ID: 962122234

View in Genome Browser
Species Human (GRCh38)
Location 3:132574074-132574096
Sequence CATTAACTTTAAAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 1, 2: 1, 3: 18, 4: 254}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962122231_962122234 -2 Left 962122231 3:132574053-132574075 CCAGGCTTGCTCTGCATGACACA 0: 1
1: 0
2: 1
3: 22
4: 157
Right 962122234 3:132574074-132574096 CATTAACTTTAAAAGGTGGAAGG 0: 1
1: 1
2: 1
3: 18
4: 254
962122229_962122234 28 Left 962122229 3:132574023-132574045 CCAGTGAAAACAGGCATATTTGT 0: 1
1: 0
2: 1
3: 20
4: 219
Right 962122234 3:132574074-132574096 CATTAACTTTAAAAGGTGGAAGG 0: 1
1: 1
2: 1
3: 18
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962122234 Original CRISPR CATTAACTTTAAAAGGTGGA AGG Intronic
901902686 1:12379363-12379385 CATTCAGTTTTAAGGGTGGAGGG + Intronic
902127096 1:14223964-14223986 CGTGAACTCTAAATGGTGGATGG - Intergenic
904848988 1:33442850-33442872 CATGAACTTTAGAAGGCAGAGGG - Intergenic
906450664 1:45944235-45944257 AATTAAATTTAAAATGTGGGTGG - Intronic
908653987 1:66368532-66368554 CATTGAATTTAAAAATTGGAAGG - Intronic
908969143 1:69805739-69805761 CATTAAGCTGAAAAGGTGGCAGG - Intronic
911881170 1:103239931-103239953 GACTTACTTTAAAAGGTGAAGGG - Intergenic
912022538 1:105123150-105123172 TATTATCTTTATATGGTGGAAGG + Intergenic
912343004 1:108936049-108936071 TACTAACTATAAAAGCTGGAAGG + Intronic
914518165 1:148391773-148391795 GATTAACTATCAAAGGTGGTTGG + Intergenic
915908300 1:159895813-159895835 GAATAACTGGAAAAGGTGGATGG + Intronic
916796959 1:168176472-168176494 CCTAAACTTTAAAAGGGAGAAGG - Intergenic
921660863 1:217800762-217800784 AATTAATTTTAGCAGGTGGAAGG - Intronic
921821857 1:219625907-219625929 AATTAACTTTACAAGATAGAAGG + Intergenic
924951174 1:248884979-248885001 CCTTAAATTTAAAAGGAAGAGGG + Intergenic
1063272140 10:4522258-4522280 CATTAACCATGATAGGTGGAAGG + Intergenic
1063574637 10:7250820-7250842 CATTTATTTTTAAAGGTGGCTGG + Intronic
1063889288 10:10613118-10613140 CAGTAACTTTTAAAAGTAGAGGG + Intergenic
1064129422 10:12695720-12695742 CATTAAATTTAAAAGCTGGGTGG - Intronic
1069130541 10:64696279-64696301 CAGTAACTTTAATAACTGGAGGG - Intergenic
1070115182 10:73521789-73521811 CATTCACTTTGAGAGGAGGATGG - Intronic
1070804127 10:79260747-79260769 CATTAGCTTTATAAGGAGAATGG + Intronic
1071466051 10:85940665-85940687 CTTTAAATTTAAAGGGTGCAGGG + Intronic
1073189131 10:101637754-101637776 CCTTATCTCTAAAAGGAGGAGGG - Intronic
1074655007 10:115575053-115575075 CAATGAGTTTAAAAGGTGCAAGG - Intronic
1076035989 10:127198359-127198381 CAGTCACTTTAAAAGACGGAAGG - Intronic
1078820499 11:14875847-14875869 CATAAACTTTTAAAGGTAGAAGG - Intergenic
1079209303 11:18447030-18447052 CATTACCCCTAAAAGGAGGAGGG + Intronic
1079626617 11:22624838-22624860 CTTTATCTTTCAGAGGTGGAGGG + Exonic
1079772376 11:24478052-24478074 CATAAACTTTATAAAGTGGTGGG - Intergenic
1081896375 11:46590656-46590678 CATTTCCTTTAAAAACTGGACGG - Intronic
1084150125 11:67284194-67284216 CAGTAACTTTACCAGGTGGATGG - Exonic
1085379737 11:76104134-76104156 GACAAAGTTTAAAAGGTGGAAGG - Intronic
1085815942 11:79737642-79737664 CATTACCTTTCAAAGCTGAAAGG - Intergenic
1086758736 11:90600374-90600396 AATTAACTTTAAATGGTTCATGG + Intergenic
1087693090 11:101345007-101345029 CATTAACTTTTAGAGTTGAAGGG + Intergenic
1088251079 11:107861378-107861400 CAGTAACTTTAAAAGAGGGTGGG + Intronic
1088681734 11:112249429-112249451 CATTAACTTTAAAGCAGGGATGG - Intronic
1089869956 11:121663644-121663666 CATTGACTCTGAAAGGTGGTGGG - Intergenic
1090168088 11:124572508-124572530 CACAAATTTTAAAAGCTGGATGG + Intergenic
1091542756 12:1477341-1477363 CTTTAGCTTTAAAAGGGGGGAGG - Intronic
1093253993 12:16842856-16842878 GATTAACTTTAAAAAGATGATGG - Intergenic
1094407013 12:30127173-30127195 CATTCACTTTAAAAAGTGAATGG + Intergenic
1095591490 12:43908497-43908519 TATTAACTTTAAAATGTAAATGG + Intronic
1097524470 12:60713156-60713178 TATTAACTTCAAAAGGTAAATGG + Intergenic
1099164888 12:79292601-79292623 CATTAAATTTAAAAGCAGGATGG + Intronic
1105833802 13:24191270-24191292 CATTAATTTTAAAATATGGCTGG - Intronic
1106685929 13:32058975-32058997 CATTGACTCTAAAATGTAGATGG + Intronic
1106776259 13:33012973-33012995 AATTAATTTTAAAAAGAGGAGGG + Intergenic
1107425229 13:40286345-40286367 TCTAAACTTTAAAAGGAGGATGG + Intergenic
1108713426 13:53056345-53056367 CATTAGATTTGAAAGGTGGAAGG - Intergenic
1108716627 13:53085680-53085702 CTTTAACTTTAAATGGGTGAAGG + Intergenic
1109802296 13:67397017-67397039 CATTAAATTTAAAATGAAGATGG + Intergenic
1109855220 13:68118416-68118438 CATCCAATTAAAAAGGTGGAAGG - Intergenic
1111386755 13:87538084-87538106 GTTTAACTTTAAAAGACGGATGG + Intergenic
1111408550 13:87843141-87843163 GATTAACTGTAACAGGTGGTTGG - Intergenic
1112307955 13:98292198-98292220 CATTTATTTTACAAGTTGGAGGG + Intronic
1115451714 14:33555593-33555615 TATCAACTTAAAAAGGTGGGAGG - Intronic
1115707859 14:36016509-36016531 CAGTAAGTTTAAAAGGGGGCAGG - Intergenic
1116780224 14:49228609-49228631 AGTTAACTTTGAAAGATGGATGG - Intergenic
1117729132 14:58703900-58703922 CATTATCTGTAAATGATGGAGGG + Intergenic
1118520471 14:66577232-66577254 CACAAAATTTTAAAGGTGGAAGG + Intronic
1118671890 14:68137500-68137522 CATTATCTTTAATAGTTGCATGG + Intronic
1118767380 14:68918938-68918960 CCTTAACTGTAAAACGTGGCTGG + Intronic
1118941423 14:70342867-70342889 CATTTACTCTAAAAGATGAATGG - Intronic
1121601562 14:95208642-95208664 CATTAAGTTTCAAAGCAGGATGG - Intronic
1124146908 15:27136442-27136464 TTTTAACTTTAGAGGGTGGAAGG + Intronic
1124469758 15:29973368-29973390 CATCATATTTAAAGGGTGGAAGG + Intergenic
1125190871 15:36991520-36991542 CACTAACTTAATAAGGTTGATGG + Intronic
1125293481 15:38175877-38175899 CATTAACCTTTAAAGGAAGAGGG - Intergenic
1125590184 15:40849536-40849558 CATAAAATTCAAAAGGTGGCTGG - Intronic
1125614360 15:40996753-40996775 CCTGAACTTCAAAAGGTGGTTGG - Intronic
1126064281 15:44813628-44813650 CATGAACTGTCAAAGATGGAAGG + Intergenic
1128786415 15:70400664-70400686 CATTTGCTTTCCAAGGTGGAAGG + Intergenic
1129080652 15:73037044-73037066 CATTAACTTTACAATCTGGCTGG + Intergenic
1129148042 15:73667614-73667636 CAAAAACTTTAGAAGCTGGAAGG - Intergenic
1129733642 15:77946731-77946753 AAATAAAGTTAAAAGGTGGATGG + Intergenic
1129841952 15:78749270-78749292 AAATAAAGTTAAAAGGTGGATGG - Intergenic
1129898759 15:79129516-79129538 CCTTATCTTGAAAAGCTGGAGGG - Intergenic
1129971113 15:79778876-79778898 ATTTACCTTGAAAAGGTGGAAGG - Intergenic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1131185741 15:90272501-90272523 TATAAACTTTAAAATGTGGCTGG - Exonic
1131287239 15:91070489-91070511 AATAAACTTTAACAGGAGGAAGG + Intergenic
1132079423 15:98852024-98852046 AATTAATCTTAAAAGGTGGAGGG + Intronic
1137542389 16:49373764-49373786 TATTGGCCTTAAAAGGTGGAAGG - Intergenic
1137901923 16:52277964-52277986 CTTAAACCTAAAAAGGTGGAGGG + Intergenic
1139083454 16:63555031-63555053 CATTAAATTAGAAATGTGGATGG - Intergenic
1143689225 17:8546821-8546843 TATTAATTTGAAAAGATGGAAGG - Intronic
1145869372 17:28260828-28260850 CTTTTACTTTAAAAGGAAGAGGG - Intergenic
1147017457 17:37503685-37503707 CAATAACTATAAAAGGTGGAAGG - Intronic
1147815671 17:43208372-43208394 CATTAACCTGCAAAGGAGGATGG + Intronic
1150134003 17:62685432-62685454 CATTCTGTTTAAAAAGTGGATGG - Intronic
1150309055 17:64112653-64112675 AATTAACTTTAAAAAGTTGTTGG + Intronic
1153703831 18:7724777-7724799 AATAAACTTTAAAATGTGTAGGG + Intronic
1156043016 18:32844451-32844473 CATTAAAATTAAGAGGTTGAGGG - Intergenic
1156417016 18:36906073-36906095 AGTTAACTTTAAAAAGTGAATGG - Intronic
1156749810 18:40438239-40438261 CATTAGCTTTGAAAGCTGGAAGG + Intergenic
1156973702 18:43190295-43190317 AATCAACTTTAAAAGGGTGAGGG - Intergenic
1158031047 18:52965491-52965513 CATTAAATATATAAGGTGCATGG - Intronic
1160166820 18:76520838-76520860 GATTAACTTTAAAAACTGCAAGG + Intergenic
1160405435 18:78643028-78643050 CGTTACCTTGCAAAGGTGGATGG + Intergenic
1162368713 19:10265869-10265891 AATAAAATTTAAAAAGTGGAGGG - Intergenic
1164505454 19:28856989-28857011 TATTATCTTTATAAGGTGGACGG - Intergenic
1164887190 19:31790103-31790125 CATGAATTTTAAAAAGTGCAAGG + Intergenic
1168541355 19:57213165-57213187 AATTATTTTTAAAAGGAGGAGGG + Exonic
926778619 2:16446838-16446860 CTTTAAATTTAAAATTTGGAGGG + Intergenic
927365000 2:22284367-22284389 CAATAACTTCAAAGGGTCGAGGG - Intergenic
928382857 2:30835291-30835313 TAGTAACTATAAAAGGTGAAGGG - Intergenic
929019214 2:37533892-37533914 TGTTAACTTTAAAATGTGTAAGG - Intergenic
929130370 2:38562465-38562487 CATTAATTTTCAGAGGAGGAAGG + Exonic
929479775 2:42294223-42294245 CATTAAGTTTAAAAGATTTATGG - Intronic
930624787 2:53684919-53684941 CAATAACGTTAAAAGGAGCAGGG + Intronic
930733159 2:54748001-54748023 CTTTCACTTTAAAATGTGCAAGG + Intronic
933391255 2:81670826-81670848 AAATAACTTTAAAATATGGAAGG + Intergenic
933495127 2:83040872-83040894 CAGGAACTTTAAAAGATTGATGG + Intergenic
935948600 2:108308474-108308496 AAATAAAATTAAAAGGTGGATGG + Exonic
936032661 2:109084828-109084850 CATGAACTTCAAATAGTGGAGGG + Intergenic
936160640 2:110081869-110081891 CATGATCTTTAAAAGATAGAGGG - Intergenic
936184024 2:110289485-110289507 CATGATCTTTAAAAGATAGAGGG + Intergenic
937399948 2:121573808-121573830 CCTCAACTTTAAAAGGGAGAAGG + Intronic
937872357 2:126795242-126795264 CATTATTTTAAAAAGATGGAAGG + Intergenic
939033985 2:137109379-137109401 CATGAACTTGGAAAGGGGGATGG + Intronic
939042768 2:137211048-137211070 TGTTCACTTTAACAGGTGGAGGG - Intronic
940900276 2:159120420-159120442 GATTGACTTTACATGGTGGAGGG + Intronic
941049922 2:160721407-160721429 AATTTACTTTAAAAGTTGTAGGG - Intergenic
941318787 2:164029058-164029080 CATTATCATGAAAAGTTGGAAGG - Intergenic
941584415 2:167339577-167339599 CATTTACTTTTTAAGGTGGGTGG + Intergenic
941635989 2:167935247-167935269 AATTAACTGTACATGGTGGAGGG + Intergenic
941965837 2:171300284-171300306 CATTGACTTTTAGAGCTGGAAGG + Intergenic
942238310 2:173934537-173934559 AGTTAACTTTAAAGGGTGTAAGG - Intronic
942747584 2:179252790-179252812 AATTAAGTTTAAAAGGTGGCAGG - Intronic
943528409 2:189047840-189047862 CATTCACTTTAGATGGTGAATGG + Intronic
947537475 2:230949456-230949478 CAAGAACTTTAAAAGCAGGATGG - Intronic
947671514 2:231939493-231939515 TATTAAATATAAAATGTGGAAGG - Intergenic
948202399 2:236138829-236138851 CCTTTACTTTAAAATGTGGCTGG - Intergenic
1169104040 20:2979022-2979044 CATTAACTCTAAAAGGTGGAGGG + Intronic
1170693284 20:18634428-18634450 CATTAAATTGAAATGCTGGAAGG + Intronic
1172727304 20:37055262-37055284 CAGTTGCTTTAACAGGTGGAGGG + Intronic
1173683199 20:44902093-44902115 CCTCAATTTTAAAAGATGGAGGG - Intronic
1174753966 20:53140237-53140259 CATTATATTTAAAAGATAGAGGG + Intronic
1174833604 20:53836109-53836131 AAATAACTATAAAAGGTTGAGGG + Intergenic
1178194125 21:30323073-30323095 TATTAATTTTGAAAGATGGAAGG + Intergenic
1180858448 22:19062928-19062950 CTTTAACTTCAAAAGGAGGCGGG + Intronic
1183029175 22:35089741-35089763 ATTGAACTATAAAAGGTGGATGG - Intergenic
1184124097 22:42474719-42474741 CAGTAAATTTAAAAGGTGACTGG + Intergenic
1185375130 22:50479126-50479148 CATTTATGTTGAAAGGTGGAGGG - Intergenic
949315511 3:2750488-2750510 TATTGACTTTAAAAAGTGGGAGG - Intronic
949715679 3:6928542-6928564 CATTTATTTTAAAAGGTATATGG - Intronic
949730097 3:7100515-7100537 CATTAACATTAAACTGTGCAGGG - Intronic
949900576 3:8811764-8811786 CATTTGCTTGAAAAGATGGATGG + Intronic
950971042 3:17188188-17188210 CATTAACTATACAAGTTAGAGGG - Intronic
952523142 3:34182603-34182625 CATGAACTGTCAAAGATGGAAGG - Intergenic
952986575 3:38790767-38790789 CATTATCTGTAAAATGGGGATGG + Intronic
953517480 3:43608982-43609004 AATTAAATTTAAAAGGCGGTAGG - Intronic
954358846 3:50106802-50106824 CATCAATTTTCAAAGGAGGATGG - Exonic
954530503 3:51314811-51314833 CATAAACTCTAAAAAGTTGAGGG + Intronic
955730363 3:61978979-61979001 CATTATCTGTAAAATGGGGAAGG + Intronic
956041648 3:65151387-65151409 CATTAACTGCAAAAGGGGAATGG + Intergenic
956467323 3:69532466-69532488 CATAAATGTTTAAAGGTGGAAGG + Intronic
957480794 3:80790663-80790685 CATTATATTTAATATGTGGAAGG - Intergenic
957546953 3:81651461-81651483 GATTAGCTTTAATAGGTGGGAGG - Intronic
957740519 3:84261525-84261547 CATTAAATTAAAAAGGGGGTGGG + Intergenic
958569011 3:95855660-95855682 CATTAACTTTACATGTTAGATGG + Intergenic
958887684 3:99745810-99745832 CATTAACTTTCAAACCTTGATGG + Intronic
959339875 3:105115343-105115365 AATAAACTTTAGGAGGTGGAAGG - Intergenic
959619184 3:108381676-108381698 CATTAACTTCAAAGGGAGGCAGG + Intronic
962122234 3:132574074-132574096 CATTAACTTTAAAAGGTGGAAGG + Intronic
966081640 3:176011264-176011286 CATTAAGTTTAAAAAGGAGATGG + Intergenic
975111254 4:70629780-70629802 CACTAACTTTTAGAGATGGAAGG + Intronic
975275016 4:72486874-72486896 CATTAGTTTAAAAAGGTAGAAGG + Intronic
975809707 4:78154484-78154506 TAATAGCTTTAAAAGGTGGGTGG - Intronic
975838954 4:78454320-78454342 GATGAGCTTTAAATGGTGGAGGG + Intronic
976100659 4:81559493-81559515 TATTAAATTAAAAGGGTGGAAGG + Intronic
977129347 4:93215371-93215393 AATTAACTTTAAAAGATGTCTGG + Intronic
977819440 4:101455018-101455040 AATTAATTTTACAAGGTGTAAGG + Intronic
981259582 4:142703907-142703929 CATTACCTTCAAAGTGTGGAAGG + Intronic
981724436 4:147832807-147832829 CACTAATGTTCAAAGGTGGAAGG - Intronic
981735717 4:147948214-147948236 TATTATCTTTAAAAAGTGGCAGG - Intronic
982931531 4:161413907-161413929 GATGAACACTAAAAGGTGGAGGG + Intronic
983349395 4:166568789-166568811 AAATTTCTTTAAAAGGTGGAAGG + Intergenic
984126442 4:175816555-175816577 CATTAACTATAAAAAGTGAGGGG + Intronic
986324006 5:6658019-6658041 CATGAATTTTAAAATGTGAATGG + Intronic
988387640 5:30586454-30586476 CATTCATTTTAAAAGGCAGAGGG - Intergenic
988892889 5:35638460-35638482 CATTAATTTGCAAAGGTGCAAGG - Intronic
990022358 5:51143190-51143212 CATTGTCTTTACATGGTGGAAGG - Intergenic
990336267 5:54775741-54775763 CATGAACTTTAAAATGTTCAGGG + Intergenic
990454940 5:55975932-55975954 CAATAACTTTAAAATGGGGAAGG - Intronic
991350155 5:65712732-65712754 CATTAAATATAAAAGGTGAGAGG + Intronic
992328289 5:75685692-75685714 CATTAGCTTTCACATGTGGAAGG - Intronic
992970498 5:82051810-82051832 CTTTAACTTTAAAAAATGGATGG + Intronic
992994027 5:82314996-82315018 AATTAAATTTAAAAAGAGGAAGG + Intronic
992994769 5:82321824-82321846 CAGTAACCTTAAAAGGCTGATGG + Intronic
993770157 5:91916669-91916691 CATTACCTTTTAAAGGGGAAGGG - Intergenic
998107347 5:139476948-139476970 CATTAGCTTTAAAAGTAAGAGGG - Intronic
998184901 5:139970966-139970988 CATTAACTTTCAAAGCTCAAGGG - Intronic
998901834 5:146863676-146863698 CATAAAATTTAAAGGATGGATGG - Intronic
999280759 5:150364009-150364031 CATTGCCTTTAAGAGCTGGAAGG + Intronic
1001342282 5:170858773-170858795 CAATAGCTTTAAAAGGTGGTTGG + Intergenic
1001613201 5:173020679-173020701 CAGCAACTTTAAAAAGTGGCTGG + Intronic
1002937827 6:1688473-1688495 CACAAACTTTAGAAGGTGGAGGG - Intronic
1003065394 6:2900555-2900577 CAGTATCTTTAAAAGGCGTATGG + Exonic
1003209006 6:4042418-4042440 CTTTAACTTTAAAATGTATAAGG + Intronic
1004175613 6:13337302-13337324 CATTTACAATAAAATGTGGATGG - Intergenic
1005238121 6:23790091-23790113 CATTATATTTAAAATGTGGAAGG - Intergenic
1005906249 6:30263373-30263395 CATTAACCCCACAAGGTGGAAGG + Intergenic
1007190658 6:40014789-40014811 CAATAACTTTAAATGGGGAAAGG - Intergenic
1007298701 6:40849132-40849154 CATTAACTTGAAAAAGAGTATGG - Intergenic
1008792295 6:55251188-55251210 AAATAACTTTAAAATGTGGCTGG - Intronic
1009516368 6:64623930-64623952 AAATAACTTTAAAGGGAGGATGG + Intronic
1010907119 6:81504168-81504190 CATTATTTATAAAAGGTGGGTGG + Intronic
1014458123 6:121662213-121662235 CATTAATGTAAAAAAGTGGAGGG - Intergenic
1014544454 6:122717071-122717093 CATTCACTATAAAGGGAGGAAGG - Intronic
1014686850 6:124512397-124512419 CATTAAATGTAAAAGGAGGAAGG + Intronic
1015477531 6:133670483-133670505 CATGAGATTTAAGAGGTGGAAGG + Intergenic
1016596598 6:145809564-145809586 CAATAATTTTCAAAGGTAGAAGG + Intronic
1016627745 6:146192177-146192199 CATTCTCATTAAAAGGAGGATGG - Intronic
1017173675 6:151481520-151481542 CATTGGCTTTAAAAGGAGTAAGG + Intergenic
1020915069 7:14183360-14183382 CATAAATTTTAAAAGGGGGTGGG + Intronic
1021026474 7:15673350-15673372 CATTTTCATTAAAATGTGGATGG - Intronic
1022435202 7:30376780-30376802 AAATACCTTTAAAAGGTTGAGGG + Intronic
1022829365 7:34049535-34049557 CATTAACTCTAAGCGGTAGAAGG + Intronic
1025156393 7:56610825-56610847 CATTAATTTTTAAAGGTTAATGG - Intergenic
1027358266 7:77381542-77381564 AATTAACTGTAAAGGGAGGATGG - Intronic
1028729808 7:94133254-94133276 CATTAAGTTTAACAGGTAAAGGG - Intergenic
1030464578 7:109884267-109884289 CATTAAATTTTAAAGGAGAATGG - Intergenic
1031345787 7:120664550-120664572 CATTATCTTTTAAATGTTGATGG - Intronic
1031488465 7:122358733-122358755 TATTAACTTTAAAAGCTGTAAGG - Intronic
1031869802 7:127079420-127079442 CATTAACTTTAAAAAATACACGG - Intronic
1033231397 7:139600891-139600913 CAGGGACTTTAAAAGTTGGAGGG - Intronic
1034308550 7:150067216-150067238 CATTGAATTTAAATGCTGGATGG + Intergenic
1034311554 7:150093355-150093377 AATTCACTTTAAAAAGTGAAAGG + Intergenic
1034795301 7:154007299-154007321 AATTCACTTTAAAAAGTGAAAGG - Intronic
1034827295 7:154277461-154277483 AATAAATTTTAAAAGATGGAAGG + Intronic
1035927243 8:3741409-3741431 GATTAACTTCAGAAGCTGGATGG - Intronic
1036282906 8:7416879-7416901 CAGGACCTTTATAAGGTGGAAGG - Intergenic
1036338562 8:7894639-7894661 CAGGACCTTTATAAGGTGGAAGG + Exonic
1037962421 8:23107649-23107671 AATTAACATTAAAATGTGCAGGG + Intronic
1037969020 8:23158643-23158665 AATTAACATTAAAATGTGCAGGG - Intronic
1038728429 8:30103277-30103299 CATAAACTTTAAAATATGAATGG - Intronic
1038779544 8:30558252-30558274 CATTAGCTTTCTAAAGTGGAAGG - Intronic
1038832554 8:31077547-31077569 GATGAACTTTAAAATGGGGAAGG + Intronic
1042000197 8:64113747-64113769 AATTAATTTTAAAAGCTTGATGG - Intergenic
1042846143 8:73171243-73171265 CATTGAGTATAAAAGGTGCATGG + Intergenic
1043277632 8:78419761-78419783 CAGTCACTTTATAAGGAGGATGG - Intergenic
1044119584 8:88378191-88378213 CATAATCTTTTAATGGTGGATGG + Intergenic
1046678868 8:117144627-117144649 CATTATGTTTAAAATATGGAAGG - Intronic
1048561387 8:135541487-135541509 CAATAAAATTAAAAGTTGGAAGG + Intronic
1048908042 8:139107272-139107294 CAAGAACCTTAAATGGTGGAAGG + Intergenic
1049077150 8:140407547-140407569 CCCTTTCTTTAAAAGGTGGAGGG - Intronic
1052495278 9:29215927-29215949 CATTAACTTTAATACGTGAAGGG + Intergenic
1056948794 9:91025352-91025374 CTTTATCTGTAAAATGTGGATGG + Intergenic
1058507242 9:105678604-105678626 CTTTAGCTTTAAAAGGGAGAGGG - Intergenic
1060376778 9:123122063-123122085 CATTACCTTTAAAAATTGTATGG - Exonic
1060418304 9:123448833-123448855 AATTAACTTGAAAGGGTCGAAGG - Intronic
1060964339 9:127704206-127704228 CATAAAATTTAAAAGCTGGCTGG + Intronic
1186170039 X:6867222-6867244 CAATAACTTTGAAAGGTAGGGGG - Intergenic
1186588413 X:10901757-10901779 CAACAAATTTAATAGGTGGAAGG - Intergenic
1186972005 X:14856771-14856793 CATAATTTTTAAAAGGGGGAAGG + Intronic
1187351273 X:18519939-18519961 CATTAACCATAAAAGTTAGAAGG + Intronic
1187665995 X:21609866-21609888 CATTAACCTTAAAAGGCAAATGG - Intronic
1188381520 X:29499605-29499627 CATTCACATTTAAAAGTGGAAGG + Intronic
1188762983 X:34054945-34054967 CATTAACGTTAAAAATTGGTAGG + Intergenic
1188916881 X:35922218-35922240 CATTGACCTTAAAAGATGCATGG - Intronic
1191240981 X:58189921-58189943 CTTTATCTTTAAAATGTGGGAGG - Intergenic
1192188745 X:68977981-68978003 AAGCAACTTTAGAAGGTGGAAGG - Intergenic
1192421621 X:71037534-71037556 CATTGATTTTAACAGGTGCATGG - Intergenic
1192630625 X:72775343-72775365 CATTAACATGAGAAGATGGAGGG - Intergenic
1192651085 X:72945461-72945483 CATTAACATGAGAAGATGGAGGG + Intergenic
1193099673 X:77594415-77594437 CTTTGACTATGAAAGGTGGAAGG + Intronic
1193251849 X:79299906-79299928 CATGAAATTAAAAATGTGGATGG + Intergenic
1193847260 X:86488560-86488582 CATTATCTTTAAAATGAGTATGG + Intronic
1193994508 X:88347793-88347815 CAGAAACTTTACAAGCTGGATGG + Intergenic
1198591885 X:138192606-138192628 CATGACCATTAAAAGATGGATGG - Intergenic
1198834283 X:140784916-140784938 CATTACTTTTAAAAGTTGTAGGG - Intergenic
1199118320 X:144018988-144019010 CATTAGCTTGAAAAGGAAGAGGG + Intergenic