ID: 962116501

View in Genome Browser
Species Human (GRCh38)
Location 3:132514849-132514871
Sequence TGTCAAAAGTTGAAAGTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 299}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962116496_962116501 18 Left 962116496 3:132514808-132514830 CCTAATAATGTTTTACATACGTT 0: 1
1: 0
2: 0
3: 17
4: 223
Right 962116501 3:132514849-132514871 TGTCAAAAGTTGAAAGTTGGGGG 0: 1
1: 0
2: 1
3: 26
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962116501 Original CRISPR TGTCAAAAGTTGAAAGTTGG GGG Intronic
902157354 1:14499230-14499252 TGGGAAAAGTTGAGAGGTGGGGG - Intergenic
905720229 1:40193530-40193552 TGTGAAAAGTTAAAAATTTGAGG - Intronic
906817101 1:48890269-48890291 TGACACAAGTTGAAGCTTGGAGG - Intronic
908266830 1:62387477-62387499 TGTCAAAAGTTGTAAATGTGAGG - Intergenic
908753871 1:67449847-67449869 TTTTAAAAATTGAAAGTTGGTGG - Intergenic
909716680 1:78716588-78716610 TATCAAAAGTTAAAATTTGAAGG - Intergenic
910159252 1:84255986-84256008 TGCCAACATTTAAAAGTTGGGGG + Intergenic
910832099 1:91471281-91471303 TGTCACAAGTTCACAGCTGGAGG + Intergenic
910929403 1:92428014-92428036 TATCAAAAATTGAAAATAGGTGG + Intergenic
911868436 1:103059075-103059097 TGTTACAAATTGAAAGTTTGTGG - Intronic
914284693 1:146213495-146213517 AGTCAATAGTTGAATGTTGAAGG - Intronic
914389534 1:147207387-147207409 TTTCAAAAATAAAAAGTTGGAGG + Intronic
914545724 1:148664234-148664256 AGTCAATAGTTGAATGTTGAAGG - Intronic
914620841 1:149406432-149406454 AGTCAATAGTTGAATGTTGAAGG + Intergenic
916347134 1:163806212-163806234 GGTCAGAAGTTGGAAATTGGTGG - Intergenic
917273741 1:173306884-173306906 AGTCTAAAGGTGAGAGTTGGAGG - Intergenic
919415199 1:197299835-197299857 TTTCACAAATTGAAAGTTTGTGG + Intronic
920303254 1:205002497-205002519 TGTCAAAGGTAGAAAGTGTGGGG - Intronic
920696034 1:208181862-208181884 TTTCAAAATAAGAAAGTTGGAGG - Intronic
921988231 1:221335673-221335695 TGTCTAAACTGGAATGTTGGAGG - Intergenic
922083663 1:222324478-222324500 TGTCTTAAGCTGCAAGTTGGTGG - Intergenic
922823441 1:228501017-228501039 TGTTAAAAATTGAAGGTGGGTGG - Intergenic
923093679 1:230758191-230758213 TGGGCAAAGTTGAAACTTGGAGG + Intronic
923106360 1:230856941-230856963 TGTCAAAAGCTGAAAGAAGAGGG - Intronic
923285930 1:232495261-232495283 TTTTAAAAGATGAAAGGTGGGGG + Intronic
1063959472 10:11295046-11295068 TGTAAAATGTTGAAACTTGCAGG - Intronic
1065413225 10:25453868-25453890 AGTCAAAAGAACAAAGTTGGAGG - Intronic
1066142753 10:32524203-32524225 TGTCATTAGTTTAAAGTTGTGGG - Intronic
1067856896 10:49802239-49802261 AGCCAGAAGTTGGAAGTTGGTGG - Intergenic
1068601753 10:58964205-58964227 AGCAAAGAGTTGAAAGTTGGGGG - Intergenic
1068698719 10:59997403-59997425 TCTCAAAAGTAGAAAGTTTGGGG - Intergenic
1071369011 10:84932079-84932101 TGTTACAAGTTGAAGGTTTGTGG - Intergenic
1071828553 10:89349718-89349740 TGTTGAAAGCTGTAAGTTGGAGG - Intronic
1073686403 10:105759152-105759174 TGTCAAAACTTGAAGGGTGGAGG + Intergenic
1076076023 10:127534465-127534487 TGTCCACAGTGGAAACTTGGTGG + Intergenic
1076419281 10:130317950-130317972 TGTCTAATGTTGACAGTGGGGGG + Intergenic
1077944923 11:6886729-6886751 TGTCAAAAGTGGCCAGTGGGAGG + Intergenic
1077998354 11:7473407-7473429 GGTCATAAGTTGAAGGTAGGTGG - Intergenic
1078387673 11:10907263-10907285 TGTCAAAGGTTCAAAGTTGAAGG + Intergenic
1081338177 11:41894095-41894117 TGTTAAATGTTGATAGTTGTAGG + Intergenic
1085935306 11:81134604-81134626 TGTGATTTGTTGAAAGTTGGAGG + Intergenic
1086037536 11:82435167-82435189 TGCCAACAGTTTAAAGTTGGTGG + Intergenic
1086672890 11:89568867-89568889 TGTCAAAAGTTGTTTGTTGTAGG - Intergenic
1087133579 11:94692294-94692316 TGTCAAAAGGGGAAATGTGGAGG - Intergenic
1087409560 11:97774787-97774809 TGCCAAAAGCTGCAAGATGGAGG + Intergenic
1088662795 11:112065136-112065158 TCTCAAAATTAGAAATTTGGAGG - Intronic
1090064507 11:123491570-123491592 TGCCAGATGTTGAAAGATGGAGG + Intergenic
1090611009 11:128470767-128470789 TTGAAAAAGTAGAAAGTTGGAGG + Intronic
1091115256 11:133006575-133006597 TGTTGAAAGTTGAAAGTCGCTGG + Intronic
1091924561 12:4334442-4334464 TGTCAACATTTGAATTTTGGGGG + Intronic
1094052141 12:26231748-26231770 TCTCAATAATTGAAAGGTGGTGG + Exonic
1094280669 12:28733985-28734007 TTTTAAAAGTTAAAAGTTTGTGG + Intergenic
1096765389 12:53884196-53884218 TGTAAAAAGATAAAATTTGGAGG - Intergenic
1096849691 12:54427654-54427676 TGTCAATAGGCTAAAGTTGGGGG + Intergenic
1097752845 12:63377339-63377361 AGTTAGAAGTTGGAAGTTGGGGG - Intergenic
1097895552 12:64821777-64821799 TGTAAAAAGTTGATGGTTGATGG + Intronic
1099269266 12:80486874-80486896 TTTCAAAAGCTGAAAAGTGGGGG - Intronic
1099512714 12:83556691-83556713 TGTTAAAATTTAAAAATTGGGGG - Intergenic
1099592391 12:84611304-84611326 TTTCAAACATTGAAAGTTTGTGG + Intergenic
1099781902 12:87205911-87205933 TGTCCAATGTTGAAGGTAGGAGG - Intergenic
1100117516 12:91325445-91325467 TTTCACAAATTGAAAGTTTGTGG - Intergenic
1100405481 12:94268999-94269021 TGTCAAGAGTGGAACTTTGGAGG + Intronic
1100907556 12:99319252-99319274 TGTCTAATGTTGACAGTGGGGGG + Intronic
1101197417 12:102398672-102398694 GATAAAAAGTTGAAAGGTGGTGG + Intronic
1101311639 12:103586049-103586071 TTTCAAAAGTTGAAAGGAGTCGG + Intergenic
1101420164 12:104544347-104544369 TGTCAAAATTAAAAAATTGGTGG + Intronic
1101636701 12:106549486-106549508 TGTCTAATGTTGACAGTGGGAGG + Intronic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1105755360 13:23458768-23458790 TGTCAAGGTTTAAAAGTTGGAGG + Intergenic
1105828927 13:24146874-24146896 TGTAAAATGTTCAAAATTGGTGG - Intronic
1106686250 13:32063161-32063183 TGTCAAAAGATGGCAGTTGCTGG + Intronic
1109764080 13:66870361-66870383 TGTCAAAAGAACAAAGCTGGAGG - Intronic
1110091202 13:71450211-71450233 TTTAACAAGTTGAAAGTTTGTGG + Intronic
1110467593 13:75819629-75819651 TGACTAAAGTTGAATATTGGTGG - Intronic
1111012907 13:82335112-82335134 TGTGAAAAGTTGAAACTTGATGG - Intergenic
1111164860 13:84446241-84446263 TCTCACAAGTGGAAAGTTGAGGG + Intergenic
1111257725 13:85694460-85694482 TGTCTCACGTTGAAATTTGGAGG - Intergenic
1111327827 13:86722322-86722344 TGAAAAAAGATGAAAGCTGGAGG + Intergenic
1111669906 13:91317538-91317560 AGTCAAAAGTTGAGGGTTGCTGG - Intergenic
1111732206 13:92090300-92090322 TTTCAACAGTTGAATTTTGGGGG - Intronic
1112301243 13:98232481-98232503 TTTTACAAGTTGAAGGTTGGTGG + Intronic
1112650657 13:101393514-101393536 TGTGAAAAGCTGAAACTTAGTGG + Intronic
1112764932 13:102731323-102731345 TTTCAAAAGATAACAGTTGGAGG - Exonic
1112890902 13:104230093-104230115 TGTTAAAAGGTGGAAGTTGTTGG + Intergenic
1113173152 13:107529489-107529511 AGTCAAAAGCAGAAAGTTTGAGG - Intronic
1113376581 13:109769924-109769946 TGAGAAAGGTAGAAAGTTGGGGG - Intronic
1115661403 14:35498281-35498303 TTTCCAATGCTGAAAGTTGGGGG - Intergenic
1116079999 14:40159426-40159448 AATAAAAAGTTAAAAGTTGGGGG + Intergenic
1118193538 14:63603088-63603110 TGTTGAAAATTAAAAGTTGGAGG - Intronic
1121953616 14:98194533-98194555 TGGCAAAGGTTGAGAGATGGTGG + Intergenic
1124381526 15:29171578-29171600 TGTCAAAATTAGAAACTTGAAGG - Intronic
1125378957 15:39066315-39066337 TGTTAAAAGATCAAAATTGGGGG + Intergenic
1125858198 15:42971951-42971973 TGCCAAATGTTGATAGGTGGGGG - Intronic
1127104074 15:55594757-55594779 TATCAAAAGCTCAAAGTTGAGGG + Intergenic
1127703928 15:61528547-61528569 TATCAAACGTTTAAAGTTTGTGG - Intergenic
1128766927 15:70256923-70256945 TGTCAAAACTGGAAGGGTGGGGG - Intergenic
1129564397 15:76606595-76606617 TGTCTAATGTTGACAGTGGGGGG + Intronic
1130506234 15:84545173-84545195 TGGCAACAGTTGAATTTTGGAGG - Intergenic
1131372215 15:91892079-91892101 TGTCAAAAGGGCAAAGCTGGGGG - Intronic
1135782609 16:25317843-25317865 TGTCTGAAGTTGAGAGTTGGGGG + Intergenic
1135889604 16:26345346-26345368 TGTCAAAAGTTGTAAGCAGAGGG + Intergenic
1136620145 16:31423233-31423255 TGGATAAAGTTGGAAGTTGGTGG + Intronic
1137016202 16:35377956-35377978 TGTCAAAAGTTCTAAGGTGGAGG - Intergenic
1137034690 16:35559770-35559792 TGTCAAAATTTGAAATGGGGTGG + Intergenic
1137503150 16:49026707-49026729 TGTCATGTGTTGAAAGCTGGTGG - Intergenic
1137556047 16:49470997-49471019 TGCCAACATTTCAAAGTTGGAGG + Intergenic
1142837555 17:2599373-2599395 TGTTAAATGGTGAAAGTTGGTGG + Intronic
1144445626 17:15325187-15325209 TGGAAAAAGAAGAAAGTTGGAGG - Intronic
1146625138 17:34429645-34429667 TGTCAAAGGTTGAAATTTCAGGG + Intergenic
1147889342 17:43706062-43706084 TCTCAAAAGTTCAACTTTGGAGG - Intergenic
1147902256 17:43796068-43796090 TGTCTAATGTTGACAGTGGGGGG + Intergenic
1149929098 17:60732078-60732100 TGTTAATAGTTGAAAATAGGAGG - Intronic
1151161261 17:72167728-72167750 TATAAAAAGATGAAAGTTGCTGG + Intergenic
1151265512 17:72952283-72952305 TATCAATAATTGAGAGTTGGAGG - Intronic
1153906470 18:9665984-9666006 TGACACCAGTTGAAAGTTTGGGG - Intergenic
1156110612 18:33721801-33721823 TTTTATAAATTGAAAGTTGGAGG + Intronic
1156427074 18:37025285-37025307 TGTCTAATGTTGACAGTGGGGGG - Intronic
1156635299 18:39020661-39020683 TGTCTAAACTTGAAATTTGATGG - Intergenic
1158614463 18:58973511-58973533 TGCCAAATGTTAAAAGATGGCGG + Intronic
1158752888 18:60285891-60285913 TGTAAAGAGTTCAAAGCTGGAGG + Intergenic
1159142586 18:64415451-64415473 TGTCCATAGATGAAAGTTGGTGG + Intergenic
1161868398 19:6851931-6851953 TTTCAGAAGTTAAAAATTGGGGG - Intronic
1162867337 19:13558335-13558357 TGTCAAAAATGCAAACTTGGGGG - Intronic
1165154147 19:33777310-33777332 TGGGCAAAGGTGAAAGTTGGGGG + Intergenic
1166352165 19:42204448-42204470 TGTCACATGGTGAGAGTTGGGGG - Intronic
1166403434 19:42501491-42501513 TCTCAAAAAATAAAAGTTGGGGG + Intergenic
1166429300 19:42710670-42710692 TGTCAAATCCTGAAAGTAGGGGG + Intronic
924966430 2:80760-80782 TGTCAAGATTTGAAAGTAGGAGG - Intergenic
925521513 2:4751330-4751352 ACTCAAAAGTTGAAAGAAGGAGG + Intergenic
926866987 2:17371019-17371041 AGTCAAAAGAACAAAGTTGGAGG + Intergenic
927309534 2:21614593-21614615 TGACAAAAGTGGAATGTTGAAGG + Intergenic
927677717 2:25118631-25118653 TGTCAAAAACAGCAAGTTGGAGG + Intronic
928802374 2:35110431-35110453 TGTCTAATGTTGACAGTGGGGGG + Intergenic
930228226 2:48816435-48816457 TGTCAGAGGGTGAAAGTGGGAGG - Intergenic
930393410 2:50789430-50789452 TGTCAAAAGATGAAAGACGTAGG - Intronic
930504998 2:52272381-52272403 TTTCACAAGTTGAAGGTTTGTGG - Intergenic
930559205 2:52939069-52939091 TTTTACAAGTTGAAAGTTTGTGG + Intergenic
930750823 2:54932517-54932539 GGTCAAAAGTTGAGAGTAAGAGG - Intronic
931455232 2:62404857-62404879 TGACAATTGTTGAAACTTGGTGG + Intergenic
931613029 2:64124747-64124769 TGTCAGAATTGGAGAGTTGGTGG - Intronic
932097916 2:68868237-68868259 TGTGAAAAGGTGAAAATTGCAGG - Intronic
933180747 2:79223720-79223742 TGACATAAGCTGACAGTTGGTGG + Intronic
933491430 2:82989920-82989942 TTTAAAAAGATGATAGTTGGTGG - Intergenic
934894152 2:98098994-98099016 TATCAAAAATTCAAAATTGGGGG - Intronic
935581655 2:104760981-104761003 TGTCAAAAGGGGAATGTAGGCGG + Intergenic
937578982 2:123460508-123460530 TGTCAAAAGTATAAACTTGTTGG - Intergenic
938936806 2:136134493-136134515 AGTCAAAACTTCAAAGTTGAGGG + Intergenic
939207549 2:139127030-139127052 TGACAAAAGTTGAAGGTTTGTGG + Intergenic
939983088 2:148804137-148804159 TTGAAAAAGATGAAAGTTGGAGG - Intergenic
940289409 2:152063897-152063919 TGCCAAGATTTGAAAGTTGGGGG - Intronic
940890216 2:159028072-159028094 TGCCAACACATGAAAGTTGGGGG + Intronic
941488241 2:166109499-166109521 TTTCACAAATTGAAAGTTTGTGG + Intronic
942822403 2:180130164-180130186 TTTAAAAAATTGAAAGTTTGTGG - Intergenic
943193747 2:184716938-184716960 GGTCAAAAGAGGACAGTTGGAGG - Intronic
943436950 2:187876664-187876686 TGTCAAAAGCTGAAAGGTGGTGG + Intergenic
944315399 2:198280140-198280162 TGTCAAAAATTTAGAATTGGTGG + Intronic
944950931 2:204747630-204747652 TGCCAAAAGTACAAAGCTGGAGG + Intronic
945953186 2:216059844-216059866 TTGCAAAAGAAGAAAGTTGGAGG - Intronic
946716607 2:222559824-222559846 TGTGAAGAGATGAAAGGTGGAGG + Exonic
948348117 2:237316281-237316303 TGTCTAGATTTGAATGTTGGGGG - Intergenic
1169357893 20:4923396-4923418 TTTTAAAATTTGTAAGTTGGGGG - Intronic
1169861187 20:10154334-10154356 TGTCAAAAGATAAAAGTTTCAGG + Intergenic
1170509683 20:17063872-17063894 TTTCCCAAGTGGAAAGTTGGAGG - Intergenic
1171356358 20:24548410-24548432 TGTAAAAACTTGAAAGCTGTTGG + Intronic
1171432819 20:25095435-25095457 TATCCAATGTTGAAAGTGGGGGG - Intergenic
1171777082 20:29378836-29378858 TGTAAAAATTTGATAGTTTGAGG + Intergenic
1173269389 20:41518441-41518463 TGTTAAATGTTGAAAGGAGGGGG + Intronic
1174039354 20:47688078-47688100 TGGCAAAAGTTGGTAGATGGTGG - Intronic
1174771157 20:53301764-53301786 TTTAAAAACCTGAAAGTTGGGGG - Intronic
1174808337 20:53624315-53624337 TGTAAAATGTTAAAACTTGGAGG + Intergenic
1174882833 20:54299518-54299540 TTTCAAAAGTTAAATGTAGGAGG - Intergenic
1175250310 20:57605280-57605302 TTTCACAAGTTGAAGGTTTGTGG + Intronic
1177093637 21:16802253-16802275 TGTCAAAAGCTGAGAGTCGTCGG - Intergenic
1177232721 21:18343155-18343177 TGTGAAAAGCTGAAAATTGTAGG + Intronic
1177417124 21:20808435-20808457 GGTCAAAAGTTGTAACTTGTAGG - Intergenic
1177512140 21:22101739-22101761 TTTCACAAGTTGAAAGTTTATGG - Intergenic
1178177104 21:30115192-30115214 TTTTAAAAATTGAAAGTTTGTGG - Intergenic
1178578220 21:33814231-33814253 TGTGAATAGTTGGGAGTTGGGGG + Intronic
1181375619 22:22455595-22455617 GGTCAAAAGAAGAAAATTGGGGG + Intergenic
1181840440 22:25654348-25654370 TGTAAAAATTTGAAAATTGGAGG + Intronic
1184904460 22:47471353-47471375 TGACAACAGTTGAATTTTGGAGG + Intronic
949128473 3:473503-473525 TGTCAAAACTGCAAAGCTGGAGG + Intergenic
949422678 3:3882794-3882816 TGTCAAAAGATGAAAGATGATGG + Intronic
949735826 3:7170544-7170566 TGTCATATGGTGAAATTTGGTGG + Intronic
950381001 3:12614788-12614810 TCTGAAAAGCTGGAAGTTGGTGG - Intronic
950817820 3:15725524-15725546 TCTTAAAAATTGAAAGTTTGTGG + Intronic
951111374 3:18808400-18808422 TGTCTAAAGTTGCAATTTGGTGG - Intergenic
952324730 3:32310781-32310803 TGTGAATTGTAGAAAGTTGGAGG + Intronic
953483947 3:43276732-43276754 TTTCATAAGTTGAAGGTTTGTGG + Intergenic
953646603 3:44761431-44761453 AGGCAAAAGTTGAAAGTGGCGGG + Intronic
953835144 3:46336325-46336347 TTTGAAAAGAAGAAAGTTGGAGG + Intergenic
954125985 3:48529409-48529431 TTTCAAAACTTGAAAGATGAAGG + Intronic
954166606 3:48764364-48764386 TGTCAAATATAGAAAGTTAGAGG + Intronic
955307372 3:57847769-57847791 TGTCAAAAGATGTATTTTGGGGG - Intronic
955482399 3:59402748-59402770 TCTCAAAAGCTGGTAGTTGGAGG - Intergenic
955658952 3:61276288-61276310 TGGGAAGATTTGAAAGTTGGAGG + Intergenic
956639815 3:71405062-71405084 TGTGGAAATTTGGAAGTTGGTGG - Intronic
956764016 3:72468719-72468741 TGTTAAAAGCAGAAAGCTGGGGG + Intergenic
958951922 3:100426084-100426106 TGTCAAAAGCTGCAAGCTAGGGG - Intronic
959768318 3:110060925-110060947 TCTCAACACTTGAAACTTGGAGG + Intergenic
959870071 3:111316389-111316411 TGTCAAGAGTTGAAGGTTTCTGG + Intronic
960627218 3:119692808-119692830 TTTCAAAAGATGAAAATTTGTGG - Intergenic
962116501 3:132514849-132514871 TGTCAAAAGTTGAAAGTTGGGGG + Intronic
962434437 3:135351709-135351731 TGTCTTAAGTTGAAAGTTTTAGG - Intergenic
962556721 3:136560249-136560271 TGATCAAACTTGAAAGTTGGTGG - Intronic
963096094 3:141542504-141542526 TTTCAAAATTTTAAAGTTGGGGG - Intronic
963263011 3:143211585-143211607 TGTCCAAATTTCAATGTTGGAGG - Intergenic
963750188 3:149169860-149169882 TGTCAAAGGTTGAAAATTTCTGG - Intronic
963928900 3:150981357-150981379 TGGCAAGGGCTGAAAGTTGGGGG + Intergenic
964842885 3:161013603-161013625 TGTCTAATGTTGACAGTGGGGGG + Intronic
964846033 3:161045184-161045206 TGTCTAATGTTGACAGTGGGGGG - Intronic
966022976 3:175238915-175238937 TGTCAAAAGCAAAAAGTTGTGGG - Intronic
966039714 3:175467084-175467106 TGTCAAAAGTTAAGAGAGGGTGG + Exonic
966403046 3:179566033-179566055 TGGCAGAACTTGAAAGATGGAGG + Intronic
966903410 3:184503990-184504012 TGGCAAAAGCTGAATTTTGGAGG + Intronic
967738130 3:192975477-192975499 TGTCCAACGCTGAAAGTGGGAGG - Intergenic
968178286 3:196569542-196569564 TGTCAAAAGTTGAATGAGTGAGG - Intronic
970332017 4:14996233-14996255 TTTCACAAATTGAAGGTTGGTGG + Intergenic
971690543 4:29828881-29828903 AGTGAAAAGTTAAAAGGTGGGGG + Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
972481075 4:39496791-39496813 TGTGAAAAGTTGAAAGAAGGTGG - Intergenic
972568733 4:40291887-40291909 TGCCAAAAGTCAAAAGATGGAGG + Intergenic
972949890 4:44306572-44306594 TTTCACAAATTGAAATTTGGAGG + Intronic
975852392 4:78585570-78585592 TGTACCAAGTTAAAAGTTGGGGG + Intronic
976373663 4:84319546-84319568 TGTCAGAAGTTACAGGTTGGTGG + Intergenic
976450802 4:85188805-85188827 TATCCAATGCTGAAAGTTGGGGG + Intergenic
977245687 4:94628643-94628665 TATAAATAGTTGAAAATTGGTGG + Intronic
977356072 4:95948527-95948549 TGTTACAAATTGAAAGTTTGTGG - Intergenic
978518096 4:109590912-109590934 TGTCAGAAGTTAAAAATTGTTGG + Intronic
979317069 4:119277679-119277701 TGTCTAATGTTGACAGTGGGGGG + Intronic
979811550 4:125042404-125042426 TGTCGCAAATTGAAAGTTTGTGG + Intergenic
979853025 4:125596731-125596753 TTTAAAAAGATTAAAGTTGGAGG + Intergenic
980304084 4:131034034-131034056 TTTCAAATGTTGAAAGTTGATGG - Intergenic
980548768 4:134305284-134305306 TGCAAAAAGTACAAAGTTGGAGG + Intergenic
980639928 4:135564724-135564746 TGTCAATAGTTTAAAGCTGGAGG - Intergenic
980709872 4:136551038-136551060 TGTGAAAGGTTGAAAATTGAGGG - Intergenic
981199918 4:141968258-141968280 TGTCTAAATTTGACAGTGGGGGG - Intergenic
981506257 4:145503548-145503570 AGACAAATGTTGAAAGTTGAGGG + Intronic
982161862 4:152578420-152578442 TGTTGAAAGTTAACAGTTGGTGG - Intergenic
982285802 4:153732965-153732987 TGTCAAAAGTGGAAAGAAGGTGG - Intronic
983073775 4:163300219-163300241 TTTTACAAGTTGAAAGTTTGTGG - Intergenic
983464754 4:168073541-168073563 TTTCACAAGTTGAAGGTTTGTGG - Intergenic
983756180 4:171339884-171339906 GGGCAGAAGTTGAAAGTTGTAGG - Intergenic
987883383 5:23779612-23779634 TGTTAAATGTTGAAAGTGGTTGG + Intergenic
988291217 5:29289555-29289577 TTTTAAAAGTTGAAAGCTTGAGG - Intergenic
988450068 5:31332907-31332929 TGTCAGGGGTTGAAACTTGGAGG + Intergenic
988889120 5:35595473-35595495 TTTCACAAGTTGAAGGTTTGTGG - Intergenic
990735208 5:58852992-58853014 AGTCAAAAGTTGGAAATTAGGGG + Exonic
991296867 5:65090949-65090971 AGTCTAAACTTGAAACTTGGGGG - Intergenic
991647976 5:68820157-68820179 TATCAAAAGTTCAATGTTTGAGG + Intergenic
992288577 5:75261420-75261442 TGTAAAAGGTTGACAGTTGGAGG - Intergenic
995068409 5:107889347-107889369 TGTGAAAATTTTAAAGATGGTGG + Intronic
995988182 5:118206283-118206305 TGTGAAAAGATGGAAGTGGGAGG - Intergenic
997217081 5:132121389-132121411 AGTAAAAAGTACAAAGTTGGGGG + Intergenic
998195206 5:140063109-140063131 TGGAAAATGTTGAGAGTTGGTGG - Intergenic
998737968 5:145164670-145164692 TGTCTAATGCTGAAAGTGGGAGG + Intergenic
1000151738 5:158509039-158509061 TGTGAAAACTTGGAATTTGGAGG + Intergenic
1004323987 6:14656864-14656886 TATTTAAAGTTGAAAGTTTGGGG - Intergenic
1005211713 6:23473249-23473271 TCTCCAAATTTGAAAGTTTGGGG - Intergenic
1005790277 6:29293047-29293069 TCTCAGAGGTTGAATGTTGGGGG + Intergenic
1009836519 6:69008130-69008152 TGTCAACAGCTGAATTTTGGAGG + Intronic
1009881116 6:69567412-69567434 TGTCAAAACCTGAAAGTTCTGGG + Intergenic
1010109464 6:72208667-72208689 AGTCAGAAGTTAAAAATTGGAGG + Intronic
1010264104 6:73848627-73848649 TGTCTAATGCTGAAAGTTGGGGG + Intergenic
1011774435 6:90713010-90713032 TGTAAAAATTTAAAAGTTGAAGG + Intergenic
1014887488 6:126799248-126799270 TGGCAAAAGTTAAAAGCAGGTGG + Intergenic
1015078097 6:129187811-129187833 TTTCAAAATTTGAAACTTTGGGG - Intronic
1016002368 6:139055171-139055193 TGCCAAAAGTGAAAAGTTTGGGG + Intergenic
1018691749 6:166351165-166351187 TTTTACAAGTTGAAAGTTTGTGG - Intergenic
1022554021 7:31273415-31273437 TGTGATAAGTTGAACCTTGGTGG + Intergenic
1022917605 7:34974747-34974769 TGTCACAAATTGAAGGTTTGTGG + Intronic
1026923950 7:74175903-74175925 TGTCAAATTTTGACATTTGGGGG + Intronic
1030218165 7:107067984-107068006 GGACAAAAGTTGAAGGTTGCAGG + Intronic
1031275880 7:119722993-119723015 AATCAAACATTGAAAGTTGGAGG + Intergenic
1031498717 7:122484817-122484839 TTTCATAAATTGAAAGTTCGTGG + Intronic
1036059872 8:5304437-5304459 TGACAAAAGTTGAATATTGGTGG - Intergenic
1036124097 8:6047263-6047285 TTTCAACAGATGAAATTTGGGGG + Intergenic
1036196989 8:6727356-6727378 TGTCAAAAGTAGATAGTTGAAGG - Intronic
1036925553 8:12901761-12901783 TGGCAAATGTTGGAAGTTGCTGG + Intergenic
1037298305 8:17424598-17424620 TGTCAAAATTAAAAAGATGGTGG - Intergenic
1037850588 8:22324352-22324374 TTTCAAAAGTGGAAAGGTGGGGG - Intronic
1038270779 8:26073747-26073769 TGTCAGAAATTGTGAGTTGGAGG - Intergenic
1038435855 8:27535569-27535591 TTCCAGAAGTTGAAAGATGGTGG - Intronic
1040376888 8:46834542-46834564 TGCCAAAAGTACAAAGCTGGAGG + Intergenic
1040710856 8:50187219-50187241 TGTCAAAAGAACAAAGCTGGAGG + Intronic
1042659770 8:71141555-71141577 TGTCAAAAAATGAAAATTGAAGG - Intergenic
1042678666 8:71353485-71353507 TATCAAAAATTGAAATTTTGCGG - Intronic
1044731976 8:95236255-95236277 TGTTGTAAGATGAAAGTTGGTGG + Intergenic
1045184345 8:99821378-99821400 TCTCCAAAGTGGAAAGATGGAGG + Exonic
1045722601 8:105131315-105131337 TGACAAAAGCAGGAAGTTGGAGG - Intronic
1048308894 8:133303149-133303171 AGTCAAAAGTTGAGAGATGTAGG - Intergenic
1048847978 8:138617475-138617497 TGTCCAGAGTTGCAACTTGGAGG + Intronic
1050049716 9:1586997-1587019 TGTCTAATGTTGACAGTGGGGGG + Intergenic
1050993394 9:12181748-12181770 TGGCAGAAGTTGAAAGTGGAAGG + Intergenic
1051647692 9:19285992-19286014 TGGAAAAAGAAGAAAGTTGGAGG - Intronic
1054749740 9:68893193-68893215 TCTCAAATGTTGAGAATTGGGGG + Intronic
1055555011 9:77464996-77465018 TGCCAGAAGTTGAAAGAGGGAGG + Intronic
1055872453 9:80899402-80899424 TATCAAAAATTGAAAATGGGAGG - Intergenic
1057876793 9:98762451-98762473 GGTACAAAGTTGACAGTTGGAGG + Intronic
1058571215 9:106347006-106347028 TCTCAAAAGAAAAAAGTTGGTGG + Intergenic
1058641735 9:107093792-107093814 TTTAACAAGTTGAAAGTTTGTGG - Intergenic
1059475968 9:114547976-114547998 TGTCAAAACTTGAATCTGGGTGG + Intergenic
1061024620 9:128040315-128040337 TGTCTAAAAAAGAAAGTTGGGGG - Intergenic
1186545663 X:10446569-10446591 GATCCAAAGTTGAAAGTTGCTGG - Exonic
1187848080 X:23562090-23562112 AGTCAAAAGAAGAAAGCTGGAGG - Intergenic
1188059578 X:25584662-25584684 CGTAAAATGTTCAAAGTTGGAGG + Intergenic
1191118231 X:56873677-56873699 AGGCAAAAGAAGAAAGTTGGAGG + Intergenic
1191136109 X:57067214-57067236 TTTCAAGAGTTGAAAGAAGGTGG - Intergenic
1193420641 X:81278986-81279008 TGTTTAAAGTTGATAGTTTGGGG - Intronic
1193571786 X:83152731-83152753 TTTCAAAATTTCAAAATTGGAGG + Intergenic
1194988589 X:100520046-100520068 TTTCAAAAGATGACATTTGGTGG + Intergenic
1195697156 X:107675641-107675663 TGTCAGAAGTTGCAAACTGGTGG + Intergenic
1196106943 X:111906542-111906564 TTTCCAAAGCTGGAAGTTGGGGG - Intronic
1196277880 X:113789978-113790000 TCTCAGAAGTTGGAAATTGGAGG - Intergenic
1197173958 X:123465036-123465058 TGTGATACGATGAAAGTTGGTGG + Exonic
1197251622 X:124222514-124222536 TTTCAAAAGAACAAAGTTGGAGG - Intronic
1197480577 X:126980181-126980203 TGGCAAAGGTTGAAAGTGAGAGG - Intergenic
1197584343 X:128326787-128326809 TTTCAAAAGTAGATTGTTGGGGG + Intergenic
1197641587 X:128974035-128974057 TGTGAAAAGTTGCAAATTTGGGG - Intergenic
1197858040 X:130939022-130939044 TATCAAAAGTTTAAAGTTTTTGG - Intergenic
1198279428 X:135127026-135127048 TTTCAAAATTTAAAAGTTGAAGG + Intergenic
1198291528 X:135245488-135245510 TTTCAAAATTTAAAAGTTGAAGG - Intergenic
1199946482 X:152672716-152672738 TGTCAAGGGCTGGAAGTTGGTGG + Intergenic
1200429903 Y:3067241-3067263 TTTCAAATGGTGAAGGTTGGGGG - Intergenic
1202111767 Y:21428128-21428150 AGTAAAAAGTTCAAAGCTGGAGG + Intergenic
1202363741 Y:24139441-24139463 TGGCAACAGTTGAATTTTGGAGG + Intergenic
1202507039 Y:25530676-25530698 TGGCAACAGTTGAATTTTGGAGG - Intergenic