTCAGACGG + Intergenic
918343233 1:183584263-183584285 CTGCAGCAGTGGTTGTTAAATGG - Intronic
924387008 1:243508462-243508484 CTGTAGCAAGGAAAGTCAGACGG - Intronic
924825419 1:247533121-247533143 CAGGAGCAGGGGTGGTGAGAAGG - Intronic
1067398438 10:45947022-45947044 CAGTAGCAGGGGGAGGTAGTCGG - Intergenic
1067866749 10:49916105-49916127 CAGTAGCAGGGGGAGGTAGTAGG - Intronic
1070743351 10:78917052-78917074 CTGTAGCAGGAAGAGTTAGCAGG - Intergenic
1074188759 10:111117777-111117799 GTGTAGCAGTGGTTGTCAGATGG + Intergenic
1075916412 10:126171383-126171405 CCGTGGCAGGGGTGGTTAGTTGG + Intronic
1076931266 10:133533431-133533453 CTGTAGCAGGAGGGGTTAGCAGG + Intronic
1078514982 11:12014315-12014337 CTGTTGCAGGGGCAGACAGAGGG + Intergenic
1081196124 11:40162971-40162993 ATGTAGTAGAGGTGGTTAGAGGG - Intronic
1083366763 11:62145934-62145956 CTGTAGCAGCAGTAATTTGAGGG + Intronic
1085842086 11:80023753-80023775 CTGTAGCAGGGGCAGAGACAGGG + Intergenic
1086248306 11:84782421-84782443 GTGTGGTAGGGGTAGTTAGTGGG - Intronic
1087933449 11:104004184-104004206 CTGTAGAAGGGGTGGGGAGAGGG + Intronic
1088100598 11:106150894-106150916 CTGTAGCATCTGTAATTAGAAGG - Intergenic
1089617902 11:119705579-119705601 CTGTGGCCGGTGTAGCTAGACGG + Intronic
1090078071 11:123591886-123591908 CTGTAGCAGTGGCAGGGAGAGGG - Intronic
1095314549 12:40744132-40744154 CAGTAGCAGGGGTAGAGGGAGGG + Intronic
1095487176 12:42697279-42697301 CTGTAGCCTGTGGAGTTAGATGG + Intergenic
1095756082 12:45768668-45768690 CTGTAGAAGGGCTAGTTTGCTGG + Intronic
1101673170 12:106895977-106895999 ATGTAGCAGGGGTAATGAAAAGG - Intergenic
1102158689 12:110751102-110751124 TTGGAGCAGGGGGATTTAGATGG + Intergenic
1103717401 12:122953097-122953119 CTGGAGCAGAGGGAGTGAGATGG - Intronic
1104322925 12:127768900-127768922 CGTTAGCAGGGGTAGTGACAGGG + Intergenic
1108123244 13:47212579-47212601 CTGTAGCTGGTGTAGGAAGATGG + Intergenic
1108434098 13:50384895-50384917 CTGCAGCAGGGGTGGAGAGAGGG - Intronic
1112674335 13:101681187-101681209 CTCTATGTGGGGTAGTTAGAAGG + Intronic
1112926384 13:104679941-104679963 CAGGAACAGGGGTAGCTAGACGG + Intergenic
1112953515 13:105031716-105031738 CTGAAGCAGAGGAAGTTAGATGG + Intergenic
1114212988 14:20632010-20632032 CTGAAGCAGAGGTGGCTAGAAGG + Intergenic
1114317423 14:21521972-21521994 CTGGAGCAGGGGGAGGAAGAAGG + Exonic
1118158662 14:63266972-63266994 CTGTGTCAGGGGTAGTGTGAGGG - Intronic
1118532679 14:66724540-66724562 GTCTAACAGGGGTAGATAGAGGG + Intronic
1118902320 14:69996889-69996911 CTGTAACAGGGGTTGTCAAATGG + Intronic
1121712229 14:96047165-96047187 CTGAAGCAGGTCTAATTAGAAGG - Intronic
1122445418 14:101763870-101763892 CAGTAGCAGAGGTGGTTTGAAGG - Intronic
1124419938 15:29512238-29512260 CTGAAGCATGTGTAGTTTGAGGG - Intronic
1124678506 15:31709162-31709184 CTCTAGCAGGCGTAGCTAGGAGG - Intronic
1132557240 16:578071-578093 CTGTGGCCGAGGTAGTGAGAGGG + Intronic
1135039240 16:19105144-19105166 CTCCAGCAGGGATTGTTAGAAGG + Intergenic
1135654605 16:24236819-24236841 CTTTAGCAGGGGTTATCAGAAGG - Intergenic
1148031119 17:44621792-44621814 GTGTGGCAGGGCTGGTTAGATGG - Intergenic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1150507225 17:65711721-65711743 CTATAGCAGGGGGAGATAGAGGG - Intronic
1153034084 18:742250-742272 CAGTAACAGGGTTAGTTAGGGGG - Intronic
1155499592 18:26473403-26473425 CTGTAGCAGGGATAGGGGGAGGG + Intronic
1156030663 18:32708590-32708612 CTCTAGAAGGGGCAGCTAGAAGG - Intronic
1156389283 18:36635526-36635548 CTGAAGCAGGGGAAGAGAGAAGG + Intronic
1158084836 18:53638898-53638920 CTGTAGCAGAAGAAGTGAGATGG + Intergenic
1165164500 19:33842047-33842069 CTGTTTCAGGGGTAGCTGGAGGG - Intergenic
1165890856 19:39111536-39111558 CTGGAGCAGGGAGAGTGAGAGGG + Intergenic
1166317011 19:41994674-41994696 CTGCAGGAGGGGAAGTTGGAAGG + Intronic
1167049816 19:47071512-47071534 CGGAAGCATGGGAAGTTAGAGGG - Intronic
1167144169 19:47672144-47672166 ATGGAGCATGGGTAGGTAGATGG + Intronic
1167338778 19:48902850-48902872 CTGGAGCAGGGAGAGTGAGAGGG + Intronic
926234091 2:11026414-11026436 CTGCAGCAGGGGCAGGCAGATGG - Intergenic
930624838 2:53685541-53685563 CTGTAGCAGGGAAGGTTAGGAGG - Intronic
930741736 2:54838601-54838623 CTGTAGCAGAGGGAATTGGAAGG + Intronic
932301420 2:70669927-70669949 CCTTAGCAGGGGCAGCTAGAAGG - Intronic
937080766 2:119137964-119137986 CTGGAGGAGGGGAAGTTTGAAGG + Intergenic
937677203 2:124605092-124605114 CTGTAGCAGGGGAGTTTACATGG - Intronic
943746049 2:191463711-191463733 ATGTAGAAGGGGTAGCTGGATGG - Intergenic
1169523693 20:6400477-6400499 CTGCAGCTGTGGTAGGTAGATGG + Intergenic
1170083698 20:12505556-12505578 CTGTAGCAGTGGAAGTAGGAGGG + Intergenic
1175642758 20:60644710-60644732 CTGCAGCAGGGGTTGTTCGTTGG - Intergenic
1175751329 20:61499902-61499924 CTGTGGCAGGGGTGGTTGGAAGG + Intronic
1181267753 22:21640918-21640940 CTGGGGGAGGGGTAGTTTGAGGG + Intergenic
1181911196 22:26239641-26239663 AGGTAGCAGGTGGAGTTAGAAGG - Intronic
949160885 3:880527-880549 CTGCAGCTGGGGCAGTTAGACGG + Intergenic
949409124 3:3744679-3744701 GTGTAGCAGGGGTAGTGGGCTGG - Intronic
950968809 3:17166267-17166289 CTGTGGCAGGGGTCCATAGAGGG - Intronic
952906272 3:38141016-38141038 GTGTGCCAGGGGTACTTAGATGG + Intronic
955527933 3:59840018-59840040 CTGTAGCCTGGCTACTTAGAAGG - Intronic
955611193 3:60759074-60759096 CTGTAGCAGAGGAAGTAAGGAGG + Intronic
956085326 3:65602524-65602546 CTATAGCTGTGGGAGTTAGAAGG + Intronic
956311204 3:67882584-67882606 CAGTAGCAAGGGAAGGTAGAAGG - Intergenic
956488107 3:69742512-69742534 CTGTAGCAGAGGGAGGTAGGAGG - Intronic
959784810 3:110283244-110283266 CTGCAGCAGGGGTAGAGGGAAGG - Intergenic
962108189 3:132415520-132415542 CTGTAGCAGGGGTAGTTAGAAGG + Intergenic
962806964 3:138934700-138934722 GTGTAGCTGGGGTGGTGAGAGGG - Intergenic
963219194 3:142788223-142788245 CTGTGGCAGGAGTAGATGGAGGG + Intronic
963356803 3:144218144-144218166 CTGGAGCAGGGGAAGTTTGGTGG + Intergenic
963393607 3:144702823-144702845 CTGTAGTAGGGGGAGTCAGATGG - Intergenic
965079636 3:164020318-164020340 CTGTGGTGGGGGTAGTGAGAAGG + Intergenic
971337637 4:25738790-25738812 CTGAGGCAGGGGTTGTGAGAGGG - Intergenic
975732367 4:77350144-77350166 CTGTAGCAGGGGGAGTGGCATGG + Intronic
976297891 4:83489917-83489939 CTGTGGCAGGGAAGGTTAGAGGG - Intronic
982693193 4:158571049-158571071 TTGTACAAGGGGTAGTTAGAGGG - Intronic
994382139 5:99084241-99084263 TTGGAGCAGAGTTAGTTAGATGG + Intergenic
997691228 5:135828815-135828837 CTGTAGGAGGGGCAGCTGGAAGG - Intergenic
998557503 5:143139875-143139897 CTGTAGAAGGGGGAGCCAGAAGG + Intronic
1003239094 6:4326869-4326891 CTGGAGCAGTGGTAGCTACATGG - Intergenic
1004022653 6:11788978-11789000 CTGTGGTGGGGGTAGTGAGAAGG - Intronic
1005190332 6:23214221-23214243 CCGTAGCTAGGGTAGTTAGGGGG + Intergenic
1009802975 6:68566008-68566030 CTGTAGCACAGAAAGTTAGATGG - Intergenic
1011989390 6:93494348-93494370 ATTTAGCAGGGGTAGTTCCAAGG + Intergenic
1012602190 6:101112335-101112357 CTGGAGTAGGGGTAGTTATTGGG + Intergenic
1016646203 6:146411379-146411401 CTGGAGCAGAGGAAGTAAGAAGG + Intronic
1023093083 7:36634072-36634094 GTGAAGAAGGGGTGGTTAGAAGG + Intronic
1028943549 7:96552162-96552184 CTGTAGGAAGTGTAGTTAAATGG - Intronic
1032505116 7:132428591-132428613 GAGTAGCAGGGGTAGCAAGAAGG - Intronic
1037525213 8:19717958-19717980 ATGGGGCAGGGGTAGTTATAGGG - Intronic
1040533773 8:48288187-48288209 CTGAAGCTTGAGTAGTTAGATGG - Intergenic
1044413271 8:91908804-91908826 CTGTAGCAGTGGAAATAAGAGGG - Intergenic
1045624182 8:104023156-104023178 TTGTAGCAGGTGCAGTCAGAAGG + Intronic
1047356140 8:124123999-124124021 CTGTAGCATGGAGAGTTTGAAGG + Intergenic
1048468274 8:134685308-134685330 CTGTAGCAGGGCTAGGTACCAGG - Intronic
1048925101 8:139264468-139264490 CAGGAGCTGGGGTAGTTGGAAGG + Intergenic
1048991702 8:139764272-139764294 CTGTAGCAGGGGCAGTGAAATGG + Intronic
1049052021 8:140205753-140205775 CTGTAGGAGGGGTGGTGAGCGGG - Intronic
1053729442 9:41037971-41037993 CTGTATGAGGGGTAGGAAGAAGG - Intergenic
1054699067 9:68394095-68394117 CTGTATGAGGGGTAGGAAGAAGG + Intronic
1055003581 9:71481253-71481275 TTGTAATATGGGTAGTTAGAAGG + Intergenic
1058001812 9:99873455-99873477 CTGTAGCAAAGGAAGTTGGAAGG + Intergenic
1059383760 9:113948499-113948521 CTGTAGCCATGGGAGTTAGAAGG + Intronic
1188848393 X:35102423-35102445 CTGTAGCAGAGGCAGTTAACGGG + Intergenic
1192091654 X:68164863-68164885 GTCTAGAAGGTGTAGTTAGAAGG - Intronic
1192185058 X:68941088-68941110 GTGTAGCAGGGGTGGTGAGTGGG + Intergenic
1195638696 X:107149812-107149834 CTGTGGCAGTAGTAGTAAGAGGG - Intronic
1196105345 X:111889281-111889303 CTTTAGCAAGGGTAGTAAGGTGG + Intronic
1199583463 X:149385546-149385568 CTGCACCAGCGGTAATTAGATGG - Intergenic