ID: 962124432

View in Genome Browser
Species Human (GRCh38)
Location 3:132600827-132600849
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 2, 1: 0, 2: 0, 3: 14, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901801183 1:11708990-11709012 GCGCCCAGCCAATCTGGACTTGG + Intronic
902386141 1:16076962-16076984 GTGCCCAGCCAATCAGGGCCAGG - Intergenic
902477707 1:16697009-16697031 GCACCCATCCAATCTGGAGTTGG - Intergenic
903808658 1:26022445-26022467 GTCACCAGCCAGGCAGGAGGAGG - Exonic
905899982 1:41575024-41575046 GGCCCCAGCCAGTCAGGATAGGG + Intronic
906902152 1:49846402-49846424 GTCCCCAGCACATGTGGAGTGGG - Intronic
907729425 1:57051568-57051590 GTCCCCAAGCAATCAGTATTTGG - Intronic
908203771 1:61824072-61824094 GTGCCCAGCCAATAAGAAGCTGG - Intronic
908572661 1:65425593-65425615 GTCCCCAGCTAGTCCAGAGTAGG - Intronic
912383756 1:109261258-109261280 GTGCCCAGCCACTCACGAGAGGG - Exonic
912401641 1:109398050-109398072 GACGCGAGCCAATGAGGAGTGGG - Intergenic
916171181 1:162002698-162002720 GTCCCCTACCTTTCAGGAGTCGG - Intronic
916576262 1:166069855-166069877 CTTCCCAGCCAATTAGAAGTAGG - Intronic
916742397 1:167657639-167657661 GTCCCCAGACACCCAGGACTTGG + Intronic
920724452 1:208420833-208420855 GTCCACAGCCCATGAGGAGTAGG + Intergenic
923141106 1:231162272-231162294 GTCCACAGCCGCCCAGGAGTAGG + Intronic
1066277823 10:33886428-33886450 ATCTCCAGCCAATCAGAAATGGG + Intergenic
1072572340 10:96669671-96669693 GGTCCCAGCTAATCAGGAGACGG + Intronic
1077343780 11:2037323-2037345 GTCCCCAGCCTGTCTGGGGTGGG - Intergenic
1079449696 11:20589256-20589278 ATCCTCAGCCAATAAGGGGTGGG + Intergenic
1080749130 11:35136565-35136587 GTCCTCAGCCACTCAGAAGCTGG - Intergenic
1081689622 11:45069065-45069087 GTCCCCAGCCAAGCCTGAGCTGG - Intergenic
1084318988 11:68363011-68363033 GTGCCCAGCAAATGAGGACTCGG - Intronic
1084451124 11:69239441-69239463 CTCCCCAGCCAGTCTGGAGGTGG + Intergenic
1085204719 11:74724458-74724480 ATCCCCAGCCTATCATGAGGTGG + Intronic
1090766427 11:129880066-129880088 GGTCCCAGCTACTCAGGAGTAGG + Intronic
1090788416 11:130069747-130069769 GTCCAGACCCAATCAGGAGATGG - Intergenic
1202826766 11_KI270721v1_random:92512-92534 GTCCCCAGCCTGTCTGGGGTGGG - Intergenic
1096865518 12:54560575-54560597 TCTCCCAGCCAATCAGGAGGCGG + Intronic
1097551470 12:61076881-61076903 GTACACAGTCAATCAGGAGCAGG - Intergenic
1101975931 12:109358970-109358992 ACACCCAGCCCATCAGGAGTTGG + Intronic
1102016422 12:109650899-109650921 GTCCCCAGGCAGGCAGGAGGAGG - Intergenic
1102198809 12:111043478-111043500 GCCACCTGCCAATGAGGAGTAGG + Intronic
1103413856 12:120731370-120731392 GTCTCCAGCTACTCAGGAGGAGG - Intronic
1112178016 13:97047686-97047708 GTCCCCATCATAACAGGAGTTGG + Intergenic
1115664633 14:35534072-35534094 TGGCCCGGCCAATCAGGAGTGGG - Exonic
1118019315 14:61695285-61695307 GCTCTCAGCCAATCAGGAGGCGG - Intergenic
1118436055 14:65771752-65771774 GACCCCAGACACTCAGGAGGAGG - Intergenic
1121595331 14:95157635-95157657 CCCCCCAGCCACTCAGGAGCAGG + Intronic
1121870385 14:97401749-97401771 AACCACAGCCAATCAGGAGATGG - Intergenic
1122772746 14:104104556-104104578 GCCCCCAGCCCATGAGGGGTGGG - Intronic
1125543961 15:40489044-40489066 GGTCCCAGCCACTCAGGAGGAGG + Intergenic
1126053835 15:44711458-44711480 GTGCCCAGCCAATCAGGACAAGG - Exonic
1128779348 15:70348634-70348656 GTCCACAGTCAACCAAGAGTAGG - Intergenic
1130574779 15:85082087-85082109 GTCCCTGCCCAATCAGAAGTGGG + Intronic
1131302302 15:91210328-91210350 GTCCCGAACCAAGCAGGAGGTGG + Intronic
1132478022 16:152323-152345 GTCCCCTGACAAGCAGGAGGAGG - Intergenic
1133393465 16:5427755-5427777 GGCCCCATCCAATCAGGTGAAGG - Intergenic
1134888430 16:17816345-17816367 GTCCCCAGCTGACCAGAAGTGGG + Intergenic
1134889779 16:17829889-17829911 TTCCCCAGCTACTCAGGAGGCGG - Intergenic
1135264627 16:21012562-21012584 CACCCCTGCCAATCAGTAGTTGG + Intronic
1138598216 16:58040741-58040763 GTCCCTGGCCAATGAGGAGTAGG + Intronic
1139605812 16:68017464-68017486 GCGCCCAGCCAATCAAGTGTAGG + Intronic
1142121870 16:88390449-88390471 TTCTCCAGCCAAACAGGAGGCGG + Intergenic
1142596696 17:1033208-1033230 GTCACCAGCCAGGCAGGTGTCGG + Intronic
1143633695 17:8152483-8152505 ATCCCCAGCCAATCGGGGGCGGG - Intronic
1147456839 17:40543157-40543179 TAGGCCAGCCAATCAGGAGTTGG + Intergenic
1148688258 17:49512742-49512764 GCCCCCAGCCAAGCGGGAGGAGG + Exonic
1148724603 17:49779631-49779653 CTCCCCACCCAATCTGGAGAAGG + Intronic
1155234717 18:23807699-23807721 GTCCTCATCCAATCAGGTGAAGG - Intronic
1162020623 19:7866861-7866883 CTCCCCAGCATGTCAGGAGTCGG + Intergenic
1162494234 19:11014191-11014213 CTCCCCAGCCTGCCAGGAGTTGG - Intronic
1162579720 19:11521655-11521677 GTCCCCAGCTACTCAGGAGGCGG + Intronic
1162834603 19:13308077-13308099 GACCCCAGGGAACCAGGAGTTGG + Intronic
1163505818 19:17705529-17705551 GTCTCCAGCCAGTCTAGAGTGGG - Intergenic
1163809813 19:19423863-19423885 TTCCCCAGCCACTCTGGATTCGG + Intronic
1164221043 19:23194086-23194108 GTGCCCAGCCAATGATAAGTGGG + Intergenic
1165144925 19:33724782-33724804 CTCCCCAGCCCACCCGGAGTGGG - Intronic
1167300282 19:48673904-48673926 GTCCCAAGCCTGTCAGGATTGGG - Intergenic
1168647374 19:58068463-58068485 GTCCCCAGCACATGTGGAGTGGG - Exonic
925921224 2:8639244-8639266 GTCCCCAGCCCCTCAGGATAGGG - Intergenic
927198334 2:20563369-20563391 GTCAGCAGCCAAACAGGGGTGGG + Intronic
928811830 2:35236636-35236658 GTACCCAGTCATTCAGGAGCAGG - Intergenic
929790002 2:45015148-45015170 GTCACCAGCCAGGCAGGAGGGGG - Intergenic
930911866 2:56638522-56638544 GTCTACAGACAATCAAGAGTAGG - Intergenic
932209597 2:69915637-69915659 TTCCCCAGCCCTTCACGAGTGGG + Intronic
935032497 2:99336350-99336372 GTTCGCAGCCAATAAGGAGGCGG - Exonic
935281952 2:101526030-101526052 GACCCCAGCCAATGGGGAGAGGG - Intergenic
938696173 2:133837406-133837428 GTCCCCAGGGCATCAGGAGGAGG + Intergenic
948431753 2:237923267-237923289 GTCCCCAGCCCATCACAAGCTGG + Intergenic
948877334 2:240836711-240836733 GCCCCCAGCCAACCAAGGGTAGG + Intergenic
948883833 2:240873354-240873376 GGCTCCAGTCAATCAGGCGTTGG + Intronic
1168889232 20:1283298-1283320 GCCCCCAGTAAATCAGGAGTGGG - Intronic
1168956167 20:1835945-1835967 GTCCCCAGAGAATGAGAAGTGGG - Intergenic
1170723917 20:18908754-18908776 GCCCCCAGCCTAACTGGAGTGGG - Intergenic
1178080200 21:29055554-29055576 GTCCCCAGCTTTTCAGGAGGCGG + Intergenic
1181045022 22:20210374-20210396 GTCCCCTGACAACCAGGAGTTGG + Intergenic
1181165113 22:20979192-20979214 GTCCCCAGGGCATCAGGAGCAGG + Intronic
1183016938 22:34996580-34996602 GCCCACAGCCCATCAGGAATGGG + Intergenic
1184737823 22:46409535-46409557 GTCCCCAGTCCCTCAGGTGTGGG - Intronic
1184924143 22:47625734-47625756 GTCACCAGCAAAGCAGGAGTGGG - Intergenic
1185330204 22:50248984-50249006 TTCCCCAGCCACACAGGAGTGGG + Intronic
949891235 3:8734835-8734857 GGTCCCAGCTAATCAGGAGGTGG - Intronic
954966091 3:54612289-54612311 TTCCTCAGTCAATCAGGAGAAGG - Intronic
956328000 3:68074313-68074335 GTCCACAGCCTATCAGGAACTGG - Intronic
961646691 3:128396541-128396563 GCCCCCATCCATGCAGGAGTTGG + Intronic
962124432 3:132600827-132600849 GTCCCCAGCCAATCAGGAGTGGG + Exonic
963134076 3:141884583-141884605 GTGCCCACCCAATTAAGAGTGGG - Intronic
963811596 3:149782339-149782361 TTCCCCAGCTACTCAGGAGGTGG - Intronic
965287505 3:166835670-166835692 TTCCCCACCCAACCTGGAGTGGG - Intergenic
967220162 3:187241980-187242002 GCCCTCAGCCAGGCAGGAGTGGG - Intronic
967889670 3:194356316-194356338 GTCCCACGCCCATCTGGAGTGGG - Intronic
968872863 4:3250407-3250429 GTCCCCAGCCCATTAGGACAGGG + Intronic
969247685 4:5946013-5946035 CTCTCCACCCCATCAGGAGTAGG + Intronic
972661286 4:41119018-41119040 GGCCCCAGCTACTCAGGAGGAGG + Intronic
975725777 4:77290472-77290494 GTCCTCAGCCAGTGAGGAGCAGG - Intronic
979559894 4:122089750-122089772 GTCCCTGGCAAATCAGGAGGTGG - Intergenic
980075336 4:128287910-128287932 GTCAACACCCAATCAGGAGCCGG - Exonic
984253086 4:177358168-177358190 TTCTGCAGGCAATCAGGAGTAGG + Intronic
984647272 4:182233158-182233180 GTGCTCAGCCAAACAGGAGCCGG + Intronic
985270782 4:188192800-188192822 GACCCCATCCAATCAGGTGAAGG - Intergenic
985902760 5:2809532-2809554 ATCCCCAGGCAATCAGTGGTGGG + Intergenic
986156019 5:5176785-5176807 GTCATCAGCCAATCAGGCTTTGG - Intronic
986186541 5:5446405-5446427 GTTCCCAGCTACTCAGGAGGTGG - Intronic
987418204 5:17687314-17687336 TTCCCCAGTCCACCAGGAGTAGG + Intergenic
988454298 5:31373537-31373559 GTACCCAGCCATGCAGGACTAGG + Intergenic
991772513 5:70052947-70052969 GTCCCCATCAAATCACTAGTAGG + Intronic
991851806 5:70928371-70928393 GTCCCCATCAAATCACTAGTAGG + Intronic
992218381 5:74547591-74547613 TTCCCCAGCCCATCAGGAGAGGG - Intergenic
997661369 5:135591673-135591695 GATCCCAGCCAATGGGGAGTGGG + Intergenic
1004263622 6:14130154-14130176 GTCCCCAGCCAACCAGCAAAGGG + Intronic
1006191539 6:32212731-32212753 GTCCCAGGCCATTCAGGAGAAGG - Intronic
1010273091 6:73937205-73937227 GTCCCCAGCCAAAGAGGGGTTGG - Intergenic
1013420009 6:109959038-109959060 GGCCCCAGCTCATCAGGAGAAGG - Intergenic
1013429332 6:110041856-110041878 GTCCCCAACCAATCACTAATAGG - Intergenic
1015201568 6:130587333-130587355 GTTCCCAGCCCATCAGAAGGTGG + Intergenic
1015979340 6:138823176-138823198 GTCCCCAGCCAATCAGGAGTGGG + Intronic
1020477048 7:8608453-8608475 AGTCCCAGCTAATCAGGAGTGGG - Intronic
1023059628 7:36315259-36315281 GTCCCCAGCCAAGCATGAGGAGG + Intergenic
1026293343 7:69028709-69028731 GTCCCCAGGCATGCAGAAGTAGG + Intergenic
1028894808 7:96029232-96029254 GGCCCCAGTCAATCAGAATTGGG - Intronic
1028910841 7:96205809-96205831 GTCCCCACCCACTAAGGTGTTGG - Intronic
1032485552 7:132284633-132284655 GGCCAGAGCCAACCAGGAGTGGG + Intronic
1032841101 7:135714277-135714299 GTCTCCAGTCATGCAGGAGTTGG - Intronic
1033221003 7:139526051-139526073 GACCACAGGCCATCAGGAGTGGG - Intronic
1038708472 8:29919548-29919570 GTCTTCAGGCACTCAGGAGTGGG + Intergenic
1042911641 8:73833822-73833844 CTCCCATGCCAATCAGTAGTGGG - Intronic
1043967825 8:86498660-86498682 AGCCCCAGCCACTCAGGAGGTGG + Intronic
1045245187 8:100436416-100436438 GCCCCCAGGCAATGAGCAGTTGG - Intergenic
1047023997 8:120807728-120807750 GTCCCCAGCACTTCAGGAGTGGG + Intronic
1047500408 8:125436128-125436150 GTCCGCAGCCTTTCCGGAGTAGG - Exonic
1048214365 8:132481195-132481217 GTCCCCAGACAATCAGCGGTGGG - Intergenic
1049206738 8:141367090-141367112 ACCCCCAGCCAAGCAGGAGTGGG - Intronic
1055164947 9:73179870-73179892 CTCCACAGCCAGTGAGGAGTCGG - Intergenic
1056237163 9:84606056-84606078 GTGGCCACCCTATCAGGAGTAGG - Intergenic
1058181981 9:101809477-101809499 GTGCCCACCCAATTAAGAGTGGG - Intergenic
1060004163 9:119984999-119985021 GTCCTCTGCCACTCAGTAGTTGG - Intergenic
1061541333 9:131279093-131279115 ATCCCCAGCTAATGAGGAGGTGG + Intergenic
1062456240 9:136640592-136640614 GTCCTCAGCCCTGCAGGAGTCGG + Intergenic
1185808457 X:3081816-3081838 GTCCTCAGCCACCCAGTAGTTGG + Intronic
1187442968 X:19336501-19336523 GGTCCCAGCTACTCAGGAGTCGG - Intergenic
1187749552 X:22446734-22446756 GCCTCCAGCCAATCAGTAGAAGG - Intergenic
1190598936 X:52069993-52070015 GTCCCCAGGCCAGCAGGAGCAGG - Intergenic
1190609888 X:52184080-52184102 GTCCCCAGGCCAGCAGGAGCAGG + Intergenic
1192225176 X:69222659-69222681 TTCCCCAGCCCACCAGGAGGAGG - Intergenic
1192446360 X:71214517-71214539 ATCCCCAGCCACTCAGGATGTGG + Intergenic
1195136507 X:101912075-101912097 GTCCCCAGCACATGTGGAGTGGG - Intronic
1196834825 X:119804236-119804258 GTCCCCAGCTACTCAGAAGGCGG - Intergenic
1199431120 X:147761125-147761147 ATCCCCAGCTACTCAGGAGATGG - Intergenic
1201973160 Y:19817651-19817673 GACCCCAGCCAATCGGGAAAGGG - Intergenic