ID: 962113724

View in Genome Browser
Species Human (GRCh38)
Location 3:132478629-132478651
Sequence ACGTGGTGGCATGTACCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 0, 2: 8, 3: 62, 4: 368}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962113724 Original CRISPR ACGTGGTGGCATGTACCTGG TGG Intronic
900919015 1:5659020-5659042 AGGTGGGGGCATGTTCCAGGTGG - Intergenic
901316508 1:8313639-8313661 GCGTGGTGGCGTGCACCTGTAGG - Intergenic
901397676 1:8993280-8993302 ACGTTGTGGGAGGGACCTGGTGG - Intergenic
901693861 1:10991968-10991990 GCATGGTGGCATGTAACTGTAGG + Intergenic
901906136 1:12413343-12413365 GCGTGGTGGTATGTACCTGTAGG + Intronic
901906537 1:12416970-12416992 ACCTGGTGGCAGGTGACTGGAGG - Intronic
902424048 1:16305247-16305269 GCGTGGTGGCATGCACCTGTGGG + Intronic
902775144 1:18669943-18669965 GCGTGGTGGCACGTGCCTGTAGG + Intronic
903146633 1:21376939-21376961 ATGTTGTGGGAGGTACCTGGTGG + Intergenic
903231841 1:21927042-21927064 AGGTGGTGGCAGGGACCCGGAGG + Intronic
904383146 1:30124914-30124936 TCGTGGTGGCAAGGACCTTGTGG + Intergenic
905759186 1:40539357-40539379 GTGTGGTGGCATGTGCCTGTAGG + Intronic
906256552 1:44355064-44355086 ACGTCGGGGCCTGCACCTGGAGG - Exonic
907074182 1:51563943-51563965 GTGTGGTGGCATGCACCTGGTGG + Intergenic
908705423 1:66948758-66948780 GCATGGTGGCATGCACCTGTAGG + Intronic
909687273 1:78364341-78364363 GCGTGGTGGCACGCACCTGTAGG - Intronic
909896735 1:81080658-81080680 GTGTGGTGGCATGTGCCTGTAGG - Intergenic
910584670 1:88866226-88866248 GCGTGGTGGCATGTGCCTGTAGG + Intronic
910952698 1:92667752-92667774 GCGTGGTGGCATGTGCCTGTAGG - Intronic
911009234 1:93262126-93262148 ATGTGGAGGAAGGTACCTGGTGG - Intronic
911406590 1:97448083-97448105 GCATGGTGGCATGCACCTGTAGG + Intronic
913504536 1:119504339-119504361 GCATGGTGGCAGGTGCCTGGAGG + Intergenic
914853318 1:151331184-151331206 ACGTGGTAGTATGCACCTGTGGG + Intergenic
917551984 1:176041971-176041993 ACATGGTGGCACGTGCCTGTAGG + Intronic
917823288 1:178789043-178789065 GCGTGGTGGCATGCACCTGGAGG - Intronic
918633371 1:186746616-186746638 ATGTAGTGGAAGGTACCTGGTGG + Intergenic
919064090 1:192670944-192670966 ATGTTGTGGGAGGTACCTGGTGG + Intergenic
919204768 1:194407646-194407668 GCGTGGTGGCATGTACAGGTGGG + Intergenic
919810118 1:201404040-201404062 GCCTGGTGGAATGTCCCTGGAGG - Intronic
919912380 1:202119423-202119445 GCATGGTGGCATGTGCCTGTGGG + Intergenic
920586110 1:207163007-207163029 ACGTGGTGGCAGGTGCCTGTAGG + Intergenic
920778460 1:208964560-208964582 GCGTGGTGGCACGTGCCTGTTGG - Intergenic
923669578 1:236029036-236029058 GTGTGGTGGCATGTGCCTGTAGG + Intronic
923670197 1:236033722-236033744 AAATGTTGGCATATACCTGGGGG + Intronic
924248841 1:242110669-242110691 GTGTGGTGGCATGTGCCTGCAGG + Intronic
924350038 1:243106072-243106094 ACGTTGTGGGAGGGACCTGGTGG + Intergenic
1063856100 10:10255737-10255759 ATGTGGTGGGAGGGACCTGGTGG - Intergenic
1063895040 10:10671026-10671048 GCACGGTGGCATGTACCTGCAGG + Intergenic
1064791279 10:18959945-18959967 ACGTGGTGGCCAGTCCCTGGTGG + Intergenic
1065160054 10:22909996-22910018 ATGTTGTGGGATGGACCTGGTGG - Intergenic
1065958663 10:30715577-30715599 GCATGGTGGCATGCACCTGCAGG + Intergenic
1066352237 10:34646813-34646835 AGGTGGTGGCATATACCTGTGGG - Intronic
1066419284 10:35249069-35249091 GAGTGGTGGCATGCACCTGTTGG - Intronic
1068446274 10:57127857-57127879 ACGTGGTGGCATGCACCTCAGGG - Intergenic
1068487382 10:57677616-57677638 ATGTGGTGGGAGGGACCTGGTGG - Intergenic
1069504055 10:68980858-68980880 ATGTAGTGGCATGCACCTGTAGG + Intronic
1069691938 10:70359413-70359435 GTGTGGTGGCATGCACCTGTGGG + Intronic
1070629492 10:78074858-78074880 GCGTGGTGGCATGCACCTGTAGG - Intergenic
1072757913 10:98032620-98032642 AGGTGGTGGCATGTTCCAGCAGG - Intergenic
1073305283 10:102498601-102498623 GCTTGGTGGCATGCACCTGTAGG - Intronic
1073370218 10:102981527-102981549 GTGTGGTGGCATGCACCTGTGGG - Intronic
1074804117 10:117030025-117030047 GCGTGATGGCATGCACCTGTAGG - Intronic
1074862551 10:117523311-117523333 ACCTGGTGGCAGGTACCTAGTGG + Intergenic
1075941901 10:126396913-126396935 AAGTGGTGCCATGTGACTGGAGG - Intergenic
1076064065 10:127434789-127434811 GCATGGTGGCATGTGCCTGTAGG - Intronic
1079143703 11:17832181-17832203 ACGTTGTGGGAGGGACCTGGTGG + Intronic
1079505155 11:21144936-21144958 ACATATTGGCATGTACCTTGGGG + Intronic
1079514242 11:21248204-21248226 ATGTGGTGGCACGCACCTTGTGG + Intronic
1079695865 11:23481979-23482001 GCATGGTGGCATGCACCTGTAGG + Intergenic
1081815142 11:45934944-45934966 AGGTGGTGCCTTGTACTTGGTGG - Intronic
1081875242 11:46404065-46404087 GCGTGGTGGCGTGTGCCAGGAGG + Intronic
1081879824 11:46439133-46439155 ATATGGTGGCATGTGCCTGTAGG + Intronic
1081995299 11:47359837-47359859 AGGCGGTGGCATGCACCTGGTGG + Exonic
1082766604 11:57173574-57173596 GCATGGTGGCATGCACCTGTGGG - Intergenic
1083039779 11:59674289-59674311 ATGTGGTGGCACGTGCCTGAAGG - Intergenic
1083211032 11:61186290-61186312 ACGTGGTGGCACGTGCCTGTAGG - Intergenic
1084662645 11:70555585-70555607 ACATGGTGGCATGTGCTTGTAGG + Intronic
1084913161 11:72407783-72407805 GCGTGGTGGCAGGCACCTGTAGG - Intronic
1085059627 11:73433048-73433070 GCGTGGTGGCACGCACCTGTAGG - Intronic
1085970872 11:81589069-81589091 GCATGGTGGCATGCGCCTGGTGG - Intergenic
1086056707 11:82654856-82654878 ACGTTGTGGGAGGGACCTGGTGG + Intergenic
1086470419 11:87103324-87103346 AAGTGTTGGCAAGTACCTGGAGG - Intronic
1086903573 11:92394331-92394353 GGGTGGTGGCATGCACCTGTAGG + Intronic
1089716579 11:120366115-120366137 ATGTGGTGGCATATGCCTGTGGG + Intronic
1090826513 11:130390928-130390950 ATGTGGTGGCATGCACCTGTAGG - Intergenic
1090956175 11:131514725-131514747 GCGTGGTAGCATGGACCTGTAGG - Intronic
1091226653 11:133960770-133960792 ATGTGGTGGCATGTGCCTGTAGG - Intergenic
1091350567 11:134890850-134890872 ACGTTGTGGGAGGGACCTGGTGG + Intergenic
1091570061 12:1677318-1677340 GCATGGTGGCATGTACCCGTAGG - Intergenic
1092497792 12:9013751-9013773 ACCTGGTGGGAGGTACCTGGTGG - Intergenic
1092527911 12:9320772-9320794 GAGTGGCTGCATGTACCTGGTGG - Intergenic
1092539355 12:9411006-9411028 GAGTGGCTGCATGTACCTGGTGG + Intergenic
1094500154 12:31013843-31013865 GAGTGGCTGCATGTACCTGGCGG - Intergenic
1095039033 12:37422213-37422235 AAATGGTGGCTTGTGCCTGGTGG + Intergenic
1096325228 12:50654491-50654513 ATGTGGTGGCATGTGCCTGTAGG - Intronic
1096570489 12:52520293-52520315 ACATGGTGGCTTGTTCCTGGTGG + Exonic
1097499060 12:60378920-60378942 ATGTTGTGGGATGGACCTGGTGG + Intergenic
1097648440 12:62264121-62264143 GCGTGGTGGCATGTGCCTGCAGG - Intronic
1098333577 12:69379550-69379572 TAGTGGTGGCATGTGCCTGTGGG - Intronic
1098849420 12:75577647-75577669 GCGTGGTGGCATTCACCTGCAGG - Intergenic
1099187843 12:79535143-79535165 CCGTGGTGGCATGTGCCTGTAGG + Intergenic
1099983679 12:89637535-89637557 GCGTGGTGGCATGCGCCTTGTGG - Intronic
1100038579 12:90282681-90282703 ATGTGGTGGGAGGGACCTGGTGG + Intergenic
1100959137 12:99943690-99943712 ATGTTGTGGCAGGGACCTGGTGG - Intronic
1103002920 12:117399418-117399440 ACGTTGTGGGAGGGACCTGGTGG - Intronic
1103083761 12:118045557-118045579 ACGTGGTGGCAGGGACCTGGTGG + Intronic
1104693332 12:130843194-130843216 GCATGGTGGCATGTGCCTGTAGG + Intergenic
1105381771 13:19893910-19893932 ACGTGGTGGTGTGTGCCTGTAGG - Intergenic
1105773301 13:23633249-23633271 CCATGCTGGCATGTACCTGTGGG - Intronic
1106449592 13:29868076-29868098 GCGTGGTGGCATGCACCTGCAGG + Intergenic
1106547206 13:30741242-30741264 GCGTGGTGGCAGGCACCTGTAGG - Intronic
1106788338 13:33129581-33129603 GCGCGGGGGCATGTACTTGGAGG - Exonic
1108073457 13:46653690-46653712 GCGTGGTGGCGTGCACCTGTAGG + Intronic
1108102441 13:46970917-46970939 GTGTGGTGGCATGCACCTGTAGG + Intergenic
1108355770 13:49627724-49627746 GCGTGGTGGCACCTACCTGTAGG - Intergenic
1108420078 13:50239913-50239935 GCGTGGTGGCACGTGCCTGTAGG - Intronic
1109129300 13:58560943-58560965 ATGTGGTGGGAAGAACCTGGAGG - Intergenic
1110115078 13:71804178-71804200 CCGTGGTGGCATGCACTTGTAGG + Intronic
1111815948 13:93152654-93152676 ATGTTGTGGGATGGACCTGGTGG + Intergenic
1111885736 13:94018426-94018448 ATGTGGTGGCATGTGCCTGTAGG - Intronic
1112180794 13:97078041-97078063 GCGTGGTGGCACATGCCTGGAGG + Intergenic
1112334605 13:98503839-98503861 GAGTCGTGGCATGTTCCTGGGGG - Intronic
1112453773 13:99538651-99538673 GCATGGTGGCATGTGCCTGTAGG + Intronic
1112672067 13:101652278-101652300 GTGTGGTGGCATGCACCTGCAGG - Intronic
1112943395 13:104894199-104894221 GCATGGTGGCACGTGCCTGGTGG - Intergenic
1113143553 13:107182411-107182433 GCGTGGTGGCATTCACCTGTAGG - Intronic
1114464637 14:22912859-22912881 ACGTGGTGGCACGCGCCTGTAGG + Intronic
1116821428 14:49631484-49631506 GCGTGGTGGCAGGTGCCTGTAGG + Intronic
1117277800 14:54207168-54207190 ACATGGTGGCGTGTGCCTGTAGG - Intergenic
1118015602 14:61657300-61657322 GGGTGGTGGCATTTACCTGTAGG - Intronic
1118632297 14:67716743-67716765 ATGTGGTGGCAGGCACCTGTGGG + Intronic
1118938807 14:70313635-70313657 ACGTTGTGGGAAGGACCTGGTGG + Intergenic
1119634197 14:76260889-76260911 GCCTGGTGGCATGCACCTGTAGG + Intergenic
1119911933 14:78357374-78357396 ATGTGGTGGGAAGAACCTGGTGG - Intronic
1120782440 14:88497638-88497660 GCGTGGTAGCAGGTACCTGTAGG + Intronic
1120785271 14:88528564-88528586 ACGTTGTGGGAGGGACCTGGTGG + Intronic
1121131408 14:91450784-91450806 ACATGGTGGCATGAACCTATTGG - Intergenic
1121133523 14:91472601-91472623 GCGTGGTGGCAGGTGCCTTGTGG - Intronic
1121512992 14:94526869-94526891 ATGTTGTGGGATGGACCTGGTGG + Intergenic
1121772247 14:96557014-96557036 AAATGGTGGCATGCACCTGTGGG - Intronic
1122596507 14:102896932-102896954 TGGTGGTGGCATGTACCTGTAGG + Intronic
1122722325 14:103729176-103729198 ACGTGCTGGCATTTACCTCCAGG - Exonic
1122943105 14:104991923-104991945 GCGTGGTGGCATGTGCGTGGCGG - Intronic
1122943121 14:104992033-104992055 GCGTGGTGGCGTGTGCGTGGCGG - Intronic
1122943134 14:104992108-104992130 GCGTGGTGGCGTGTGCATGGCGG - Intronic
1122961557 14:105096243-105096265 GCGTGCTGGCCTGTGCCTGGTGG - Intergenic
1123807842 15:23893609-23893631 GCATGGTGGCATGCACCTGTAGG - Intergenic
1124358231 15:29014843-29014865 GCCTGGTGCCATGTACCTGTAGG - Intronic
1125514638 15:40311184-40311206 CTGTGGTGGCATGAAGCTGGTGG - Intergenic
1125558487 15:40606896-40606918 GCATGGTGGCATGTTCCTGTAGG - Intronic
1125955748 15:43790001-43790023 GCGTGGTGGCACGCACCTGTAGG + Intronic
1126942594 15:53782385-53782407 ATGTTGTGGGAGGTACCTGGTGG - Intergenic
1126973354 15:54145701-54145723 ACATCGTGTCATGCACCTGGAGG + Intronic
1127244767 15:57160421-57160443 ACGTCGTGGGAGGGACCTGGTGG - Intronic
1128835850 15:70808475-70808497 GCGTGGTGGCATATGCGTGGTGG - Intergenic
1129035916 15:72648279-72648301 GGGAGGTGGCACGTACCTGGGGG - Intergenic
1129050072 15:72773978-72774000 GCATGGTGGCATGTGCCTGTGGG - Intronic
1129213969 15:74088937-74088959 GGGAGGTGGCACGTACCTGGGGG + Intergenic
1129338442 15:74868679-74868701 GTGTGGTGGCATGCACCTGTGGG - Intronic
1129644031 15:77413960-77413982 GTGTGGTGGCATGTGCCTGTGGG - Intronic
1129716877 15:77857428-77857450 ACGTGGTGGGATGTGCAAGGTGG + Intergenic
1129976656 15:79828071-79828093 GAGTGGTGGCATGTGCCTGTAGG + Intergenic
1130562085 15:84966806-84966828 ACGTTGTGGGAGGGACCTGGTGG - Intergenic
1130738735 15:86575726-86575748 ATGTGGTGGTGTGTACCTGTAGG - Intronic
1131101969 15:89698994-89699016 GCGTGGTGGCATGTGCTTGGAGG - Intronic
1132525848 16:414274-414296 GTGTGGTGGCATGCACCTGTAGG - Intergenic
1132795530 16:1719705-1719727 ATGTGGTGGCACGTGCCTGTGGG + Intronic
1134061931 16:11204625-11204647 AAGTGGTGGCACATACCTGGTGG - Intergenic
1134327711 16:13222180-13222202 ACCTGGTGGGAGGGACCTGGTGG - Intronic
1135661958 16:24304697-24304719 GCATGGTGGCGTGTACCTGTAGG - Intronic
1135935329 16:26775045-26775067 AAGTAGTGGCATGTAACTGGGGG - Intergenic
1137268811 16:46889164-46889186 ACGTGGTGGCATACGCCTTGTGG - Intronic
1138725597 16:59135315-59135337 GCATGGTGGCATGCACCTGTAGG + Intergenic
1139559090 16:67730328-67730350 ACATGGTGCCAGGGACCTGGGGG + Intronic
1139810312 16:69609864-69609886 ACATGGTGGCATGAGCCTGTAGG + Intronic
1139913352 16:70412503-70412525 GCGTGGTGGCATGTTTCTGTAGG + Intronic
1140408280 16:74725357-74725379 GGCAGGTGGCATGTACCTGGAGG + Intronic
1141313728 16:82940114-82940136 ACGTTGTGGGAGGGACCTGGTGG - Intronic
1141398861 16:83728984-83729006 TCCTTGGGGCATGTACCTGGAGG + Intronic
1141529958 16:84639343-84639365 ACGTTGTGGGAGGGACCTGGTGG + Intergenic
1142543556 17:681273-681295 GTGTGGTGGCATGCACCTGTAGG - Intronic
1142774813 17:2128683-2128705 GCGTGGTGGCGTGCACCTGTAGG + Intronic
1143114592 17:4575576-4575598 AGGTGGAGGGAAGTACCTGGAGG + Intergenic
1143505766 17:7364235-7364257 TCGTGGTGGCAGGCACCTGTAGG - Intergenic
1144178818 17:12733169-12733191 ATGTGGTGGCAGGTGCCTGTAGG + Intronic
1146230815 17:31107401-31107423 GCATGGTGGCATGCACCTGTGGG - Intronic
1146719167 17:35111240-35111262 GCCTGGTGGCATGTGCCTGTAGG + Intronic
1146851336 17:36224426-36224448 GCGTGGTGGCAGGTGCCTGTAGG - Intronic
1146867249 17:36348299-36348321 GCGTGGTGGCAGGTGCCTGTAGG - Intronic
1147070124 17:37948910-37948932 GCGTGGTGGCAGGTGCCTGTAGG - Intergenic
1147081645 17:38028436-38028458 GCGTGGTGGCAGGTGCCTGTAGG - Intronic
1147097596 17:38152406-38152428 GCGTGGTGGCAGGTGCCTGTAGG - Intergenic
1148512728 17:48186605-48186627 GCATGGTGGCATGTGCCTGTAGG - Intronic
1150578236 17:66449148-66449170 GTGTGGTGGCATGTGCCTGTAGG + Intronic
1151609083 17:75159617-75159639 GTGTGGTGGCATGTGCCTGTAGG - Intronic
1151968337 17:77444069-77444091 AGGTGGTGACATTTACCAGGGGG + Intronic
1152483968 17:80577414-80577436 GTGTGGTGGCATGCACCTGTAGG - Intronic
1153034256 18:744526-744548 GCGTGGTGGCATGCACCTGTAGG - Intronic
1154248657 18:12723528-12723550 GCATGGTGGCATGTGCCTGTAGG - Intronic
1155459497 18:26061172-26061194 ACATGGTGGCGTGCACCTGTAGG + Intronic
1156284191 18:35674842-35674864 GCGTGGTGGCAGGCACCTGTAGG + Intronic
1156328586 18:36097872-36097894 GCATGGTGGCATGTGCCTGTGGG - Intergenic
1158512944 18:58107578-58107600 AAGTGGTGGCTTGTGCCTGTAGG + Intronic
1158888456 18:61851005-61851027 ACCTGGTGGTATGTACCCTGGGG - Intronic
1159446717 18:68549905-68549927 GCGTGGTGGCAGGCACCTGTAGG - Intergenic
1159506983 18:69351432-69351454 GTGTGCTGGCATGTACCTGTGGG + Intergenic
1159747446 18:72255302-72255324 GCATGGTGGCATGTACCTTATGG + Intergenic
1159750265 18:72292502-72292524 TTGTTGTGGCAGGTACCTGGTGG + Intergenic
1160350524 18:78174527-78174549 ACGAGGTGGCCGGCACCTGGTGG + Intergenic
1161569264 19:5021454-5021476 GTGTGGTGGCATGTACCTGTGGG + Intronic
1162611954 19:11762737-11762759 CCATGGTGGCATGTCCCTGTAGG + Intergenic
1163007209 19:14404555-14404577 ACGTGGAGGTAAGTAGCTGGAGG + Exonic
1163868012 19:19791083-19791105 ACATGGTGGCACACACCTGGAGG - Intronic
1165477914 19:36042490-36042512 ATATGGTGGCATGTGCCTAGAGG + Intronic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
1167140298 19:47645957-47645979 GCGTGGTGGCATGCGCCTGTAGG + Intronic
1167155776 19:47738017-47738039 ACGTGGTGGCACATGCCTGCAGG - Intronic
1167446041 19:49538129-49538151 ACATGGTGGCTTGTGCCTGGTGG - Intronic
1168025857 19:53643185-53643207 GCATGGTGGCATGTACCTGTTGG - Intergenic
1168095231 19:54110587-54110609 GCGTGGTGGCAGGTGCCTGCAGG + Intronic
925236339 2:2281065-2281087 ATGTTGTGGGATGGACCTGGTGG + Intronic
925948662 2:8890656-8890678 GTGTGGTAGCATGTACCTGTAGG - Intronic
926240633 2:11082120-11082142 GCGTGGTGGCATGTGCCTGTAGG - Intergenic
927274278 2:21248723-21248745 GCATGGTGGCATGCACCTGTAGG - Intergenic
927585951 2:24305455-24305477 GCGTGGTGGCGTGTGCCTGTAGG + Intronic
928205374 2:29279881-29279903 AAGTTCTGGCATGTACCAGGTGG + Intronic
928513954 2:32027765-32027787 GCGTGGTGGCAGGTGCCTGTAGG - Intronic
928652353 2:33416645-33416667 TCATGGTGGCGTGTACCTGTAGG - Intergenic
928988426 2:37204414-37204436 GCGTGGTGGCATGCACTTGTAGG - Exonic
929716384 2:44315079-44315101 ACATGGTGGCAGGCGCCTGGCGG - Intronic
929747422 2:44673286-44673308 GTATGGTGGCATGTACCTGTGGG + Intronic
929820760 2:45271646-45271668 AAGTGGTGCCATGTACTTTGGGG - Intergenic
930807461 2:55505422-55505444 GCCTGGTGGCATGTGCCTGTAGG - Intergenic
932814791 2:74853098-74853120 TCGTCAGGGCATGTACCTGGAGG + Intronic
933251435 2:80033432-80033454 GCTTGGTGGCATGCACCTGTAGG + Intronic
935314081 2:101814150-101814172 ATGTGATAGCATGTATCTGGAGG - Intronic
936501021 2:113066415-113066437 GCATGGTGGCATGCACCTGTAGG - Intergenic
936560986 2:113539723-113539745 GCGTGGTGGCATGTACCTGTAGG + Intergenic
942078628 2:172380140-172380162 ATGTGGTGGGAGGGACCTGGTGG - Intergenic
942452482 2:176116928-176116950 AGGTGGTGGCATGTACATGCTGG - Exonic
942471364 2:176264110-176264132 GCGTGGTGGTATGCACCTGGCGG - Intergenic
943478061 2:188384423-188384445 ATGTTGTGGCAGGAACCTGGTGG - Intronic
943729918 2:191291574-191291596 TAGTGGTGGCATGGACCTGAGGG + Intronic
946709934 2:222495273-222495295 GTGTGGTGGCATGTGCCTGTGGG + Intronic
947153580 2:227138177-227138199 GTGTAGTGGCATGTACCTGTAGG + Intronic
947221615 2:227798706-227798728 GCGTGGTGGCATGTGCCTGTTGG - Intergenic
1169192683 20:3668113-3668135 GCGTGGTGGTGTGTACCTGTAGG - Exonic
1170072367 20:12382394-12382416 GCATGGTGGCAGGTGCCTGGAGG + Intergenic
1170467422 20:16635583-16635605 GCATGGTGGCATGTGCCTGTAGG - Intergenic
1170614771 20:17939645-17939667 CAGTGGTGGCATACACCTGGAGG - Intergenic
1170891529 20:20380269-20380291 ACGTGGTGGCAGGCGCATGGTGG - Intergenic
1171204381 20:23267555-23267577 ACGTGGTGGCCAACACCTGGAGG + Intergenic
1172135919 20:32686628-32686650 GCGTGGTGGCAGGCACCTGTAGG - Intergenic
1172255250 20:33512036-33512058 GCGTGGTGGCATGCGCCTGTAGG + Intronic
1172470786 20:35193312-35193334 GCGTGGTGGCATGCGCCTGTAGG - Intergenic
1173098388 20:40060442-40060464 ATGTCGTGGGAGGTACCTGGTGG + Intergenic
1173731949 20:45335317-45335339 ATGTGGTGGCATGCACCTGTAGG - Intronic
1174220272 20:48948851-48948873 AGGTGGGGACATCTACCTGGGGG + Intronic
1174347602 20:49942118-49942140 GTGTGGTGGTATGTACCTGTAGG + Intronic
1174486059 20:50861990-50862012 GCATGGTGGCATGTGCCTGTGGG - Intronic
1174602855 20:51738941-51738963 GCGTGGTGGCAGGTGCCTGTAGG + Intronic
1174609554 20:51787958-51787980 GCGTGGTGGCATGCGCCTGTAGG - Intronic
1175596492 20:60238926-60238948 ACATGGTGGCAGGTACAAGGGGG - Intergenic
1177411762 21:20738790-20738812 ACCTGGTGGGAGGCACCTGGTGG + Intergenic
1178578014 21:33812635-33812657 GCATGGTGGCATGCACCTGTAGG - Intronic
1178824262 21:36002322-36002344 GCATGGTGGCATGCACCTGTGGG + Intronic
1180154017 21:45969018-45969040 ACATGGTGGCAGGCACCTGCAGG + Intergenic
1180665322 22:17506263-17506285 GCGTGGTGGCATGTGCCTGCAGG - Intronic
1180795358 22:18601451-18601473 GCATGGTGGCATGCACCTGCAGG + Intergenic
1181226382 22:21393861-21393883 GCATGGTGGCATGCACCTGCAGG - Intergenic
1181252268 22:21540977-21540999 GCATGGTGGCATGCACCTGCAGG + Intergenic
1181384291 22:22532632-22532654 GCGTGGTGGCATATGCCTGCAGG - Intergenic
1182209102 22:28659405-28659427 ACGTGGTGGCATGAACCTGTAGG - Intronic
1182786551 22:32912580-32912602 GGGTGGTGGCATGCACCTGTAGG + Intronic
1183166354 22:36149943-36149965 GCGTGGTGGTATGTACCTGTAGG - Intronic
1183316135 22:37137809-37137831 AGGTGGTAGCATGTGCCAGGAGG - Intronic
1184772021 22:46602879-46602901 GCGTGGTGGCATGTGCCTGTAGG - Intronic
950188527 3:10960319-10960341 AAGTGGTGGGAGGAACCTGGAGG - Intergenic
950293379 3:11805900-11805922 ACGTCGTGGGAGGGACCTGGTGG + Intronic
952860536 3:37808688-37808710 ACTTAGTGGCATTTACCTGGTGG + Intronic
953739846 3:45528196-45528218 ATGTGGTGGCATGTGTCTGTAGG + Intronic
953803600 3:46048577-46048599 ATGTGGTCGCATGCACCTTGAGG + Intergenic
953859477 3:46530802-46530824 ACGTTGTGGGAGGGACCTGGTGG - Intronic
953860760 3:46542355-46542377 GTGTGGTGGCATGCACCTGTTGG + Intronic
953930240 3:47002364-47002386 ACATGGTTGGCTGTACCTGGAGG - Exonic
954349298 3:50029592-50029614 GCGTGGTGGCGTGTACCTGTAGG + Intronic
954506170 3:51076321-51076343 ATGTGGTGGCATGCACCTGTAGG + Intronic
954946439 3:54429025-54429047 AGCTGGTGGGATGTACCTGGAGG + Intronic
956236595 3:67079183-67079205 GCGTGGTGGCATACACCTGTGGG - Intergenic
956420049 3:69078610-69078632 GTATGGTGGCATGTACCTGTAGG - Intronic
958421784 3:93938877-93938899 ACTTGGTGGCATGTCAATGGTGG + Intronic
958542578 3:95498412-95498434 ACGTGGTGGCGGGTGCCTGTAGG + Intergenic
959061806 3:101623056-101623078 GCATGGTGGCATGCACCTGTAGG - Intergenic
960517178 3:118615312-118615334 ATATGGTGGCATCTTCCTGGTGG - Intergenic
962113724 3:132478629-132478651 ACGTGGTGGCATGTACCTGGTGG + Intronic
962578598 3:136777008-136777030 GTGTGGTGGCATGTACCTGTAGG + Intergenic
962960489 3:140306964-140306986 ATGTTGTGGAAGGTACCTGGTGG + Intronic
963256014 3:143145580-143145602 GCATGGTGGCATGTGCCTGGAGG + Intergenic
965224682 3:165972805-165972827 ATGTCGTGGGATGGACCTGGTGG + Intergenic
967009278 3:185416758-185416780 GCATGGTGGCATGTGCCTGTAGG - Intronic
967300587 3:188008646-188008668 GTGTGGTGGCATGTGCCTGTAGG - Intergenic
967595639 3:191324438-191324460 ATGTGGTGGGAGGGACCTGGTGG + Intronic
968577013 4:1371750-1371772 ACGTGGTGGGAGGGAGCTGGTGG - Intronic
970308098 4:14753747-14753769 ATGTGGTGGGAGGAACCTGGTGG - Intergenic
970910500 4:21269542-21269564 GCATGGTGGCATGCACCTGTAGG - Intronic
972489565 4:39574377-39574399 GCATGGTGGCATGCACCTGTAGG - Intronic
975653491 4:76618163-76618185 GCGTGGTGGCATGTGCCTATAGG + Intronic
977891183 4:102313726-102313748 ACATGGTGGCATGCACCTGTAGG - Intronic
979535547 4:121816092-121816114 GCGTGGTGGCATGTGCTTGTAGG - Intronic
982577627 4:157135412-157135434 ATGTGGTGGGAGGGACCTGGTGG + Intronic
983454929 4:167952019-167952041 ACGTTGTGGGAGGGACCTGGTGG + Intergenic
984187541 4:176564421-176564443 GCATGGTGGCATGCACCTGTAGG - Intergenic
985406188 4:189640471-189640493 ATGTGGTGGGAGGGACCTGGTGG - Intergenic
985483580 5:135525-135547 GCATGGTGGCAGGTACCTGTAGG + Intergenic
987006953 5:13720519-13720541 ACGTGGTGGCCTGTGCCTGTGGG - Intronic
988450114 5:31333656-31333678 ATGTGGTGGGAGGGACCTGGTGG + Intergenic
988643979 5:33073465-33073487 GTGTGGTGGCATGTACCTTTAGG - Intergenic
989494874 5:42100887-42100909 ATGTGGTGGGAGGGACCTGGTGG + Intergenic
989511806 5:42296420-42296442 ACGTGGAGGCAGGCACCTGTAGG + Intergenic
990412972 5:55559671-55559693 ACATGGTGGTATGCACCTGTAGG + Intergenic
990439890 5:55833804-55833826 GCGTGGTGGCAGGTGCCTGTAGG + Intergenic
990514484 5:56518951-56518973 ACGTGGGGGCATGGATCTGTGGG - Intronic
990580990 5:57167510-57167532 GTGTGGTGGCATGTGCCTGTAGG + Intergenic
992115921 5:73538542-73538564 GCATGGTGGCATGTGCCTGTAGG + Intergenic
994098507 5:95869317-95869339 GCATGGTGGCATGCACCTGTAGG + Intergenic
995560300 5:113374041-113374063 GCGTGGTGGCATGCGCCTGTGGG - Intronic
995655324 5:114419857-114419879 ATGTGGTGGCATGTGCCTTCAGG + Intronic
997305980 5:132836695-132836717 GCATGGTGGCATGTGCCTGCAGG - Intergenic
999456292 5:151719158-151719180 GCGTGGTGACATGTGCCTGTAGG - Intergenic
999473295 5:151875309-151875331 GCATGGTGGCATGCACCTGTAGG - Intronic
1000577097 5:162988139-162988161 ACCTGGTGGGAGGGACCTGGTGG - Intergenic
1001142841 5:169159635-169159657 GCGTGGTGGCAGGCACCTGTAGG + Intronic
1002317283 5:178351288-178351310 CCGTGCTGGCAGTTACCTGGCGG + Intronic
1004345229 6:14843213-14843235 GCATGGTGGCATGTACCTTGTGG + Intergenic
1005484920 6:26290433-26290455 CCATGGTTGCACGTACCTGGAGG + Intergenic
1006346798 6:33488844-33488866 GCGTGGTGGCACGCACCTGTAGG + Intergenic
1007833238 6:44654805-44654827 CCCTGGTGGCATGCACCTGTGGG + Intergenic
1008816329 6:55571055-55571077 ACGTTGTGGGAGGGACCTGGTGG - Intronic
1013687944 6:112608153-112608175 ATGTTGTGGGAGGTACCTGGTGG + Intergenic
1014665219 6:124229623-124229645 ATGTTGTGGCAGGGACCTGGTGG + Intronic
1014741978 6:125156325-125156347 GTGTGGTGGCATGTGCCTGTAGG + Intronic
1014773760 6:125485823-125485845 ATGTGGTGGGAGGGACCTGGTGG - Intergenic
1015161535 6:130157465-130157487 ATGTGGTGGCATGGCCCTGTAGG - Intronic
1015351406 6:132224421-132224443 ATGTGGTGGGAGGGACCTGGTGG + Intergenic
1015764829 6:136705439-136705461 TTGTGGTGGCATGTACCTGTAGG - Intronic
1015846535 6:137525937-137525959 ACCTGGTGGGAGGGACCTGGTGG + Intergenic
1016108300 6:140189298-140189320 ATGTTGTGGGAGGTACCTGGTGG + Intergenic
1016568473 6:145485970-145485992 ATGTGGTGGGAGGGACCTGGTGG - Intergenic
1017404176 6:154099144-154099166 GCGCGGTGGCATGCACCTGTAGG + Intronic
1017673767 6:156793472-156793494 GCATGGTGGCATGTGCCTGTAGG - Intronic
1018281663 6:162192589-162192611 GCGTGGTAGCATGTGCCTGTAGG - Intronic
1018465471 6:164040273-164040295 ACGTGGTGGGAAGCACCAGGTGG - Intergenic
1019012009 6:168850032-168850054 AAGAGGTGGCATGGACCTTGTGG + Intergenic
1019012097 6:168850368-168850390 AAGAGGTGGCATGGACCTTGTGG + Intergenic
1019832794 7:3349736-3349758 GCGTGGTGGCAGGTGCCTGTAGG - Intronic
1020036966 7:4969770-4969792 GAGTGGTGGCATGTGCCTGTAGG + Intergenic
1020163318 7:5788909-5788931 GAGTGGTGGCATGTGCCTGTAGG - Intergenic
1020171629 7:5849559-5849581 GCGTGGTGGCACGTGCCTGTAGG + Intergenic
1020802922 7:12754571-12754593 ACCTGGTTCCATATACCTGGAGG + Intergenic
1021715693 7:23460092-23460114 ACGAGGAGGCATGTGCCTGTAGG + Intronic
1022349436 7:29553817-29553839 ATGTGGTGGGAGGGACCTGGTGG - Intergenic
1023290237 7:38660507-38660529 TCATGGTGGCATGTGCCTGTGGG - Intergenic
1023438040 7:40158609-40158631 GCGTGGTGGCATGTGCCTGTAGG + Intronic
1025199110 7:56950822-56950844 ACCTGGTGGCTCGGACCTGGAGG - Intergenic
1025263645 7:57438920-57438942 ACGTTGTGGAATGTTTCTGGTGG + Intergenic
1025672837 7:63626111-63626133 ACCTGGTGGCTCGGACCTGGAGG + Intergenic
1025901073 7:65745263-65745285 GCATGGTGGCGTGTGCCTGGAGG + Intergenic
1026224762 7:68430595-68430617 ATGTGGTGGGAGGGACCTGGTGG + Intergenic
1026454507 7:70558997-70559019 ACGTTGTGGGAGGGACCTGGTGG + Intronic
1026989941 7:74579180-74579202 ACGTGGTGGTATGCACCTGTAGG + Intronic
1027661036 7:80988421-80988443 ACGTCGTGGGAAGGACCTGGTGG - Intergenic
1028156663 7:87437385-87437407 ACATGGCTGCATTTACCTGGAGG - Intronic
1029108137 7:98194992-98195014 CCATGGTGGCATGAACCTGTGGG - Intronic
1029564533 7:101327135-101327157 GCATGGTGGCATGTACCTGTGGG - Intergenic
1029566069 7:101338923-101338945 ACGTGGTGGCACATCCCTGTAGG - Intergenic
1030257396 7:107525856-107525878 GTGTGGTGGCTGGTACCTGGAGG - Intronic
1031170156 7:118283308-118283330 ATGTCGTGGGAGGTACCTGGTGG + Intergenic
1032829162 7:135605161-135605183 GCGTGGTGGCATGCACCTGTAGG - Intronic
1033853157 7:145523122-145523144 ACCTGGTGGAAGGCACCTGGTGG - Intergenic
1034045972 7:147927977-147927999 ATGTGGTGGGAGGGACCTGGTGG + Intronic
1037506322 8:19533253-19533275 GTGTGGTGGTATGTACCTGTAGG - Intronic
1038613518 8:29073297-29073319 ACTTGGTGGCTTCTCCCTGGGGG - Intronic
1038746637 8:30260682-30260704 AGGTGCTGACATGTACCAGGTGG + Intergenic
1039041757 8:33415121-33415143 CTGTGGTGGCATGTGCCTGTAGG + Intronic
1040426680 8:47294767-47294789 ACGTGGTGGCACATGCCTGTAGG - Intronic
1040428576 8:47314660-47314682 ACGTCGTGGAAGGGACCTGGTGG - Intronic
1040543822 8:48381605-48381627 GCTTGGTGGCATGTGCCTGTAGG - Intergenic
1041052724 8:53953380-53953402 GCGTGGTGGCACGTGCCTGCAGG + Intronic
1041350477 8:56943279-56943301 ATGTGGTGGGAGGGACCTGGTGG - Intergenic
1041572354 8:59352000-59352022 TCATGGTGGCACATACCTGGTGG - Intergenic
1042029848 8:64464052-64464074 ATGTTGTGGGATGCACCTGGTGG + Intergenic
1042057849 8:64786067-64786089 ATGTGGTGGGAGGGACCTGGTGG - Intronic
1042221826 8:66482095-66482117 ATGTGGTGGCAGGCACCTGTAGG - Intronic
1042603758 8:70525782-70525804 GCATGGTGGCATGTGCCTGTAGG - Intergenic
1042711110 8:71718634-71718656 CTGTGGTGGCATGTGCCTGTAGG + Intergenic
1043840136 8:85093211-85093233 GCATGGTGGCATGCACCTGTAGG + Intergenic
1044092726 8:88022333-88022355 ATGTGGTGGGAGGGACCTGGTGG + Intergenic
1044761411 8:95521326-95521348 GCATGGTGGCATGTGCCTGTAGG - Intergenic
1044832682 8:96265632-96265654 GCGTGGTGGCATGCACCTGGAGG + Intronic
1044871284 8:96622329-96622351 CCGTGGTGGCATGCGCCTGTAGG - Intergenic
1044887814 8:96798266-96798288 GTGTGGTGGCATGCACCTGTGGG - Intronic
1045367160 8:101486889-101486911 GCGTGGTGGCAGGCACCTGGTGG + Intergenic
1047051155 8:121115014-121115036 GTGTGGTGGCATGCACCTGTAGG - Intergenic
1047539890 8:125754512-125754534 CCATGGTGGCATGTGCCTGTGGG + Intergenic
1047746330 8:127847825-127847847 AAGTGGTGGCCTGTGCGTGGTGG + Intergenic
1047798741 8:128286522-128286544 GTGTGGTGGCATACACCTGGAGG + Intergenic
1048042427 8:130744245-130744267 ACGTGGTGGCATGTGCCTATAGG + Intergenic
1049035492 8:140072391-140072413 GTGTGGTGGCATGTGCCTGTAGG + Intronic
1049891694 9:75603-75625 GCGTGGTGGCATGTACCTGTAGG - Intergenic
1051417090 9:16853269-16853291 CCGTGGTGGCATGCAGCTGTAGG + Intronic
1052029332 9:23610596-23610618 AGGTGGGGGCATGTAGCTGCTGG - Intergenic
1053641787 9:40089382-40089404 ACGTTGTGGGAGGAACCTGGTGG - Intergenic
1053733121 9:41076694-41076716 GCGTGGTGGCATGTACCTGTAGG - Intergenic
1053764349 9:41376082-41376104 ACGTTGTGGGAGGAACCTGGTGG + Intergenic
1054542964 9:66287260-66287282 ACGTTGTGGGAGGAACCTGGTGG + Intergenic
1054695302 9:68354869-68354891 GCGTGGTGGCATGTACCTGTAGG + Intronic
1055492254 9:76817455-76817477 ACATGGTCACATGTAACTGGAGG - Intronic
1055985612 9:82055082-82055104 GCGTGGTGGCAGGCACCTGTAGG + Intergenic
1056308979 9:85320898-85320920 GCATGGTGGCCTGTCCCTGGTGG - Intergenic
1057163625 9:92908971-92908993 GCGTGGTGGCACGTGCCTAGTGG - Intergenic
1057253289 9:93521441-93521463 ACATGGTGGCATGTGCCTGTGGG + Intronic
1059122314 9:111652377-111652399 GCGTGGTGGCATGCTCCTGTAGG + Intronic
1059228742 9:112697443-112697465 GCTTGGTGGCATGTGCCTGTAGG + Intronic
1060648250 9:125301205-125301227 ATGTGGTGGCGTGTGCCTGTAGG - Intronic
1060759983 9:126238847-126238869 ATGTGGTGGCTTGGACCAGGTGG + Intergenic
1060870283 9:127034483-127034505 ACGTTGTGGCCTTTACCCGGAGG + Exonic
1060905080 9:127297275-127297297 ACGTGGTGGCCTGCGCCTGTAGG - Intronic
1061378313 9:130239210-130239232 GCGTGGTGGCAGGTGCCTGTGGG + Intergenic
1185691663 X:2160232-2160254 ATGTTGTGGGAGGTACCTGGTGG - Intergenic
1185992938 X:4912346-4912368 ATGTGGTGGCAGGAGCCTGGTGG + Intergenic
1186270445 X:7880992-7881014 ATGTTGTGGGAGGTACCTGGTGG + Intergenic
1187853466 X:23613962-23613984 ATGTTGTGGGATGGACCTGGTGG - Intergenic
1188298243 X:28476610-28476632 GCATGGTGGCATGCACCTGTAGG - Intergenic
1189684160 X:43546380-43546402 GCGTGGTGGCATGTGTCTGTAGG - Intergenic
1190789815 X:53687753-53687775 GCGTGGTGGCGCATACCTGGAGG - Intergenic
1192842064 X:74866636-74866658 ATGTGGTGGGAGGGACCTGGTGG + Intronic
1193662648 X:84275484-84275506 ATGTGGTGGGAGGGACCTGGTGG - Intergenic
1196405622 X:115359641-115359663 ACGTCGTGGGAGGGACCTGGTGG + Intergenic
1196756181 X:119159471-119159493 ATGTGGTGGCGTGCACCTGTAGG - Intergenic
1197940720 X:131786009-131786031 GCGTGGTGGCATGCACCTGTGGG + Intergenic
1198074730 X:133183495-133183517 GTGTGGTGGTATGTACCTGTAGG + Intergenic
1198948258 X:142039804-142039826 ACGTGATGGGAGGGACCTGGTGG + Intergenic
1198996226 X:142577243-142577265 ATGTGGTGGGAGGGACCTGGTGG + Intergenic
1199301382 X:146218223-146218245 GCGTGATGGCATGCACCTGTAGG - Intergenic
1199835023 X:151581449-151581471 GCATGGTGGCATGCACCTGTAGG + Intronic
1202270222 Y:23065064-23065086 CCGTGGTGGCATGCACCTGCAGG - Intergenic
1202295805 Y:23355618-23355640 CCGTGGTGGCATGCACCTGCAGG + Intergenic
1202423216 Y:24698809-24698831 CCGTGGTGGCATGCACCTGCAGG - Intergenic
1202447573 Y:24971277-24971299 CCGTGGTGGCATGCACCTGCAGG + Intergenic