ID: 962118275

View in Genome Browser
Species Human (GRCh38)
Location 3:132534934-132534956
Sequence ATTCCTGGAGTTCCACATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962118275_962118277 -1 Left 962118275 3:132534934-132534956 CCATGATGTGGAACTCCAGGAAT 0: 1
1: 0
2: 0
3: 24
4: 146
Right 962118277 3:132534956-132534978 TTTATAGTGTTGTGTTGAATTGG 0: 1
1: 0
2: 2
3: 26
4: 409

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962118275 Original CRISPR ATTCCTGGAGTTCCACATCA TGG (reversed) Intronic
901265830 1:7910076-7910098 ATTGCTGGAGTTCAAAATGAAGG + Intergenic
901917204 1:12508838-12508860 ATTCCTGGATTTCCCCATCCTGG + Intronic
902917398 1:19646858-19646880 CTTGCTGGAGTTTCACCTCAAGG + Intronic
903134710 1:21302026-21302048 TTTCCTGCAGCTCCACATCAGGG - Intronic
903287731 1:22287105-22287127 TTTCCTGGGGTTCCTCATAATGG - Intergenic
903684796 1:25122977-25122999 ATCCCTGGAGTTCTGTATCAAGG - Intergenic
904076638 1:27847843-27847865 AATCCTGGAGTACCACAGAAAGG + Intronic
905123627 1:35701982-35702004 ATTCCTCAGGTTCCACATCATGG + Intergenic
907225877 1:52945878-52945900 ATTCCTGCAATTCCACTTCTAGG - Intronic
912930746 1:113958180-113958202 GTTCCTGGAGTTGCCCAGCAGGG + Exonic
912975422 1:114324865-114324887 TGTACTGGAGTTCCAAATCAGGG - Intergenic
921323095 1:213962447-213962469 ATGGCTGGAGATCCATATCATGG + Intergenic
1064258848 10:13768418-13768440 ATTCCTGCAGTTCCGGACCATGG - Intronic
1064722134 10:18239886-18239908 AGTCCTGGAATTACATATCAAGG + Intronic
1069690421 10:70348191-70348213 AATCCAGGAGTTCCACAGAAGGG + Intronic
1069985500 10:72280278-72280300 ATTCCTTTAATTCCACCTCATGG + Intergenic
1073157429 10:101358790-101358812 ATTCTTGGACTTCCAAATCTAGG - Intronic
1073502207 10:103950690-103950712 ATTCCTCTAGTACCACATCCTGG - Intergenic
1073764001 10:106662203-106662225 ATGCCAGGATTTCCCCATCATGG + Intronic
1074326781 10:112458185-112458207 AGTCCTGGAGGTCCACGGCATGG + Intronic
1075768263 10:124912163-124912185 AATCCTGGAGATCAACATCAGGG - Intergenic
1078886184 11:15502386-15502408 CTCCCTGGAGTTCCACATCTAGG - Intergenic
1085451197 11:76634980-76635002 ATTCCAGGAGCTCCACTTCCAGG - Intergenic
1086139344 11:83477541-83477563 TATCCTGGAGTTACACATCGTGG - Intronic
1087903229 11:103666164-103666186 ATTCCTGGAGTGTCACAACTTGG + Intergenic
1089067139 11:115670530-115670552 GTTCCCTGAGTTCCACATCAGGG + Intergenic
1091236584 11:134026228-134026250 AGTCCTAGAGGTCCACAGCAAGG + Intergenic
1096097308 12:48944397-48944419 TTTCCTGGCATGCCACATCAAGG + Intronic
1097239317 12:57564191-57564213 GAACCTTGAGTTCCACATCAAGG + Exonic
1098718529 12:73864017-73864039 AGTCCTGGGGATCCAAATCAGGG - Intergenic
1101210304 12:102528912-102528934 GATCCTGGAGATCCACATCCTGG + Intergenic
1107028090 13:35824083-35824105 ACCCCTGGAGTTCCACCACAGGG + Intronic
1108476915 13:50829287-50829309 TTTCCTCAAGATCCACATCAAGG + Intronic
1110385410 13:74905123-74905145 ATTCCAGCAGTTCCACTTCTAGG + Intergenic
1111585452 13:90277987-90278009 ACACCTGTAGTTCCAAATCATGG - Intergenic
1112211849 13:97385714-97385736 ATTCCTGGAGATCAACCTCAAGG + Intronic
1113357205 13:109592221-109592243 ATTTCTGAAGTTCAACTTCAGGG - Intergenic
1121758599 14:96423938-96423960 TTTCCTGGTGGTCCACATGAAGG - Intronic
1126937303 15:53725315-53725337 ATTCCTGTTGCTCCACATCCCGG - Intronic
1129777121 15:78244084-78244106 CTTCCTGGACTTCCAGAACAAGG + Intronic
1132588703 16:717099-717121 ACTCCTGCAGCTCCACGTCATGG - Exonic
1135193441 16:20374449-20374471 ATGCCTGGTGTTGCACATAAAGG + Intronic
1140694170 16:77515504-77515526 ATTCCTGAAGTTTCAGATCTGGG - Intergenic
1141996615 16:87640040-87640062 CTTCCTGGAGTTCCAGCTGAGGG + Intronic
1143986043 17:10915284-10915306 ACACCTGGAGTTCCATACCATGG - Intergenic
1145263551 17:21368691-21368713 ATCCTAGGAGTTCCACATCTAGG - Intergenic
1145268872 17:21393623-21393645 AGTCCTGGGGCTCCACCTCATGG + Intronic
1146587808 17:34097719-34097741 TATCCATGAGTTCCACATCATGG - Intronic
1150049984 17:61952578-61952600 ATTCATGCATTTCTACATCATGG - Intronic
1153776567 18:8459277-8459299 ATTCCCGAAGTCCCACATCAAGG - Intergenic
1155007523 18:21741579-21741601 ATTCCGGGAGTTACTCATCGGGG - Exonic
1156359556 18:36372347-36372369 ATTCCAGGAATTTCACTTCATGG + Intronic
1157427679 18:47598013-47598035 ATTCCTGGATTCCCTCATGAAGG - Intergenic
1158396302 18:57080880-57080902 ATTCCTGGGGCTCCTCAGCAAGG - Intergenic
1158489230 18:57894974-57894996 AGGCCAGAAGTTCCACATCAAGG - Intergenic
1158909575 18:62046811-62046833 TATCCTTGGGTTCCACATCATGG - Intronic
1159056063 18:63465239-63465261 CTTCCTGGAGTCCCTCATCATGG - Intergenic
1160298800 18:77660213-77660235 ATTCCTGGAGTTGGAGAGCAAGG - Intergenic
1163784985 19:19270347-19270369 CTTCATGGAGTTCTACACCAAGG - Exonic
1165618759 19:37226382-37226404 ACTCCTGGTGTTACACATCCAGG + Intronic
1166076371 19:40415929-40415951 TTTTCTGGACTTCCCCATCAAGG - Intergenic
1166315933 19:41989680-41989702 AGACCTGGAGATACACATCAAGG - Intronic
931487750 2:62709936-62709958 ATTCCTTGATTGCCACATGAAGG + Intronic
932918356 2:75881237-75881259 ATTCCTGGGGTTACACATTAAGG + Intergenic
933639301 2:84741909-84741931 ATCCCTGGAGCTCCAAAACAGGG - Intronic
936522235 2:113218578-113218600 ATTATTACAGTTCCACATCAAGG - Exonic
939959766 2:148556189-148556211 ATTCCTTTAGTTCTTCATCAGGG - Intergenic
941020733 2:160406144-160406166 TTCCATGGACTTCCACATCAAGG + Intronic
941058371 2:160814777-160814799 GTTCCTGGAGTTCTACATGCAGG - Intergenic
941081503 2:161066256-161066278 CTTCCTGGAGGTCAACAACAAGG - Intergenic
941495390 2:166194975-166194997 ATTTCTTGAAATCCACATCAAGG - Intergenic
942823521 2:180145241-180145263 CATCCTGGAGTTTCACATCATGG - Intergenic
944437983 2:199711805-199711827 ATTCCTGGGTTTCCACATCCTGG + Intergenic
944821806 2:203440059-203440081 CTTCCTGGAGTTCTCCAACAAGG - Exonic
945362241 2:208906338-208906360 AAACCTGGAGGTCCAGATCATGG + Intergenic
945896711 2:215491186-215491208 ATTCGTGTTGTTCCACATCCTGG + Intergenic
945897028 2:215495023-215495045 ATTCCTGTTGTTCCACATCCTGG - Intergenic
947822943 2:233084738-233084760 CTTCCTGAAGTTGCACAACAAGG + Intronic
947848973 2:233268931-233268953 ATTGCTAGAGTTCTACATTAGGG + Intronic
1169904008 20:10582009-10582031 CTTCCTGGAGATCCACCCCACGG - Intronic
1172999419 20:39094833-39094855 ATTTCTGGAGTCCAAAATCAAGG + Intergenic
1173146777 20:40531651-40531673 ATTCATGGAGTTCCCAATTATGG + Intergenic
1174006956 20:47418598-47418620 TTTCCTGGATTTTCACATCAAGG - Intergenic
1174104487 20:48152724-48152746 AGTTCTGGAGTCCCAGATCAAGG - Intergenic
1175169634 20:57070922-57070944 AATCCTGGGGTTCCATATTACGG + Intergenic
1175659272 20:60798172-60798194 ATCCCTTGATTTCCACATCCTGG - Intergenic
1177514717 21:22134583-22134605 ATTCCTGGTGCCCCACCTCAAGG + Intergenic
1178136167 21:29629959-29629981 ATCCTTGCAGTTCCACCTCATGG - Intronic
1178291442 21:31372111-31372133 TTTCCTCTAGTTCCACCTCATGG + Intronic
1178889861 21:36512024-36512046 CTTCCTGGAGATCCATTTCAAGG - Intronic
1179517542 21:41918942-41918964 ATAGCTGGAGTTCCACATGAAGG - Exonic
1182862430 22:33571580-33571602 ACTCCTGGAAATCCACATCTTGG - Intronic
1183140818 22:35937181-35937203 ATACCTGGAGATCCACCCCACGG - Intronic
1183828260 22:40405024-40405046 ATTCCTTGTGTTCCTGATCAAGG - Intronic
1184180678 22:42822566-42822588 ATTCCAGGAGTCCCTCAGCATGG + Intronic
950211370 3:11126086-11126108 ACTCCTGGAGTTGGACAACAGGG - Intergenic
951401812 3:22241815-22241837 ATTCCTGGAATTTCAAATGATGG - Intronic
955512838 3:59698552-59698574 ATTCCTGGAGCCACACATCCAGG - Intergenic
956240794 3:67128041-67128063 ATTCCTGGATTTGGACAACAAGG + Intergenic
957305503 3:78453419-78453441 ATTCTTGGAGTCCCAAATCATGG - Intergenic
957774490 3:84738357-84738379 GTTCCTGGAGTTTCACATTCAGG - Intergenic
959912242 3:111776639-111776661 ATTCTTGGAGTTCTACATCTAGG - Intronic
962118275 3:132534934-132534956 ATTCCTGGAGTTCCACATCATGG - Intronic
962214898 3:133512819-133512841 ATTCCTGGACCTCTACATCCTGG - Intergenic
962500075 3:135982363-135982385 ATTCCTGCAGTCCCACATGTAGG + Intronic
962898928 3:139740220-139740242 ATTCCAGGACTCCCACATGATGG + Intergenic
963749606 3:149162767-149162789 GTTCCTGAAGTACCACATCTGGG - Exonic
964168908 3:153743586-153743608 TATGCTGAAGTTCCACATCAAGG - Intergenic
965619798 3:170631758-170631780 ATTTCTGAAGTTCCATATTAAGG - Intronic
971613904 4:28762848-28762870 ATGCCTTGATTTTCACATCAGGG + Intergenic
971804175 4:31333992-31334014 TTTCTTGGAGTACCAAATCATGG - Intergenic
976365382 4:84227784-84227806 ATTCCAGGAGCTCCATTTCATGG + Intergenic
979165489 4:117524606-117524628 ATTTCTGGAGTACCACATTAAGG - Intergenic
979628473 4:122873182-122873204 ACTCCTGGCTTTCCACATCTTGG + Intronic
980341911 4:131561403-131561425 AGTCCAGGAGTTCCAGACCAGGG - Intergenic
980515351 4:133850848-133850870 ATTACTGGAATTCCAGAGCAAGG + Intergenic
982816437 4:159891333-159891355 ATTCCTGTTGCTCCACATAAAGG + Intergenic
987181025 5:15368550-15368572 ATGCCCTGAGTTCCACAGCAGGG + Intergenic
987811638 5:22844214-22844236 CTTCATGGAGTTACACATTAAGG + Intronic
994013707 5:94939741-94939763 ATACTTGGAATTCCACATTACGG - Intronic
994522482 5:100858082-100858104 CTTCCTTGAGTTCCACAAGAAGG - Intronic
996594227 5:125183364-125183386 ATTCCTGGAATTTCTCAACAAGG - Intergenic
996776923 5:127142801-127142823 CCTCCTGGATTTCCACAGCATGG + Intergenic
998344124 5:141446307-141446329 ATTCCTGGGTTTCCACATTAAGG + Intronic
1002333846 5:178464608-178464630 TTTCCTGCACTTCCACGTCAGGG - Intronic
1004576057 6:16896336-16896358 ATTCATGGAGCTCAACATCTGGG - Intergenic
1005003694 6:21267394-21267416 ATTCCTGGAGGTTTAAATCATGG - Intergenic
1006815171 6:36845216-36845238 ATTCATGGAGTTTCTTATCAAGG - Intergenic
1010489372 6:76455377-76455399 ATGCCTGGAGATACAAATCAAGG + Intergenic
1013321817 6:108999634-108999656 ATTCCTGTTGTCCCACATCTTGG - Intronic
1013448642 6:110256913-110256935 ATTCCTGGTGTTCCACAAGAAGG - Intronic
1017698690 6:157045961-157045983 ATTCCTGGATTCCCACATCCGGG - Intronic
1018464356 6:164029634-164029656 ATTTCAGGATGTCCACATCAGGG + Intergenic
1018553278 6:165023457-165023479 ATTCTTGTTGTTCCACATCCTGG - Intergenic
1019179894 6:170179972-170179994 ACTCCAGGAGTTCCACGCCAGGG + Intergenic
1020054646 7:5109011-5109033 AGCCCTTGAGTTCCTCATCAAGG + Intergenic
1023779554 7:43643247-43643269 GTTCCTGGAGCACCAGATCATGG + Intronic
1024589701 7:50870738-50870760 ATTCCTGGAGTCACACATCCTGG + Intergenic
1025771203 7:64509206-64509228 AATCCTGCAGTGCCACATAATGG + Intergenic
1026539969 7:71271331-71271353 TTTCCTTGCTTTCCACATCAGGG + Intronic
1027462682 7:78474959-78474981 AACCCTGGAAGTCCACATCATGG + Intronic
1027850966 7:83451424-83451446 AATCTTGGAGTTTTACATCAAGG + Intronic
1028162660 7:87503627-87503649 ATTCTTGCATTTCCACATTAAGG - Exonic
1028310994 7:89335645-89335667 ATTCCCGGAGTTACACTTCATGG - Exonic
1030550017 7:110946521-110946543 ATTTCTAGAGTTCTACTTCAGGG + Intronic
1030724337 7:112907962-112907984 ATTCCTGCAATTCCACACCTAGG + Intronic
1033783749 7:144704496-144704518 GTTCCTGGGTTTCCAAATCATGG - Intronic
1038526871 8:28282064-28282086 AGTCTTTGAGTTCCACATCTTGG + Intergenic
1044256410 8:90068463-90068485 AAGCCTGGATTTGCACATCAAGG + Intronic
1046082198 8:109384109-109384131 AGACCTGGAGTTCCAGATAAAGG - Exonic
1046976026 8:120278808-120278830 ATTGCTAGAGTTCCATATAAAGG - Intronic
1048623745 8:136162132-136162154 CTTCCTCGAACTCCACATCATGG - Intergenic
1049297175 8:141848204-141848226 TTTCCGTGGGTTCCACATCATGG - Intergenic
1050054617 9:1638924-1638946 AATCCTTGATTTCCAAATCATGG - Intergenic
1050547113 9:6718396-6718418 ATCCCAGGAGTTCGAGATCAGGG + Intergenic
1051097716 9:13485456-13485478 ATTCCTGGAGCTCTACCTAAAGG + Intergenic
1051268462 9:15331699-15331721 TTTCCTGCAATTCCACATCTGGG + Intergenic
1051573022 9:18582418-18582440 ATTGCAGGAGTTCCAGTTCAAGG - Intronic
1051836932 9:21349485-21349507 GTTCCTGGAGTTTCAGGTCACGG + Intergenic
1053030804 9:34776310-34776332 ATTACTGGGGTTCCAGAGCAAGG - Intergenic
1055162317 9:73145360-73145382 GTTCTTGGAGGTGCACATCAAGG + Intergenic
1059985885 9:119820209-119820231 ATAGCTGGAGTTGCACAACATGG - Intergenic
1060381407 9:123177162-123177184 ACTCCTTGAGTTCCACCACATGG + Intronic
1186178864 X:6953615-6953637 ATTCCTGGAGTTCTACTGCACGG + Intergenic
1191224681 X:58030950-58030972 CTTCTTGGAGCTCCACCTCAGGG + Intergenic
1191769313 X:64738658-64738680 ATTCCTGGAGATGCAAATCTTGG + Intergenic
1192691311 X:73367439-73367461 AAACCTGAAGTTCCAGATCACGG - Intergenic
1192762102 X:74104579-74104601 ATTCCTGGAGATCTGCCTCAGGG - Intergenic
1193140235 X:78019258-78019280 AGTCCAGGTTTTCCACATCAGGG + Intronic
1199726218 X:150584994-150585016 CATCCAGGAGTTCCACATCTAGG - Intronic
1201495021 Y:14583568-14583590 ATTTCTGGAATTCTTCATCATGG + Intronic