ID: 962128064

View in Genome Browser
Species Human (GRCh38)
Location 3:132643549-132643571
Sequence GTGACTGACCATTCTAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 106}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962128059_962128064 -5 Left 962128059 3:132643531-132643553 CCCCAGACTCAGGCAATGGTGAC 0: 1
1: 0
2: 2
3: 16
4: 152
Right 962128064 3:132643549-132643571 GTGACTGACCATTCTAAGGAGGG 0: 1
1: 0
2: 1
3: 6
4: 106
962128057_962128064 0 Left 962128057 3:132643526-132643548 CCTGGCCCCAGACTCAGGCAATG 0: 1
1: 0
2: 2
3: 24
4: 297
Right 962128064 3:132643549-132643571 GTGACTGACCATTCTAAGGAGGG 0: 1
1: 0
2: 1
3: 6
4: 106
962128061_962128064 -7 Left 962128061 3:132643533-132643555 CCAGACTCAGGCAATGGTGACTG 0: 1
1: 0
2: 0
3: 18
4: 136
Right 962128064 3:132643549-132643571 GTGACTGACCATTCTAAGGAGGG 0: 1
1: 0
2: 1
3: 6
4: 106
962128060_962128064 -6 Left 962128060 3:132643532-132643554 CCCAGACTCAGGCAATGGTGACT 0: 1
1: 0
2: 0
3: 14
4: 186
Right 962128064 3:132643549-132643571 GTGACTGACCATTCTAAGGAGGG 0: 1
1: 0
2: 1
3: 6
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962128064 Original CRISPR GTGACTGACCATTCTAAGGA GGG Intronic
901210330 1:7520862-7520884 GTGTCTGGCCATGCTGAGGAAGG - Intronic
905891901 1:41523118-41523140 CTGACTGACAATTCAATGGACGG - Intronic
906299362 1:44670917-44670939 TTGGCTGACCATTCTCTGGATGG + Intronic
916625870 1:166554032-166554054 GTGAGAGAAAATTCTAAGGAGGG - Intergenic
918012847 1:180603723-180603745 GTGCCAGAACATTCCAAGGAAGG - Intergenic
921858200 1:220012089-220012111 GTGAATGACCTCTCTGAGGATGG - Intronic
922181728 1:223241167-223241189 GGGACAGACCATGTTAAGGACGG + Intronic
923235569 1:232029932-232029954 CTGATTGACCAATCCAAGGAGGG + Intronic
924295868 1:242586399-242586421 GTGAGAGATGATTCTAAGGAGGG - Intergenic
1063649875 10:7924155-7924177 GTGACTGACTATTCTAAATGTGG + Intronic
1063911440 10:10834601-10834623 GTGAATGACCATTGTTACGAGGG + Intergenic
1068724353 10:60284504-60284526 GTTAATCACCATTCTAAGAAAGG + Intronic
1075506061 10:123023858-123023880 GTGAAAGAAAATTCTAAGGAGGG + Intronic
1076653983 10:132009067-132009089 GTGAGAGAAAATTCTAAGGAGGG - Intergenic
1076989089 11:260242-260264 GTGACTGGCCATCCTTAGGTGGG - Intergenic
1077868344 11:6241033-6241055 GTTGCTGACCATTCTCAGGGGGG - Intronic
1082778180 11:57263905-57263927 GTGAGAGAAAATTCTAAGGAGGG - Intergenic
1085930223 11:81072721-81072743 GCGAATCACTATTCTAAGGAAGG - Intergenic
1088103097 11:106176237-106176259 GTGATAGAAAATTCTAAGGAGGG - Intergenic
1092201004 12:6582821-6582843 GTGCCATACGATTCTAAGGAGGG - Intronic
1096488351 12:51999222-51999244 ATGACTGACTATTCACAGGATGG - Intergenic
1103368524 12:120400877-120400899 TTTACTGACCACTCTATGGAGGG + Intergenic
1107566904 13:41614240-41614262 GGCACAGACCATCCTAAGGAAGG + Intronic
1108679318 13:52765681-52765703 GTGACTGGCCCTTGTAAGGCTGG + Intergenic
1110107182 13:71692277-71692299 GAGACTAACCATGCTAAGGATGG - Intronic
1117505712 14:56401050-56401072 GGGACTCACCATTGGAAGGAAGG + Intergenic
1122075077 14:99230661-99230683 GTGGCTGCCCATTCTACAGATGG - Intronic
1126112849 15:45185825-45185847 GTGACTGTCCATTATCAGGGTGG - Intronic
1128138233 15:65280131-65280153 ATGGCTAACCTTTCTAAGGAAGG - Intronic
1130958986 15:88647324-88647346 GTGTCTGACCATTATATAGAGGG + Intronic
1132076819 15:98828383-98828405 GTGACTGTCCATCCATAGGATGG + Intronic
1136116073 16:28095575-28095597 GTGTCTCCCCATTCTGAGGAAGG - Intergenic
1142471941 17:169674-169696 GAGACTGACCCTTATAAGGGGGG + Intronic
1143037187 17:4006110-4006132 GGGACTGACCATTCTGTGAAAGG - Exonic
1146724671 17:35147680-35147702 ATGACTGACCAGTCTGGGGAGGG + Intergenic
1146939779 17:36836447-36836469 GTGAGTGCCCATTCTCAGGGAGG + Intergenic
1146982407 17:37176722-37176744 GAGACTGACCAATCTAAGGATGG - Intronic
1154073394 18:11176175-11176197 GTGGGTGACCAGCCTAAGGAAGG + Intergenic
1155492645 18:26415481-26415503 GTGTCTGACCATAGAAAGGAGGG - Intergenic
1156008060 18:32467068-32467090 GTGAATATTCATTCTAAGGATGG + Intronic
1156995156 18:43456972-43456994 ATTAGTGACCATTATAAGGAAGG + Intergenic
1157486827 18:48093566-48093588 GTGACTGCCTATTCTAAGCCTGG + Intronic
1158494759 18:57944659-57944681 GTGACTCACAAGTCAAAGGAAGG - Intergenic
1164701707 19:30289426-30289448 ATCACTGACCACTCCAAGGAGGG + Intronic
1165799171 19:38537148-38537170 CTGACTGACCAATCTGAGGTCGG - Intronic
1166956373 19:46468173-46468195 GTCGCTGACCATTCCGAGGAGGG + Exonic
1167204440 19:48091081-48091103 GTGACTTAATATGCTAAGGATGG + Intronic
925463810 2:4088580-4088602 GTGGCTGATCTTTCTAATGAGGG - Intergenic
926811187 2:16756677-16756699 GTGACAGGACAGTCTAAGGAGGG - Intergenic
935258091 2:101330469-101330491 GAGACTGACCAAGCTGAGGAGGG + Intergenic
935842093 2:107124617-107124639 GTGCCTGCCCAATCTAAGCAGGG - Intergenic
940681302 2:156788591-156788613 GTAACAGATCATTCTAAGGCAGG + Intergenic
948271050 2:236673573-236673595 GTGACTGACCTTTCTGGGCAAGG + Intergenic
1173087365 20:39936801-39936823 GGGACTGAGCATTCTGAGGCAGG + Intergenic
1173376270 20:42486298-42486320 TTGACTTAGCCTTCTAAGGATGG + Intronic
1175661966 20:60821224-60821246 GGGTCTGCCCATTGTAAGGATGG + Intergenic
1180124655 21:45781477-45781499 GTAACTGACCATACTAAGTATGG + Intronic
1183922058 22:41177438-41177460 GTGGCTGAGCAGTCTGAGGAGGG - Exonic
949520967 3:4853644-4853666 GCAAGTAACCATTCTAAGGAGGG + Intronic
951841877 3:27043470-27043492 GTGAGAGAAAATTCTAAGGAGGG + Intergenic
952580936 3:34832641-34832663 GTGACTGACCTGTCTCAAGATGG - Intergenic
954870141 3:53761605-53761627 GTGAATGGAGATTCTAAGGAAGG + Intronic
955065868 3:55533306-55533328 ATGACTAACCATTCTAACCAGGG + Intronic
956858094 3:73295603-73295625 TTAACTGGCCATGCTAAGGAAGG - Intergenic
960500005 3:118426497-118426519 GTGACAGGCCATTGTTAGGAAGG - Intergenic
962128064 3:132643549-132643571 GTGACTGACCATTCTAAGGAGGG + Intronic
966239479 3:177740476-177740498 GTGAATGAGGTTTCTAAGGAAGG + Intergenic
967037908 3:185661911-185661933 GGGACGGAGCATTCTAAGCAGGG + Intronic
968868691 4:3230029-3230051 GTCACTTACCATCCCAAGGACGG - Exonic
971851028 4:31986625-31986647 GTGACAGACCAGTCTGAGGAGGG + Intergenic
977656332 4:99525323-99525345 AAGACTGACCATTCTAAGCTTGG - Intronic
978625091 4:110676433-110676455 GTCACTGGCCACTCTAAAGAGGG - Intergenic
980128624 4:128797882-128797904 GTATCTGACCATTCTTAGGATGG - Intergenic
985282357 4:188300032-188300054 GTGAACGACTGTTCTAAGGAGGG + Intergenic
987441263 5:17959984-17960006 GTGGCTTACCTTTCTAAGTAAGG + Intergenic
989685287 5:44078396-44078418 GTGTCTCACCATTCTAAGGCAGG - Intergenic
992632992 5:78699853-78699875 GTGACTCACCAATGTGAGGATGG + Intronic
993401208 5:87454146-87454168 ATGACTGACTATTCAAAGGTGGG - Intergenic
996064698 5:119068064-119068086 GTCAGTGAGCATTCAAAGGATGG + Intronic
1000122492 5:158210441-158210463 GTGACTGGCCAGTTCAAGGATGG - Intergenic
1005699424 6:28385248-28385270 GTGATTTATCATTCTAAGAAGGG + Intronic
1006115957 6:31776367-31776389 GTCCCGGACCTTTCTAAGGAGGG + Intronic
1010573467 6:77505957-77505979 GTGAATGACTATTCTGAGTATGG - Intergenic
1014279832 6:119429466-119429488 GTCACTGACCTACCTAAGGATGG - Intergenic
1015511693 6:134044059-134044081 TTTACGGAGCATTCTAAGGAGGG - Intronic
1015805418 6:137103281-137103303 GTGCCTGCCCATTCTCAGGATGG + Intergenic
1018795937 6:167185712-167185734 GAAACTGATCATTCTAAAGAGGG - Intronic
1018820380 6:167369352-167369374 GAAACTGATCATTCTAAAGAAGG + Intronic
1018925965 6:168207283-168207305 GTATCTGATCTTTCTAAGGAAGG + Intergenic
1020660962 7:10981589-10981611 GTGACTGCTCATTTTCAGGATGG + Intronic
1023921504 7:44633651-44633673 GTGACTGACCACTCAAAGAGAGG - Intronic
1024085692 7:45889812-45889834 GTCAGTGACCCTTCCAAGGAGGG + Intronic
1024329100 7:48139046-48139068 GTGAGAGAAAATTCTAAGGAGGG + Intergenic
1025240077 7:57264123-57264145 GTGACTGAAAATTCTAGGAACGG - Intergenic
1026812727 7:73482099-73482121 TTGTCAGCCCATTCTAAGGATGG - Intronic
1028788947 7:94831349-94831371 GTGAGTGACCATTGAAAGAAGGG - Intergenic
1033850384 7:145488084-145488106 GTGAGAGAAAATTCTAAGGAGGG + Intergenic
1036730199 8:11256178-11256200 GTGACTGTCCATTCCCAGGCTGG + Intergenic
1037327949 8:17713191-17713213 GTGAGTGACCACTTTATGGATGG - Intronic
1038609272 8:29044431-29044453 GGGTCTGAGAATTCTAAGGATGG + Intronic
1039782313 8:40797523-40797545 GTGAGTGACAAGACTAAGGACGG + Intronic
1042443799 8:68860191-68860213 CTGACAGACCAATCTTAGGAAGG - Intergenic
1044008032 8:86961512-86961534 GTGAGAGAAAATTCTAAGGAGGG + Intronic
1045569304 8:103353041-103353063 GTGTCTGATCAGTCTGAGGATGG - Intergenic
1046486773 8:114896994-114897016 GTGAGAGAAAATTCTAAGGAAGG - Intergenic
1051048296 9:12901628-12901650 GAGACTGAACATTGTGAGGAGGG - Intergenic
1052845324 9:33330596-33330618 GTGACTGAAAATTGTAAGCAGGG + Intronic
1188971488 X:36622072-36622094 TTGAATGACCAGTCTAAGTATGG - Intergenic
1189416215 X:40816664-40816686 GTGAGAGAAAATTCTAAGGAGGG + Intergenic
1194379986 X:93179555-93179577 GTGAGAGAAAATTCTAAGGAGGG - Intergenic
1196968374 X:121083170-121083192 GTGAGAGAAAATTCTAAGGAGGG + Intergenic
1197313587 X:124936321-124936343 GGGACTGAGCATTCCAAGCAAGG - Intronic
1198678399 X:139155594-139155616 TTGACTCACCATTCTAGGGTAGG + Intronic
1199877432 X:151945298-151945320 GTGATTAACCGTTATAAGGAAGG + Intergenic