ID: 962109604

View in Genome Browser
Species Human (GRCh38)
Location 3:132430423-132430445
Sequence GTCATGCCCCGTGTTTTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 64}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962109596_962109604 16 Left 962109596 3:132430384-132430406 CCCCCCTATGGGTTTATTAGGGA 0: 1
1: 0
2: 0
3: 7
4: 75
Right 962109604 3:132430423-132430445 GTCATGCCCCGTGTTTTTTATGG 0: 1
1: 0
2: 1
3: 3
4: 64
962109600_962109604 12 Left 962109600 3:132430388-132430410 CCTATGGGTTTATTAGGGATCTT 0: 1
1: 0
2: 1
3: 10
4: 116
Right 962109604 3:132430423-132430445 GTCATGCCCCGTGTTTTTTATGG 0: 1
1: 0
2: 1
3: 3
4: 64
962109598_962109604 14 Left 962109598 3:132430386-132430408 CCCCTATGGGTTTATTAGGGATC 0: 1
1: 0
2: 0
3: 7
4: 57
Right 962109604 3:132430423-132430445 GTCATGCCCCGTGTTTTTTATGG 0: 1
1: 0
2: 1
3: 3
4: 64
962109599_962109604 13 Left 962109599 3:132430387-132430409 CCCTATGGGTTTATTAGGGATCT 0: 1
1: 0
2: 1
3: 8
4: 108
Right 962109604 3:132430423-132430445 GTCATGCCCCGTGTTTTTTATGG 0: 1
1: 0
2: 1
3: 3
4: 64
962109597_962109604 15 Left 962109597 3:132430385-132430407 CCCCCTATGGGTTTATTAGGGAT 0: 1
1: 0
2: 0
3: 3
4: 61
Right 962109604 3:132430423-132430445 GTCATGCCCCGTGTTTTTTATGG 0: 1
1: 0
2: 1
3: 3
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962109604 Original CRISPR GTCATGCCCCGTGTTTTTTA TGG Intronic
905269833 1:36780462-36780484 GTCATTCCCCCTGTTTTATATGG + Intergenic
917142014 1:171844352-171844374 GTGATGACCCTTGGTTTTTATGG - Intronic
921633147 1:217458561-217458583 ATCATGCCCCGTATTTTTCCAGG + Intronic
1063409710 10:5827996-5828018 CTCAGGCCCCCTGTTTTTTCTGG - Intronic
1065363126 10:24908253-24908275 GTCATGCCCTCTGTCTTTTACGG + Intronic
1073810598 10:107148503-107148525 GTCCTACCACCTGTTTTTTATGG - Intronic
1080374543 11:31693054-31693076 CTCGTGCCCCATGTTTATTAGGG + Intronic
1083186532 11:61021041-61021063 GGCCTCCCCAGTGTTTTTTATGG - Intergenic
1086093444 11:83026951-83026973 GTCAGTTCCTGTGTTTTTTAAGG - Intronic
1092861005 12:12718677-12718699 GTCATCCCCAGTGGCTTTTAAGG - Intronic
1103488768 12:121300121-121300143 GTCATGCCACCTGTTTTTTATGG - Intergenic
1103987408 12:124777267-124777289 GACATGCCCCGTGTTGTTCTAGG - Intronic
1110147397 13:72208500-72208522 CTCAGGCCCAGGGTTTTTTATGG + Intergenic
1110573903 13:77034826-77034848 GTCATGCCCAGTGACTTTTCTGG - Intergenic
1110770643 13:79340174-79340196 GTCCTGCCCAGTATTTTTTTTGG - Intronic
1113992565 14:16039046-16039068 GTCATGGCTCGTGCTTTTAAAGG - Intergenic
1118164064 14:63318600-63318622 GTCATTCCCCGTGCTCTTTCCGG + Intronic
1120421818 14:84296526-84296548 GTCCTGCCCCTTGAGTTTTATGG + Intergenic
1127384847 15:58459083-58459105 GTCATGCCTCCTATTTTTTTAGG + Intronic
1127513743 15:59671340-59671362 GTTATGCACAGTGATTTTTAAGG - Intronic
1137257285 16:46786779-46786801 GCCCAGCCCCTTGTTTTTTAAGG - Intronic
1152485282 17:80587079-80587101 GACAAGCCCCGTGTTGTTTCTGG - Intronic
1166579992 19:43888042-43888064 GGTATGCACCGTATTTTTTAGGG - Intronic
1168716859 19:58533988-58534010 GTAAAGCCCCATGTGTTTTATGG + Intronic
926346702 2:11953612-11953634 GTCATGCCATGTATTTTTCATGG - Intergenic
930136700 2:47909185-47909207 ATCATGCCCCAGGGTTTTTAAGG + Intergenic
936559030 2:113520551-113520573 TTCATGCTCCTTGTTTTCTATGG + Intergenic
940638149 2:156322127-156322149 CTTATGACCGGTGTTTTTTAGGG + Intergenic
940882995 2:158965724-158965746 ATCATGGCCAGTGTTTATTATGG - Intergenic
943731240 2:191305665-191305687 GACATGCCCCACCTTTTTTATGG - Intronic
948983313 2:241506006-241506028 GTCATTCCCCTTGTTTTGTGGGG - Intronic
1177036740 21:16054012-16054034 GGCATGCCCCTTTTATTTTAAGG + Intergenic
1177426891 21:20934917-20934939 CTTATGACCCATGTTTTTTATGG - Intergenic
1180314705 22:11268475-11268497 GTCATGGCTCGTGCTTTTAAAGG + Intergenic
1183643906 22:39111176-39111198 GTCAAGCCCCGTCTTTGTTCAGG + Intergenic
962109604 3:132430423-132430445 GTCATGCCCCGTGTTTTTTATGG + Intronic
962936870 3:140089527-140089549 ATAAAGCCCCGTGTTTTTGAGGG + Intronic
969643753 4:8413932-8413954 CTCATGGCCCGTGGTTTCTACGG - Intronic
975958207 4:79867892-79867914 GACAAGCTCTGTGTTTTTTAAGG - Intergenic
977817717 4:101434426-101434448 ATCATACCCACTGTTTTTTATGG - Intronic
981029734 4:140112362-140112384 GTCATGCTCCATATTTTTAAAGG + Intronic
985723854 5:1505504-1505526 TTCATGCCCCGTGTTGTTTGGGG - Intronic
985909835 5:2870398-2870420 CTGTTGCCTCGTGTTTTTTAAGG - Intergenic
994513289 5:100735992-100736014 GTTATGCCCCATGTTCTATATGG + Intergenic
994728560 5:103464738-103464760 TTCATGCCCCGTGTAGGTTAGGG - Intergenic
1000175471 5:158748245-158748267 GTCATTTCCCATGTTTTTTGTGG - Intronic
1001715255 5:173810434-173810456 GTGAAGCCCCGTGTCTTTTCTGG + Intergenic
1001797271 5:174513081-174513103 GCCATGCCCCGTGCTTTCCAGGG + Intergenic
1003206533 6:4018303-4018325 GCCAAGCGCCGTGGTTTTTACGG + Intergenic
1012621790 6:101353695-101353717 GTGAAGCACCGTGTTTTCTATGG + Intergenic
1013370945 6:109470519-109470541 GTCATGCCCCATGTTATTCTGGG - Intronic
1015320386 6:131866382-131866404 GTCATGGTCCCTGTTTTTGAGGG + Intronic
1017618907 6:156274659-156274681 CTCATGCCCTGTGATTTATAAGG + Intergenic
1026771519 7:73203868-73203890 GCCATTCCACTTGTTTTTTAAGG - Intergenic
1027012385 7:74757264-74757286 GCCATTCCACTTGTTTTTTAAGG - Intronic
1027075655 7:75188789-75188811 GCCATTCCACTTGTTTTTTAAGG + Intergenic
1036177980 8:6557266-6557288 AGCATGCCCCGTGTTTATAAGGG + Intronic
1041761580 8:61373042-61373064 GTTATGCTCCATGTTTTTGAGGG + Intronic
1042055648 8:64763031-64763053 CTCCTGCTCCGTGTTTGTTATGG + Intronic
1042598945 8:70478940-70478962 GTCAAGTCCCATGTTTTCTATGG + Intergenic
1043126118 8:76397899-76397921 GGAATGCCCATTGTTTTTTAGGG - Intergenic
1045866893 8:106877366-106877388 GTCATGCCCACTTTTTGTTAGGG + Intergenic
1049893822 9:95630-95652 TTCATGCTCCTTGTTTTCTATGG - Intergenic
1051924012 9:22301053-22301075 GTCATTGCCTGTGTTTTCTAAGG - Intergenic
1053735047 9:41095714-41095736 TTCATGCTCCTTGTTTTCTATGG - Intergenic
1188102164 X:26102324-26102346 GTAATGCCCAGTATTCTTTATGG + Intergenic
1199081385 X:143580258-143580280 GTCAAGCCCTGTGTTTGTTCAGG - Intergenic
1201764986 Y:17567506-17567528 ATCATGCCCGGTGTCTTTTCTGG - Intergenic
1201836566 Y:18338483-18338505 ATCATGCCCGGTGTCTTTTCTGG + Intergenic