ID: 962110758

View in Genome Browser
Species Human (GRCh38)
Location 3:132444119-132444141
Sequence TCTCATGTGCAGGAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 247}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962110758 Original CRISPR TCTCATGTGCAGGAGGTGGA TGG (reversed) Intronic
900955084 1:5881807-5881829 GCTCGTCTGCAGGAGGTGGCAGG - Intronic
902756738 1:18553807-18553829 TATCATGTCGAGGAGATGGATGG - Intergenic
903650202 1:24917340-24917362 TCTCATGGGCAGCAGCTGGGTGG - Intronic
903799742 1:25957769-25957791 TCTGAAGTCCAGGAAGTGGAAGG + Intergenic
903943123 1:26945280-26945302 TCTCAGGTGCAGGATGTGGATGG + Intronic
904319142 1:29685185-29685207 TCTGATCAGCAGGAGGTGGGGGG + Intergenic
904678986 1:32215785-32215807 TGCCCTCTGCAGGAGGTGGAAGG - Exonic
906111515 1:43326216-43326238 TCTCATGTCCATGAATTGGAAGG + Intergenic
906117509 1:43366413-43366435 TGTACTGTGCAGGGGGTGGAGGG + Intronic
908138456 1:61157316-61157338 TCTCTTTTGCAGGGAGTGGAGGG - Intronic
910503938 1:87927718-87927740 TCTATTGTACAGGAGGTGAAAGG - Intergenic
911646288 1:100340605-100340627 TCTCATAAGCAGTAAGTGGAGGG + Intergenic
913343434 1:117783158-117783180 TGTCATTTGCAGGAGTGGGAAGG + Intergenic
913387769 1:118278296-118278318 TCTCCTGTGGAGGAGTGGGATGG + Intergenic
914839951 1:151240151-151240173 TCTCATGGGATGTAGGTGGAAGG - Intronic
915065349 1:153220053-153220075 CCTCATGAGGAAGAGGTGGAGGG + Intergenic
915577684 1:156791329-156791351 TCTTATGAGCAGGAGGAGCAGGG + Intronic
916078166 1:161215188-161215210 TCTCTTGTGCAGGAAGGGGAAGG + Intergenic
918094663 1:181324923-181324945 TCCCAGATGCAGGAGATGGAAGG - Intergenic
918126030 1:181584773-181584795 TATAATGTGGAGGAGGTGGTAGG - Intronic
919025971 1:192170928-192170950 TCTCAAATGCAGGTGGTGAAAGG + Intronic
919235909 1:194842324-194842346 TCTCATCTGCTGAAGCTGGAGGG + Intergenic
920041741 1:203102384-203102406 GCACATGTGGAGGAGGGGGAAGG - Intronic
920535505 1:206734113-206734135 CCTCAGGGGCAGGTGGTGGAGGG + Exonic
922215252 1:223515085-223515107 CCTCTTGTCCAGGAGGTGGCTGG + Intergenic
922776712 1:228217661-228217683 TCTCATGTGCAGGGAGAAGAAGG + Intronic
923540370 1:234884421-234884443 TCACTTGGGCAGGAGGTGCAAGG + Intergenic
923648276 1:235846124-235846146 TTTCTGGTGCAGGTGGTGGAGGG - Intronic
924464933 1:244291218-244291240 TCTCAAGTGGAGGAGAAGGAGGG + Intergenic
924552314 1:245090109-245090131 TGTCATGTGCGTGAGGTGGAAGG + Intronic
1062810509 10:459928-459950 GCTCACGTGCAGCAGGTGGTTGG - Intronic
1063245385 10:4212515-4212537 TCTCAGCTGCATGTGGTGGAGGG + Intergenic
1063372998 10:5533762-5533784 ACACGTGTGAAGGAGGTGGATGG + Intergenic
1063525555 10:6781354-6781376 TCAGATGTGCAGGAGGTGTTAGG - Intergenic
1063903861 10:10763294-10763316 TCTCATGTGCAGTGAGTGGGAGG - Intergenic
1064193966 10:13230627-13230649 TCTGATGTGCAAGAGGAGGCTGG + Intronic
1065574163 10:27101530-27101552 TCCCTTGTGGAGGAGGTGGCTGG + Intergenic
1066180288 10:32955848-32955870 TCTCATGTGCAGAATGTTGAGGG + Intronic
1069786484 10:70991334-70991356 TCTGATCTCCAGGAGGCGGAGGG + Intergenic
1073234419 10:102001656-102001678 TCTTATGTGTGGGAAGTGGAGGG - Intronic
1075689439 10:124385704-124385726 TCTCAGGTGCAGGAGGCTGAGGG + Intergenic
1076462287 10:130655572-130655594 TCTCATGTGGGGGCGGAGGAGGG - Intergenic
1076871674 10:133197795-133197817 TGTCAGGTGCAGGAGCTGGTGGG - Intronic
1077133039 11:984124-984146 TCACTTGTTCAGGAGGTTGACGG + Intronic
1078582378 11:12548389-12548411 TCTCATGTCCCTGAGGTGGGAGG + Intergenic
1079400701 11:20104240-20104262 TCTCATGGCCAGGATGTGGGAGG + Intronic
1083587007 11:63867489-63867511 TCTCTTGGGAAGGAGGTGGAAGG - Intronic
1087998157 11:104838270-104838292 TTCCATGGGTAGGAGGTGGAGGG + Intergenic
1088607053 11:111541881-111541903 TCTCATTTGCAGGAAGGCGAAGG - Intronic
1089042193 11:115462613-115462635 TTTGATGTGGAGGAGGAGGAGGG + Intronic
1089127852 11:116190022-116190044 TCTCAGGAGCTGGGGGTGGAGGG + Intergenic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1090567636 11:128012717-128012739 GTACATGTGCAGGAGGTGCAGGG - Intergenic
1094220776 12:27991014-27991036 TCTCATGTACATGAATTGGAAGG + Intergenic
1094842947 12:34349569-34349591 GCGCATGTGCAGCAGGGGGAGGG + Intergenic
1097346459 12:58498744-58498766 TCTCATGCACAGGAGGTTGAAGG + Intergenic
1097590894 12:61573940-61573962 ACTCACATGGAGGAGGTGGAAGG - Intergenic
1101496150 12:105256201-105256223 AATCCTGAGCAGGAGGTGGAAGG - Intronic
1102487711 12:113269423-113269445 TTCCATGAGCAGGATGTGGAAGG - Intronic
1103574043 12:121863862-121863884 TTTCAGGTTCAGGAAGTGGAAGG - Intergenic
1103945999 12:124526758-124526780 CCTCATGTGCCTGACGTGGAAGG - Intronic
1104024751 12:125017682-125017704 GCACATGTCCAGGAGTTGGAAGG + Intronic
1104164444 12:126214449-126214471 TCTGATGAGGAGGAGGTGAAAGG - Intergenic
1106548191 13:30748776-30748798 GCTCATCTACAAGAGGTGGATGG - Intronic
1107107752 13:36664989-36665011 TCTCATGTAGAGTAGGTGAAGGG + Intergenic
1109140188 13:58704853-58704875 TTTCAGGTGCAGGATGTGGAAGG + Intergenic
1112571887 13:100600886-100600908 AGTCATGGGCAGGAGGTGGGTGG - Intergenic
1113974967 13:114220671-114220693 TCTCATGTGCAGGAGTTATTGGG - Intergenic
1114850236 14:26374493-26374515 TCTCATGTGGCGGGGGTGGGCGG - Intergenic
1115035745 14:28854352-28854374 ACTCAGGAGCTGGAGGTGGAAGG + Intergenic
1117394717 14:55297928-55297950 TCTCAAGTCCAAGAAGTGGACGG - Intronic
1119019302 14:71093720-71093742 TCAGAGGTGGAGGAGGTGGAAGG - Intronic
1119615126 14:76094070-76094092 TGTCATGAGAAGGCGGTGGAAGG - Intergenic
1121488705 14:94342479-94342501 ACTCATGTGCAAGAGGGAGAAGG - Intergenic
1121651757 14:95564043-95564065 TCTCATGGGCAGGGAGTGGTAGG + Intergenic
1123005972 14:105324043-105324065 GCTTTTGTGCAGGAGATGGAGGG + Intronic
1124686652 15:31788666-31788688 TGGCAGCTGCAGGAGGTGGAAGG + Intronic
1129852820 15:78804301-78804323 TCTCATGTGCCGGGGGTTGGGGG + Intronic
1131830842 15:96353871-96353893 GGTCGTGTGCAGGAGGGGGAGGG - Intergenic
1132641289 16:979765-979787 TCCCAGGGGCAGGGGGTGGAAGG + Intronic
1133627132 16:7581244-7581266 TCTGTTCTGCAGGAGTTGGAAGG - Intronic
1134621558 16:15693329-15693351 TCTCATGTGCTGCTGGTGCATGG + Intronic
1134751640 16:16629906-16629928 TTTCTTGTTCAGGAGGTCGAGGG + Intergenic
1134993819 16:18723703-18723725 TTTCTTGTTCAGGAGGTCGAGGG - Intergenic
1135303811 16:21352276-21352298 TCTCATGGGAAGGGGGCGGATGG + Intergenic
1135933561 16:26760052-26760074 TCTCATTGGCATGAGGTGGAAGG - Intergenic
1135998183 16:27268957-27268979 ACTGAGGTGCAGGAGGCGGAGGG - Intronic
1136300544 16:29331413-29331435 TCTCATGGGAAGGGGGCGGATGG + Intergenic
1136549123 16:30972942-30972964 GCACATCTGCAGGAGGAGGAAGG + Intronic
1137673580 16:50292903-50292925 TGCCATGTGCATGAGGTGCATGG + Intronic
1137846657 16:51696347-51696369 GCTCATATGCAGGAGGGGGAAGG + Intergenic
1138199928 16:55080983-55081005 TCTCAGGTGCATGGGGTGGCAGG + Intergenic
1140364881 16:74373664-74373686 GGTGATGAGCAGGAGGTGGAGGG - Intergenic
1141171406 16:81693954-81693976 GCTCAGGGGCAGAAGGTGGAAGG - Intronic
1141648021 16:85377824-85377846 CCACATGTGCAGGAGCTGGGGGG + Intergenic
1141652140 16:85398368-85398390 CCTCCTGAGCAGGAGGTGGAGGG + Intergenic
1142062276 16:88038205-88038227 TCTCATGGGAAGGGGGCGGATGG + Intronic
1142352064 16:89585098-89585120 TTTCACCTGCAGGAAGTGGAAGG - Intronic
1143284917 17:5781766-5781788 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143284940 17:5781890-5781912 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143284957 17:5781980-5782002 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143421860 17:6799682-6799704 TCTCATGAGCAAGAGGGGCATGG + Exonic
1144021975 17:11245699-11245721 GCTCCTGTGCAGGCAGTGGAAGG - Intronic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1145845419 17:28034342-28034364 TATAATGTGCAGGAAGTGGGAGG - Intergenic
1145863609 17:28226840-28226862 GCAGATGAGCAGGAGGTGGAAGG - Intergenic
1146649638 17:34598636-34598658 TTTGATGTGCAGAAGGTGGAAGG + Intronic
1150473110 17:65454178-65454200 CCTCATGTGGGGAAGGTGGAGGG - Intergenic
1152190709 17:78885691-78885713 TGTGAGGGGCAGGAGGTGGAGGG + Intronic
1154302811 18:13209246-13209268 TGTCCTTTGCAGGATGTGGATGG - Intergenic
1154370065 18:13752322-13752344 TCTCATTTGCAGGATATGGCTGG - Exonic
1155468970 18:26170763-26170785 TCTGATGTCCAGGAGGAGAAAGG - Intronic
1155702100 18:28758921-28758943 TCTTATATGAAGGAGTTGGATGG + Intergenic
1158418999 18:57275988-57276010 TGTGATGTGAAGGAGGTAGAAGG - Intergenic
1160056153 18:75482789-75482811 TCACATGGCCAGGAGGTGGGGGG + Intergenic
1160558167 18:79739575-79739597 TCCCAGCTGCAGGAGGTGGTTGG + Intronic
1161196600 19:2989877-2989899 TCCCAGGTTCAGGAGGTGGCAGG - Intronic
1161846875 19:6716770-6716792 TCTCATTTGCAGGACATGGCAGG + Intronic
1163132795 19:15286206-15286228 TCTCATCTGCTCGGGGTGGAGGG - Intronic
1163833388 19:19558683-19558705 TCCCATGTGCAGCTGGGGGACGG + Intergenic
1164029231 19:21386211-21386233 TCTTATGTGCAGAAAGTTGAGGG - Intergenic
1164769891 19:30800399-30800421 TCTCGGCTGAAGGAGGTGGAAGG - Intergenic
1164851748 19:31489895-31489917 TCTCATTTGCTGGGGGTGGAGGG + Intergenic
1165065866 19:33227275-33227297 TCTCTGGGGCTGGAGGTGGAGGG - Intergenic
1165373614 19:35425978-35426000 TCTCTTGAGCAGGAGCAGGATGG + Intergenic
1166031541 19:40134456-40134478 TCTTTTGCGCAGGGGGTGGAGGG + Intergenic
925182703 2:1827300-1827322 TGTGATCTGCAGGAGGTGGAAGG - Intronic
926065797 2:9838825-9838847 GCGCAGGTGCATGAGGTGGAAGG - Intergenic
928362800 2:30679356-30679378 TCTGATGTGAAAGTGGTGGAGGG - Intergenic
929376977 2:41299298-41299320 GTGTATGTGCAGGAGGTGGAGGG - Intergenic
929890965 2:45918254-45918276 TCTCATGTGCTGGCTGTGGAAGG + Intronic
930151634 2:48066154-48066176 TCTGCTGTGGAGGAGGTGGGTGG + Intergenic
931077969 2:58737464-58737486 TCACATTTGCAGGAGGAAGATGG - Intergenic
932128976 2:69170262-69170284 TCTCCTCGGCAGGGGGTGGAGGG - Exonic
932232533 2:70094595-70094617 TCTCACTGGCAGGAGGTGGCAGG - Intergenic
932750909 2:74371166-74371188 TCTCCTTTGCAGGAGGAGGAGGG - Exonic
933412170 2:81940352-81940374 TCTCTTGTGGAGGGGGTGGGGGG - Intergenic
936260827 2:110958657-110958679 TCCCATGGGCAGCAGATGGAAGG + Intronic
938163730 2:129008896-129008918 TCTCCTGTGCACCAGGTGCAAGG + Intergenic
941029133 2:160492803-160492825 TCGCGTGCGCGGGAGGTGGAGGG + Intronic
942248727 2:174030158-174030180 TCTCGTGTGCTGGAGGTTAAGGG + Intergenic
945128152 2:206536413-206536435 TACCAGGGGCAGGAGGTGGAGGG + Intronic
946361081 2:219219661-219219683 TCCCATGTGCAGGTGATGGGGGG + Exonic
947895308 2:233665892-233665914 TCTCATATGCAGGTGGTGGGAGG - Intronic
948552088 2:238779392-238779414 CCTCATGTGCTGGAGGATGATGG + Intergenic
948835456 2:240624077-240624099 TCTGATCTGCCAGAGGTGGAAGG + Intronic
948836183 2:240627052-240627074 CCTCCTGGGCAGGAAGTGGAAGG + Intronic
1169010368 20:2245175-2245197 TGTTCTGTGCAGGAAGTGGAGGG + Intergenic
1169061207 20:2661684-2661706 TCTCAAGGGCAGGAGTTGTATGG - Intronic
1169949476 20:11027408-11027430 TCTAATGAGCTGGAGTTGGAAGG - Intergenic
1170732598 20:18987638-18987660 TCTTTGGTGGAGGAGGTGGATGG - Intergenic
1170843786 20:19945328-19945350 TCACATGGGCAGGAGGTGGGTGG + Intronic
1171057332 20:21920180-21920202 CCTCATGTGAAGGAAATGGAGGG - Intergenic
1175624968 20:60482406-60482428 GCTCATCTGTAAGAGGTGGACGG - Intergenic
1177701149 21:24640946-24640968 GATCATGTGTTGGAGGTGGATGG - Intergenic
1180258737 21:46651539-46651561 TCTCCAGTGCAGGCAGTGGAGGG + Intronic
1180974716 22:19842024-19842046 CCTGATGAGCAGGAGGTGGGAGG - Intronic
1181515075 22:23405545-23405567 CCTGATGTGCAGGCGGTGGCTGG - Intergenic
1181683074 22:24509263-24509285 TCTCCTATGCAGGGGATGGAGGG - Intronic
1182644926 22:31800513-31800535 TCTCATGGTCAGGAACTGGAAGG + Intronic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
949106375 3:204692-204714 TCTCATGTGCAAAAGGTTCAGGG + Intronic
950489356 3:13294140-13294162 GCTCATATACAGAAGGTGGAGGG + Intergenic
951820586 3:26806413-26806435 TCCCATGTGCAGGAGGTCACAGG + Intergenic
952220584 3:31320287-31320309 TCTCAGGTGCAGAAGTTGAAAGG - Intergenic
953454294 3:43029683-43029705 CCTCATGTCCAGGAGGCAGAAGG + Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
956687811 3:71847400-71847422 TATCATTTGCAGGAGATGGAGGG - Intergenic
959100067 3:102000329-102000351 TTTCATGTGCATGATTTGGAAGG + Intergenic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
963785613 3:149531550-149531572 GCGCAGGTGCAGGAGGTGGGAGG - Intronic
965603707 3:170479410-170479432 TCTGATGTTCATGAGGTGGCTGG - Intronic
965770462 3:172176535-172176557 TTTCATGTACAGGAAGAGGAAGG + Intronic
966585259 3:181616630-181616652 TCTCCAGTTCAAGAGGTGGAAGG - Intergenic
968496932 4:923671-923693 TCTCAAGGGCAGGGAGTGGAGGG + Intronic
969455375 4:7297139-7297161 TCTCCTCTGCATTAGGTGGAGGG + Intronic
969842595 4:9893388-9893410 TCTCATTTGCAGGGGGAGGGCGG + Intronic
972279322 4:37587191-37587213 GCTTATGAGAAGGAGGTGGAGGG - Intronic
973694833 4:53480347-53480369 TTTCATGATGAGGAGGTGGAAGG + Intronic
973801666 4:54484463-54484485 TCTCATCTGCATGGGGTGGTTGG - Intergenic
974392200 4:61285889-61285911 TCTCCTTTGCATGAGTTGGAGGG - Intronic
975417456 4:74121496-74121518 TCCCATGTGCAGGTGATGGGAGG - Intronic
975781276 4:77842573-77842595 TCACATGTACAATAGGTGGAAGG - Intergenic
976239742 4:82942644-82942666 TCCCAGGAGCAGGTGGTGGAGGG - Intronic
978273864 4:106925123-106925145 TCTCTTGCACAGGAGGTGAAGGG - Intronic
978627092 4:110698991-110699013 TCTCATGTTCATGAATTGGAAGG - Intergenic
979947402 4:126850454-126850476 AGTCATGAGCAGGAAGTGGAAGG - Intergenic
980093071 4:128462375-128462397 AATGATGTGCAGGAGGTGGGTGG + Intergenic
985168615 4:187124478-187124500 TTCTGTGTGCAGGAGGTGGACGG - Intergenic
985520142 5:370409-370431 TCTCCCGTCCAGGAGTTGGATGG - Intronic
986007725 5:3682007-3682029 TCCCATTTGGAGGGGGTGGAGGG + Intergenic
990107690 5:52284860-52284882 TCTCATGTGCTAAAGGTGTAGGG + Intergenic
992255525 5:74917202-74917224 TCTCATTGGCAGGAAGTGGAAGG - Intergenic
992834749 5:80629127-80629149 TCTGATGTCCAGGAGGAGAAAGG - Exonic
993879697 5:93347987-93348009 TACAATGTGCAGCAGGTGGACGG - Intergenic
994355673 5:98791791-98791813 TCTCTGGTACAGGTGGTGGAGGG - Intronic
996213974 5:120845318-120845340 TCTCATTTGCAGGATGAAGAGGG + Intergenic
997958556 5:138300089-138300111 TCTCAGGAGGCGGAGGTGGAAGG + Intronic
998203446 5:140143304-140143326 GCTCATGTGCAGGAGCCTGAGGG - Intergenic
998390288 5:141783087-141783109 CCACAGGGGCAGGAGGTGGAGGG - Intergenic
998812163 5:145977188-145977210 TAGCATGTGCAGGAGGTAGTCGG - Intronic
1000810119 5:165851040-165851062 TTTTATGTGGAAGAGGTGGAAGG - Intergenic
1001303753 5:170556517-170556539 TCTCCTCTCCAGGAGGTGGGGGG + Intronic
1001795878 5:174502064-174502086 TCCCATAAGCAGAAGGTGGAGGG + Intergenic
1001964775 5:175902515-175902537 TCTCATCTGCACCAGGAGGACGG + Intergenic
1002087876 5:176787001-176787023 TCTCATGTTCAGGCTGTAGATGG + Intergenic
1002097680 5:176840998-176841020 TCTCCGGTGAAGGAGGTGGATGG - Intronic
1002201183 5:177529363-177529385 TGTGAAGTCCAGGAGGTGGAAGG + Intronic
1002252175 5:177936673-177936695 TCTCATCTGCACCAGGAGGACGG - Intergenic
1003132369 6:3405755-3405777 TCTAATGTGCTGGTGTTGGATGG - Intronic
1003576843 6:7304902-7304924 TCTTAAGTGCATGAGCTGGATGG - Intronic
1004015645 6:11729483-11729505 TCTCAGGGACAGGAGGGGGAAGG - Intronic
1004324810 6:14665070-14665092 TGTCCTGTACAGAAGGTGGAAGG - Intergenic
1004924609 6:20404163-20404185 TCCCTTGTGCTGGAGGGGGAGGG + Intronic
1005087894 6:22025610-22025632 TCCCAAGTGCAGGGGGTGGAGGG - Intergenic
1006683200 6:35811915-35811937 TGTCATGTTCTGGGGGTGGAGGG + Intronic
1007452438 6:41950478-41950500 TCTCATTTGCAAAAGGAGGATGG + Intronic
1008534375 6:52496081-52496103 TGTCAGGTTCAGGTGGTGGAAGG + Intergenic
1008871397 6:56276566-56276588 TCTGATGTCCAGGAGGAGAAAGG - Intronic
1009333902 6:62460980-62461002 TCTGATGTGGAGGAGGAGAAAGG - Intergenic
1010039820 6:71368222-71368244 TCTCATGTGCCAGAGGAGAACGG + Intergenic
1011633497 6:89349831-89349853 TGACATGTGCAGCAGGTGGTGGG - Intronic
1013043340 6:106458776-106458798 TCCCATGTGCGGGAGGAGAAGGG - Intergenic
1015234620 6:130956323-130956345 TTTCAGCTGCAGGAGGTGGCTGG + Exonic
1015487262 6:133787117-133787139 CCTCAAGTGCAGGACGGGGAGGG - Intergenic
1017159484 6:151351449-151351471 ACTCCGGTGCAGGAGGTGGAAGG + Exonic
1017924007 6:158895427-158895449 TCTCATGAGCATGAGGTGTGGGG - Intronic
1018600295 6:165531011-165531033 TCCCATGTAGAGGAGGAGGATGG - Intronic
1021265516 7:18516499-18516521 TCTCATGTGAAGGAGGTGAGAGG - Intronic
1021460334 7:20879778-20879800 TCTCATGAACTGGAGGTGGCAGG - Intergenic
1021555307 7:21912757-21912779 TCTCTCGTGCAGGAGGTGAGAGG + Intronic
1023866400 7:44240453-44240475 GCTCGTGTTCAGGGGGTGGAGGG + Intronic
1023976194 7:45031987-45032009 TCTCAGCTGCAGGGGGTGGTAGG - Intronic
1029153838 7:98500888-98500910 TCACGTGTGGAAGAGGTGGAGGG + Intergenic
1031122607 7:117738740-117738762 TCTGATGTGCAGCAGGTGGTGGG + Intronic
1032405119 7:131650267-131650289 GACCATGTGGAGGAGGTGGAAGG - Intergenic
1033584258 7:142762542-142762564 TCACATGGGCAGGAGAGGGATGG - Intronic
1034488510 7:151380935-151380957 TCACTGGTGCAGGAAGTGGATGG - Intronic
1035278074 7:157759860-157759882 TCTCTTGGGGAGGAGCTGGATGG + Intronic
1035380765 7:158439246-158439268 AGGCATGCGCAGGAGGTGGACGG - Intronic
1038260042 8:25984889-25984911 TCTCAGTTTCAGGAGGTGGGTGG - Intronic
1041353474 8:56973952-56973974 TCTCGGGTGGAGGAGGTGGAAGG - Intronic
1041430446 8:57776037-57776059 GCCCATGGGCAGGAGCTGGAAGG - Intergenic
1041545228 8:59034941-59034963 TCTCAAGGTCAGGAAGTGGAAGG + Intronic
1045504531 8:102769179-102769201 TCTGATTTGAAGGAGGAGGATGG - Intergenic
1046271161 8:111899213-111899235 TCTCGTGTGCAGCAGCAGGATGG - Intergenic
1046568564 8:115933047-115933069 TTTCATGTGCAGAAAGTGGTAGG + Intergenic
1046604379 8:116354592-116354614 TCTGATGTGGGGGAGGGGGAAGG - Intergenic
1047731742 8:127734413-127734435 TCTCTTTTGGAGGTGGTGGAGGG + Intergenic
1048794600 8:138138189-138138211 TCTCCTGTGGAGGAGGAGGAGGG - Intronic
1048972054 8:139650636-139650658 ACTCATGTGCAGGCAGTGGCTGG + Intronic
1049203585 8:141353178-141353200 TCTGATGGGCAGGGGATGGAGGG - Intergenic
1050217719 9:3346697-3346719 GCTCAGGTGCAGTATGTGGAAGG - Exonic
1050237989 9:3603142-3603164 TGTCATATGCAGGAAGAGGAAGG - Intergenic
1051851894 9:21519007-21519029 TCACATGGCCAGAAGGTGGAAGG - Intergenic
1055000746 9:71446817-71446839 TCTCATGGGGAAGAAGTGGAGGG - Intronic
1055036835 9:71826588-71826610 TGTCATGTCCAGGATGGGGAGGG + Intergenic
1055382540 9:75724614-75724636 TCACATGGGCAGGAGGTGGGTGG + Intergenic
1057225138 9:93289176-93289198 GCTCAGGTGCAGGAGGTGGCAGG - Exonic
1058656528 9:107226980-107227002 ACTTATGTGCAGAAGGAGGATGG + Intergenic
1058868037 9:109179683-109179705 TCTGATTTGCAGAATGTGGATGG - Intronic
1059650696 9:116313324-116313346 TCATATGTGCAGGTGGTGAAAGG + Intronic
1060552829 9:124493682-124493704 TCTCAGGCTCAGGAGGAGGAGGG + Intronic
1061496974 9:130980697-130980719 TCTAATGAGGAGCAGGTGGATGG - Intergenic
1062611451 9:137376384-137376406 TCTGGTGAACAGGAGGTGGAAGG - Intronic
1203773760 EBV:61843-61865 GCTCGTGTGCAGGAGGCGGCGGG - Intergenic
1190413053 X:50156120-50156142 GCAGATGAGCAGGAGGTGGAAGG - Intergenic
1190497895 X:51044265-51044287 TCTTAGGTGCAGGAGTGGGAGGG + Intergenic
1197588008 X:128373633-128373655 TCTCATTGGAAAGAGGTGGAGGG + Intergenic
1197706774 X:129639858-129639880 TCTGCAGTGCTGGAGGTGGAAGG + Intergenic
1198946720 X:142024330-142024352 TCACATGTGCAGGAGAAAGACGG - Intergenic
1201264246 Y:12190779-12190801 TCTTATGTGCAGGAAGGGGCAGG - Intergenic
1201622830 Y:15979580-15979602 TCTCCTGTGGTGCAGGTGGATGG + Intergenic
1202275668 Y:23117094-23117116 TGTCTTTTGCAGGAAGTGGATGG + Intergenic
1202290360 Y:23303597-23303619 TGTCTTTTGCAGGAAGTGGATGG - Intergenic
1202428660 Y:24750813-24750835 TGTCTTTTGCAGGAAGTGGATGG + Intergenic
1202442131 Y:24919276-24919298 TGTCTTTTGCAGGAAGTGGATGG - Intergenic