ID: 962130387

View in Genome Browser
Species Human (GRCh38)
Location 3:132667140-132667162
Sequence GATACTGATGTTACTACTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962130387 Original CRISPR GATACTGATGTTACTACTTC AGG (reversed) Intronic
903048231 1:20580599-20580621 GATACTAATGTTAATAGTTTAGG - Intergenic
904103505 1:28055171-28055193 GGTGATGATGTTACTTCTTCAGG + Intronic
907176242 1:52525589-52525611 GATTCTGATGATAGTGCTTCAGG - Exonic
907599845 1:55757207-55757229 GATAATGATGCTAATACTTTGGG + Intergenic
909344526 1:74570826-74570848 GACACAGATCTCACTACTTCAGG + Intronic
910191709 1:84601964-84601986 GATACTCATGTTGCTAGTCCAGG - Intergenic
910742849 1:90539958-90539980 GATACTGATTTTAATTCTTTTGG + Intergenic
912727544 1:112071839-112071861 GATACTGCTGTTATTTCTGCTGG - Intergenic
913226011 1:116698950-116698972 GATTCTGATGTGACTGGTTCAGG - Intronic
914876786 1:151518245-151518267 GATACTGATGCTACTGGTCCAGG - Intronic
916589790 1:166179300-166179322 GATATTGTTGTTACTATTTTAGG + Intergenic
918475314 1:184918149-184918171 GATTCTGAGGTTTCTACTGCAGG - Intronic
918928321 1:190816913-190816935 GATACTGATGTACCTACAGCTGG - Intergenic
920144511 1:203847300-203847322 AAAACTGATGATTCTACTTCAGG + Exonic
921820461 1:219610882-219610904 AAAACTGATGATTCTACTTCAGG - Intergenic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
923346098 1:233053998-233054020 GATATTGATTTTAATCCTTCTGG - Intronic
923638770 1:235729004-235729026 GATGCTGATGCTACTAATTCAGG + Intronic
924197109 1:241619707-241619729 CAGACTGATGTTACTTCTTAGGG + Intronic
1062991567 10:1824499-1824521 GATAACGGTGTTACTACTTGGGG - Intergenic
1063740666 10:8815478-8815500 CATACTGATTTCACTTCTTCTGG + Intergenic
1068591151 10:58854554-58854576 GATGCAGATGCTACTAGTTCCGG - Intergenic
1068722433 10:60260964-60260986 GTTAGTGATGATACTACATCAGG + Intronic
1069767496 10:70874030-70874052 GATACTGATGCTACTGCTCCAGG + Intronic
1072177647 10:92944537-92944559 GATACTGATTTTAATTCTTTTGG + Intronic
1072879974 10:99217176-99217198 GATACTAATGTTACTACTTATGG - Intronic
1073792324 10:106953057-106953079 TATACTGGTGTGACTACTTCAGG - Intronic
1075950543 10:126473896-126473918 GATGCTGATGCTACTGCTCCAGG + Intronic
1076449175 10:130544455-130544477 GACACTGATGTCACTCCTTCAGG + Intergenic
1079902062 11:26199066-26199088 GATAGTTATCTTACTATTTCTGG + Intergenic
1083065539 11:59919945-59919967 GATGCTGATTTTACTACTGATGG + Intergenic
1083097310 11:60264860-60264882 GATACTGATGCTACTACTCTGGG + Intergenic
1087217181 11:95506725-95506747 GATGCTGCTGTTACTGCTTCTGG + Intergenic
1094000929 12:25693281-25693303 GATGCTGATGGTACTTGTTCAGG + Intergenic
1096754423 12:53786808-53786830 GATACTAATGATACTAATTGAGG + Intergenic
1098028968 12:66235147-66235169 GCTACTGTTGTTATTACTGCTGG + Intronic
1099724940 12:86413465-86413487 GATACTCATGTTACTAAATTAGG + Intronic
1101800032 12:108013662-108013684 GATGCTGATGCTACTGATTCAGG + Intergenic
1102387799 12:112524959-112524981 GAAAGTGATGTTTCTACTTTGGG + Intergenic
1103009041 12:117443662-117443684 GACAATGTTATTACTACTTCAGG - Intronic
1106128281 13:26919406-26919428 GATTCTGATGTTAATAGCTCAGG - Intergenic
1106238646 13:27888588-27888610 GATATTGATATTGCTACTTTTGG - Intergenic
1106363856 13:29058846-29058868 GATTCTGCTGTTAATACTTCTGG + Intronic
1107710720 13:43147816-43147838 GATACTTATGTTTGTACTTAGGG + Intergenic
1108039997 13:46331107-46331129 GATCCTGATCTTAGAACTTCCGG + Intergenic
1108452337 13:50579721-50579743 GAGCCTGATGTCACTACATCGGG - Intronic
1109889327 13:68587704-68587726 GATACTGATTTTAATTCTTTTGG + Intergenic
1111748765 13:92300468-92300490 GACACTGATGTTGCTATTTCAGG + Intronic
1112714946 13:102173485-102173507 GATACTGATTTCAGTACCTCTGG - Intronic
1116683623 14:48010157-48010179 GCTACTGTTGTTATTATTTCAGG - Intergenic
1118424075 14:65638874-65638896 GTTACAGATATTACCACTTCTGG - Intronic
1118780024 14:69001746-69001768 AATACTGATTTTACTACTATGGG - Intergenic
1120864273 14:89282468-89282490 GATTCTGATCTTACTGTTTCGGG + Intronic
1121247284 14:92471160-92471182 GATACTGATGCTAGAGCTTCAGG - Intronic
1124485226 15:30108525-30108547 CATTTTGATATTACTACTTCTGG + Intergenic
1124518352 15:30388747-30388769 CATTTTGATATTACTACTTCTGG - Intronic
1124540301 15:30577502-30577524 CATTTTGATATTACTACTTCTGG + Intergenic
1124758352 15:32430078-32430100 CATTTTGATATTACTACTTCTGG - Intergenic
1125072261 15:35569227-35569249 GATAATGATTTAACTACTTTTGG + Intergenic
1125259214 15:37802782-37802804 GATACTGCTGCTGCTACTCCAGG - Intergenic
1126213121 15:46122334-46122356 GATACTGATCTTACTTCATTTGG + Intergenic
1126328763 15:47509768-47509790 GATGTTGATGTTCCTAGTTCAGG - Intronic
1127405742 15:58643904-58643926 GAAACTGATGTTACGGATTCCGG + Exonic
1128921804 15:71617659-71617681 AATACAGATGTTATTACCTCTGG + Intronic
1130368481 15:83262659-83262681 GATGCTGATGTTACTATTCTGGG - Intronic
1130368487 15:83262752-83262774 GATGCTGATGTTACTATTCTGGG - Intronic
1130548448 15:84873381-84873403 GATACTGTTATTACTATTTTAGG - Exonic
1131423313 15:92325668-92325690 GGTACTCATGCTACTACTTATGG - Intergenic
1131490337 15:92857163-92857185 CATCCTGATCTTTCTACTTCTGG + Intergenic
1132188416 15:99826084-99826106 GGTAGTCATGTTACTGCTTCAGG + Intergenic
1135669831 16:24365747-24365769 GATATTAATATTACCACTTCTGG + Intergenic
1138237334 16:55395748-55395770 GATACTGATGTTGCTGGTCCAGG - Intronic
1141117297 16:81320174-81320196 GATACTGATGAAACTACTTAAGG + Intronic
1144048941 17:11480831-11480853 GAACCTAATGGTACTACTTCTGG + Intronic
1149078884 17:52630557-52630579 TATTCTGCTGTTAATACTTCTGG - Intergenic
1151082694 17:71346658-71346680 CATACTGTTGGTCCTACTTCTGG - Intergenic
1157670172 18:49521543-49521565 GATACTGATTTCACTTCATCTGG - Intergenic
1157936656 18:51881041-51881063 GATACTGATGCTGCTGGTTCAGG - Intergenic
1158225249 18:55194524-55194546 GATGCTGATGTTGCTGATTCAGG - Intergenic
1159424755 18:68271080-68271102 GATACTGATATTCCTGGTTCAGG + Intergenic
1159966597 18:74601106-74601128 GACACTGATGTGTCTGCTTCGGG + Intronic
927258816 2:21065327-21065349 GATCCTGATTTTAGTTCTTCTGG - Intergenic
928498566 2:31862707-31862729 GATACTGATGTTGATAGTCCAGG + Intergenic
929250262 2:39746324-39746346 GATACTGATGCTACTGCTATGGG - Intronic
929483751 2:42337208-42337230 AAAAGTGATGTTGCTACTTCTGG + Intronic
930687039 2:54320715-54320737 GAGGCTTATGTTACTTCTTCTGG - Intergenic
932035991 2:68247369-68247391 GATACTGATGCTGCTAGTCCAGG + Intronic
932554015 2:72802813-72802835 GATGCTCATGTTACTGGTTCAGG - Intronic
933373340 2:81445957-81445979 GATACTGATGTTATTGATCCTGG - Intergenic
933993707 2:87652104-87652126 GAGACTGATGGCACTACTTTGGG - Intergenic
936300155 2:111298779-111298801 GAGACTGATGGCACTACTTTGGG + Intergenic
941016834 2:160367320-160367342 GCTACTGTTGTTATTACTGCTGG + Exonic
941316472 2:163999368-163999390 GATGCTGATGTTGCTAGTCCAGG + Intergenic
941448268 2:165628419-165628441 AATACTGATGTTTTTATTTCAGG - Intronic
941838427 2:170052354-170052376 GATACTGATTTTACTTCCTTAGG - Intronic
942778924 2:179617669-179617691 GGTACTGATGCTGCTAGTTCAGG + Intronic
944155142 2:196599852-196599874 GATAGCCATGTGACTACTTCTGG + Intergenic
945485992 2:210396268-210396290 GATGCTGATGATGCTGCTTCAGG + Intergenic
946618826 2:221539120-221539142 GCTACTGCTGCTACTACTCCTGG - Intronic
1168964250 20:1889572-1889594 GATACTGACGCTACTGATTCAGG - Intergenic
1169271908 20:4206788-4206810 GATTCTGAGTTTACTTCTTCTGG + Intergenic
1169674604 20:8139510-8139532 GATATCCATGTGACTACTTCAGG - Intronic
1169786433 20:9364213-9364235 TATTCTGATGTTATGACTTCAGG + Intronic
1172522503 20:35577107-35577129 GAGACTGAGGTGACTACTTGAGG + Intergenic
1172699601 20:36845113-36845135 GATGCTGATGTTACTGGTCCAGG - Intronic
1173378380 20:42511578-42511600 GAATCTGATGCTATTACTTCTGG + Intronic
1178524510 21:33315523-33315545 GTTACTGTTTTTCCTACTTCAGG - Intergenic
1179945283 21:44669919-44669941 GGTTCTGCTGTTTCTACTTCAGG - Intronic
949630116 3:5916998-5917020 AATACTGAAGAGACTACTTCAGG - Intergenic
953155294 3:40365715-40365737 GACACTTATGTTAATACGTCAGG + Intergenic
956650311 3:71498856-71498878 GATACTGATGCTACTGATCCGGG + Intronic
957220244 3:77373358-77373380 GATACAAATGTTATTACTTCTGG + Intronic
957816747 3:85310268-85310290 GATACTGATGATAAAATTTCAGG + Intronic
959172354 3:102858820-102858842 GATACAGATGATACTATTCCAGG + Intergenic
959265393 3:104131261-104131283 GATACTGGTGCTAGTACTTTAGG + Intergenic
960743424 3:120859662-120859684 GATGCTGATGTTGCTAGTTGGGG - Intergenic
960842746 3:121977061-121977083 GATATTGATGTTGCTAATCCAGG + Intergenic
962130387 3:132667140-132667162 GATACTGATGTTACTACTTCAGG - Intronic
964587404 3:158322100-158322122 AATACTGAAGTAAGTACTTCAGG - Intronic
964603583 3:158532138-158532160 GTTACTTATGTTACTATTCCAGG - Intronic
964934527 3:162065905-162065927 AATACTGATGATACTATTTTTGG - Intergenic
966483965 3:180446978-180447000 GATGCTGAAGTTACTTCTACTGG - Intergenic
967701328 3:192595645-192595667 GATGCTGATGTTGCTAGTGCAGG + Intronic
967778153 3:193406043-193406065 GATTCTGATGAGACTAGTTCAGG - Intronic
969403315 4:6971664-6971686 GATGCTGATGTGACTACTCCGGG - Intronic
969973689 4:11074682-11074704 GATGCTGATGTTTCTGCTCCAGG - Intergenic
970809366 4:20073652-20073674 GCTACTGATGCTGCTACTCCAGG - Intergenic
978643742 4:110903355-110903377 CAAACTGATGTTACTTCATCTGG - Intergenic
980856298 4:138444544-138444566 AATGCTGTTTTTACTACTTCTGG - Intergenic
981083943 4:140663547-140663569 GATACTGATTTCACTTCTTTTGG - Intronic
981277679 4:142920923-142920945 GATGCTGATGTTGCTCATTCTGG - Intergenic
981718886 4:147779155-147779177 GATGCTGATGTTGCTGGTTCAGG + Intronic
982063066 4:151624212-151624234 GATACTAAAGTTTGTACTTCGGG + Intronic
983997002 4:174194562-174194584 GTTAATGAAGTTACTAGTTCAGG + Intergenic
984073896 4:175151052-175151074 GATACTGATTTTAGAATTTCTGG + Intergenic
987144815 5:14981965-14981987 TATGCTGATTTTACTTCTTCAGG - Intergenic
989223233 5:38993798-38993820 GATGCTGAATTTTCTACTTCTGG - Intronic
990517482 5:56543865-56543887 GATGCTGATGTTACTGGTCCTGG - Intronic
993758203 5:91758536-91758558 GATCCTGATTTTAATACTTTTGG + Intergenic
994079559 5:95692203-95692225 TATTCTGATGTTATTATTTCAGG - Intronic
994978706 5:106844330-106844352 CATACTGATGTTATTTCTCCAGG - Intergenic
995488139 5:112659678-112659700 GATTCTGCTGTTAATACTTGTGG - Intergenic
997060437 5:130495022-130495044 TATACTGATTTTATTTCTTCTGG - Intergenic
998223272 5:140305587-140305609 AATACTGATTATACTACTTAAGG + Intergenic
1000875788 5:166636597-166636619 GATATTTATGTAACAACTTCTGG + Intergenic
1001840287 5:174870469-174870491 GACTCTGATATTTCTACTTCAGG + Intergenic
1002966987 6:1976678-1976700 TATACTGGTATTAATACTTCTGG + Intronic
1003989190 6:11469083-11469105 GATGCTGATGTTGCTGCTTCTGG + Intergenic
1008854572 6:56066737-56066759 GAGACCTATTTTACTACTTCAGG - Intronic
1009565177 6:65303680-65303702 AAAACTGATGATTCTACTTCAGG + Intronic
1009704023 6:67221263-67221285 TATTCTGCTGTTAATACTTCTGG - Intergenic
1010372520 6:75127642-75127664 GATACTGATGTAACTATGTGAGG - Intronic
1012324418 6:97897641-97897663 GATATTTTTGTTACTACTTTGGG + Intergenic
1017200689 6:151751351-151751373 TATTTTAATGTTACTACTTCTGG + Intronic
1019798468 7:3070055-3070077 GATACTGATTTTTGGACTTCTGG - Intergenic
1021244489 7:18245088-18245110 CATACTGATGTGACTTCTCCTGG + Intronic
1021759398 7:23888799-23888821 AATATTCATGTTACTAGTTCAGG - Intergenic
1022898652 7:34779370-34779392 TATTCTGATGCTAGTACTTCAGG + Intronic
1022970228 7:35510412-35510434 GATTCTGATGCTGCTGCTTCAGG + Intergenic
1023145316 7:37145187-37145209 GATACAGATGTTGCTAGTTGAGG + Intronic
1024566438 7:50685334-50685356 GAAACTGTTTTTACTACTTCTGG + Intronic
1025941205 7:66077167-66077189 AATACTGATATTTCTACTTTGGG + Intronic
1027645174 7:80788528-80788550 GATACTGATATTACTGGTCCAGG + Intronic
1028284895 7:88983446-88983468 GATGCTGATGCTACTAGTTTGGG + Intronic
1028594861 7:92537734-92537756 TAGACTTCTGTTACTACTTCTGG + Intronic
1031757125 7:125659072-125659094 AATACTGATTTTATTACCTCGGG + Intergenic
1035117215 7:156534502-156534524 AATAAAGAAGTTACTACTTCTGG + Intergenic
1036099703 8:5765835-5765857 AATGCAGATGTTATTACTTCTGG + Intergenic
1036714921 8:11112456-11112478 AATACTGATGTTTTTACTTTTGG - Intronic
1037245690 8:16832070-16832092 CATACTGATGGTTCTATTTCAGG - Intergenic
1037723808 8:21466949-21466971 GCTACTAATGTTACCTCTTCTGG - Intergenic
1040917860 8:52582243-52582265 TATACTCTTGTGACTACTTCAGG + Intergenic
1043486870 8:80706418-80706440 CATAATGATGATACTATTTCAGG - Intronic
1043738499 8:83776451-83776473 GATTCTGCTGTTAATACTTGTGG - Intergenic
1045880844 8:107038155-107038177 GATGGTGATGTTAATACATCAGG + Intergenic
1053027066 9:34738880-34738902 GATACTGATGTTTTAACCTCTGG - Intergenic
1053329070 9:37187593-37187615 GATATTATTGTTTCTACTTCGGG + Intronic
1054967250 9:71043660-71043682 GATGCTGATGTTGCTAGTCCAGG - Intronic
1057063385 9:92026008-92026030 GGTAGTGATGTTACCTCTTCAGG + Intergenic
1057102006 9:92370423-92370445 AATACGGCTGTTACTCCTTCTGG + Intronic
1057420851 9:94911007-94911029 GATACTGTCATTACTACTTAAGG + Intronic
1059081536 9:111255435-111255457 GATTCTGATTTTACCAATTCAGG + Intergenic
1059367109 9:113794844-113794866 AATACTGATGTTGCTGGTTCAGG + Intergenic
1059393357 9:114014831-114014853 GATACTGATGTTGCTGGTCCAGG + Intronic
1059887216 9:118759441-118759463 GATACTCCTGTTACTAATTCTGG + Intergenic
1186596633 X:10988695-10988717 GATACTGATGCTGCTGGTTCTGG - Intergenic
1187952616 X:24485696-24485718 GACACTGATGGAACTATTTCAGG + Intronic
1190398435 X:50007981-50008003 GATACTGATGCTACTGGTCCAGG - Intronic
1195604799 X:106793188-106793210 GATACTGATTCTACTAGTCCAGG + Intronic
1195682151 X:107555409-107555431 GATGCTGATGCTACCACTCCAGG - Intronic
1195834282 X:109095316-109095338 GATTCTGCTGTTAATACTTGTGG + Intergenic
1196227766 X:113187098-113187120 TATTCTGCTGTTACTACTTGTGG + Intergenic
1196335425 X:114526607-114526629 GATACTAATGTTAATTCTTTTGG - Intergenic
1196968782 X:121086485-121086507 GCTATTTATGTTAGTACTTCAGG + Intergenic
1197464903 X:126791742-126791764 GATAATGATATTATTACTTTTGG - Intergenic
1197465016 X:126793327-126793349 GATAATGATGTTATTTCTTTTGG + Intergenic
1197654861 X:129106032-129106054 GATACTGATGTTAATGCTGCTGG + Intergenic
1197804706 X:130387520-130387542 GATACTGCTGTTACTTGCTCAGG + Intergenic