ID: 962134803

View in Genome Browser
Species Human (GRCh38)
Location 3:132722376-132722398
Sequence CAGTCCTGCTGGTACTCACT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 243}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962134803_962134822 29 Left 962134803 3:132722376-132722398 CCTAGTGAGTACCAGCAGGACTG 0: 1
1: 0
2: 2
3: 18
4: 243
Right 962134822 3:132722428-132722450 GCAGAGGAACGGAACGGGACGGG 0: 2
1: 1
2: 1
3: 10
4: 199
962134803_962134815 6 Left 962134803 3:132722376-132722398 CCTAGTGAGTACCAGCAGGACTG 0: 1
1: 0
2: 2
3: 18
4: 243
Right 962134815 3:132722405-132722427 GGAACGGAACGGGACGGGGTGGG 0: 1
1: 2
2: 3
3: 25
4: 337
962134803_962134816 7 Left 962134803 3:132722376-132722398 CCTAGTGAGTACCAGCAGGACTG 0: 1
1: 0
2: 2
3: 18
4: 243
Right 962134816 3:132722406-132722428 GAACGGAACGGGACGGGGTGGGG 0: 1
1: 1
2: 2
3: 15
4: 186
962134803_962134818 18 Left 962134803 3:132722376-132722398 CCTAGTGAGTACCAGCAGGACTG 0: 1
1: 0
2: 2
3: 18
4: 243
Right 962134818 3:132722417-132722439 GACGGGGTGGGGCAGAGGAACGG 0: 1
1: 1
2: 7
3: 99
4: 908
962134803_962134811 0 Left 962134803 3:132722376-132722398 CCTAGTGAGTACCAGCAGGACTG 0: 1
1: 0
2: 2
3: 18
4: 243
Right 962134811 3:132722399-132722421 GGCAGCGGAACGGAACGGGACGG 0: 1
1: 2
2: 0
3: 15
4: 446
962134803_962134821 28 Left 962134803 3:132722376-132722398 CCTAGTGAGTACCAGCAGGACTG 0: 1
1: 0
2: 2
3: 18
4: 243
Right 962134821 3:132722427-132722449 GGCAGAGGAACGGAACGGGACGG 0: 2
1: 1
2: 1
3: 48
4: 630
962134803_962134808 -10 Left 962134803 3:132722376-132722398 CCTAGTGAGTACCAGCAGGACTG 0: 1
1: 0
2: 2
3: 18
4: 243
Right 962134808 3:132722389-132722411 AGCAGGACTGGGCAGCGGAACGG 0: 1
1: 1
2: 6
3: 27
4: 351
962134803_962134809 -5 Left 962134803 3:132722376-132722398 CCTAGTGAGTACCAGCAGGACTG 0: 1
1: 0
2: 2
3: 18
4: 243
Right 962134809 3:132722394-132722416 GACTGGGCAGCGGAACGGAACGG 0: 1
1: 0
2: 0
3: 11
4: 141
962134803_962134813 2 Left 962134803 3:132722376-132722398 CCTAGTGAGTACCAGCAGGACTG 0: 1
1: 0
2: 2
3: 18
4: 243
Right 962134813 3:132722401-132722423 CAGCGGAACGGAACGGGACGGGG 0: 1
1: 2
2: 1
3: 4
4: 56
962134803_962134823 30 Left 962134803 3:132722376-132722398 CCTAGTGAGTACCAGCAGGACTG 0: 1
1: 0
2: 2
3: 18
4: 243
Right 962134823 3:132722429-132722451 CAGAGGAACGGAACGGGACGGGG 0: 2
1: 1
2: 0
3: 9
4: 134
962134803_962134814 5 Left 962134803 3:132722376-132722398 CCTAGTGAGTACCAGCAGGACTG 0: 1
1: 0
2: 2
3: 18
4: 243
Right 962134814 3:132722404-132722426 CGGAACGGAACGGGACGGGGTGG 0: 1
1: 3
2: 10
3: 85
4: 312
962134803_962134817 13 Left 962134803 3:132722376-132722398 CCTAGTGAGTACCAGCAGGACTG 0: 1
1: 0
2: 2
3: 18
4: 243
Right 962134817 3:132722412-132722434 AACGGGACGGGGTGGGGCAGAGG 0: 1
1: 1
2: 3
3: 61
4: 632
962134803_962134820 24 Left 962134803 3:132722376-132722398 CCTAGTGAGTACCAGCAGGACTG 0: 1
1: 0
2: 2
3: 18
4: 243
Right 962134820 3:132722423-132722445 GTGGGGCAGAGGAACGGAACGGG 0: 1
1: 1
2: 2
3: 30
4: 312
962134803_962134819 23 Left 962134803 3:132722376-132722398 CCTAGTGAGTACCAGCAGGACTG 0: 1
1: 0
2: 2
3: 18
4: 243
Right 962134819 3:132722422-132722444 GGTGGGGCAGAGGAACGGAACGG 0: 1
1: 1
2: 2
3: 58
4: 646
962134803_962134810 -4 Left 962134803 3:132722376-132722398 CCTAGTGAGTACCAGCAGGACTG 0: 1
1: 0
2: 2
3: 18
4: 243
Right 962134810 3:132722395-132722417 ACTGGGCAGCGGAACGGAACGGG 0: 1
1: 0
2: 0
3: 4
4: 75
962134803_962134812 1 Left 962134803 3:132722376-132722398 CCTAGTGAGTACCAGCAGGACTG 0: 1
1: 0
2: 2
3: 18
4: 243
Right 962134812 3:132722400-132722422 GCAGCGGAACGGAACGGGACGGG 0: 1
1: 2
2: 1
3: 9
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962134803 Original CRISPR CAGTCCTGCTGGTACTCACT AGG (reversed) Exonic
901399677 1:9007291-9007313 GAGGCGTGCAGGTACTCACTGGG + Exonic
902800496 1:18826635-18826657 CAGTCGTGGTGGTGGTCACTGGG - Intergenic
903067919 1:20711188-20711210 CGGTTCTGCGGGTACTCAGTGGG + Intronic
903914444 1:26753333-26753355 AACTCATGCTGGCACTCACTAGG + Intronic
904300140 1:29548980-29549002 CCCTCCTCCTGGTTCTCACTAGG + Intergenic
904300149 1:29549014-29549036 CCTTCCTCCTGGTCCTCACTGGG + Intergenic
904300159 1:29549048-29549070 CCCTCCTCCTGGTTCTCACTGGG + Intergenic
904448968 1:30598827-30598849 CAGTCCTGATGCTGCTTACTTGG - Intergenic
907383186 1:54108479-54108501 CATTCTTGCTGGTCCTCACATGG - Intronic
911429445 1:97765630-97765652 CAGTCCTGCAGGTCTACACTGGG - Intronic
916483779 1:165238692-165238714 CAGTGCTCCAGGTACTCAGTAGG - Intronic
921837185 1:219790380-219790402 CTGTGCTGCTGGGACTCTCTTGG + Intronic
1063594896 10:7425506-7425528 CAGTCCTAATGGAATTCACTGGG - Intergenic
1068120086 10:52775909-52775931 TATTCCTGATGGTCCTCACTTGG - Intergenic
1069026692 10:63550175-63550197 CAGTCCTGGTGGTTCTCCCTTGG - Intronic
1070923479 10:80203688-80203710 CAGCCCTTCTGGCACTGACTCGG - Intronic
1073583166 10:104685869-104685891 CAGTTCTACTGGGTCTCACTAGG - Intronic
1075227767 10:120645021-120645043 CAGTCCTGCTATCACTCCCTAGG - Intergenic
1075851889 10:125595675-125595697 CTGTTCTGCTGATACTCACATGG + Intronic
1076695726 10:132246428-132246450 CAGCCCTGCTGGCACTCACTGGG + Intronic
1076924774 10:133476925-133476947 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076924781 10:133476965-133476987 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076924791 10:133477045-133477067 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076924796 10:133477085-133477107 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076924801 10:133477125-133477147 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076924811 10:133477205-133477227 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076924816 10:133477245-133477267 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076924827 10:133477323-133477345 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076924832 10:133477363-133477385 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076924839 10:133477403-133477425 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076924848 10:133477483-133477505 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076924858 10:133477561-133477583 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076924863 10:133477601-133477623 CTGTCCTGCTGACACTCTCTGGG - Intergenic
1076924868 10:133477641-133477663 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076924875 10:133477681-133477703 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076924880 10:133477721-133477743 CTGTCCTGCTGACACTCTCTGGG - Intergenic
1076924891 10:133477799-133477821 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076924896 10:133477839-133477861 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076924903 10:133477879-133477901 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076924910 10:133477919-133477941 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076924915 10:133477959-133477981 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076924920 10:133477999-133478021 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076924925 10:133478039-133478061 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076924936 10:133478117-133478139 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076924941 10:133478157-133478179 CTGTCCTGCTGACACTCTCTGGG - Intergenic
1076924946 10:133478197-133478219 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076924953 10:133478237-133478259 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076924958 10:133478277-133478299 CTGTCCTGCTGACACTCTCTGGG - Intergenic
1076924963 10:133478317-133478339 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076924968 10:133478357-133478379 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076924980 10:133478437-133478459 CTGTCCTGCTGACACTCTCTGGG - Intergenic
1076924987 10:133478477-133478499 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076924994 10:133478517-133478539 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925001 10:133478557-133478579 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925013 10:133478637-133478659 CTGTCCTGCTGACACTCTCTGGG - Intergenic
1076925020 10:133478677-133478699 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925027 10:133478717-133478739 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925034 10:133478757-133478779 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925046 10:133478837-133478859 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925051 10:133478877-133478899 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925056 10:133478917-133478939 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925061 10:133478957-133478979 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925066 10:133478997-133479019 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925071 10:133479037-133479059 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925076 10:133479077-133479099 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925083 10:133479117-133479139 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925090 10:133479157-133479179 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925097 10:133479197-133479219 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925102 10:133479237-133479259 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925107 10:133479277-133479299 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925118 10:133479355-133479377 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925123 10:133479395-133479417 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925128 10:133479435-133479457 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925133 10:133479475-133479497 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925144 10:133479553-133479575 CTGTCCTGCTGACACTCTCTGGG - Intergenic
1076925149 10:133479593-133479615 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925156 10:133479633-133479655 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925161 10:133479673-133479695 CTGTCCTGCTGACACTCTCTGGG - Intergenic
1076925172 10:133479751-133479773 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925177 10:133479791-133479813 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925184 10:133479831-133479853 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925191 10:133479871-133479893 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925196 10:133479911-133479933 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925207 10:133479989-133480011 CTGTCCTGCTGACACTCTCTGGG - Intergenic
1076925212 10:133480029-133480051 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925219 10:133480069-133480091 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925224 10:133480109-133480131 CTGTCCTGCTGACACTCTCTGGG - Intergenic
1076925229 10:133480149-133480171 CTGTCCTGCTGACACTCTCTGGG - Intergenic
1076925236 10:133480189-133480211 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925241 10:133480229-133480251 CTGTCCTGCTGACACTCTCTGGG - Intergenic
1076925246 10:133480269-133480291 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925251 10:133480309-133480331 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925263 10:133480389-133480411 CTGTCCTGCTGACACTCTCTGGG - Intergenic
1076925270 10:133480429-133480451 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925277 10:133480469-133480491 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925284 10:133480509-133480531 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925296 10:133480589-133480611 CTGTCCTGCTGACACTCTCTGGG - Intergenic
1076925303 10:133480629-133480651 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925310 10:133480669-133480691 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925317 10:133480709-133480731 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925328 10:133480789-133480811 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925333 10:133480829-133480851 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925338 10:133480869-133480891 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925345 10:133480909-133480931 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925352 10:133480949-133480971 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925357 10:133480989-133481011 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925368 10:133481069-133481091 CTGTCCTGCTGAGACTCTCTGGG - Intergenic
1076925373 10:133481109-133481131 CCGTCCTGCTGAGACTCTCTGGG - Intergenic
1078618307 11:12884878-12884900 CTGTCCTGCTGGTTCTTTCTGGG + Intronic
1080252913 11:30255906-30255928 CAATTATGCTGGTATTCACTTGG - Intergenic
1082946823 11:58770318-58770340 CAATCATGCAGGAACTCACTGGG - Intergenic
1082947687 11:58777049-58777071 CAGTCGTGCAGGAACTCGCTGGG - Intergenic
1085304521 11:75477566-75477588 CAGGCTTGCTGGGGCTCACTGGG + Intronic
1085461305 11:76695530-76695552 AAGACCTGCTGGAGCTCACTGGG - Intergenic
1088408274 11:109504876-109504898 AAATCCTGCTGGAACTCTCTGGG + Intergenic
1088915828 11:114227113-114227135 CAGTCCTGCTGGAGTCCACTGGG - Intronic
1088992229 11:114963647-114963669 AAGTCCTCCTGTTACTCAGTAGG - Intergenic
1094207940 12:27860303-27860325 CAGTCCTGCTCTTACCCACAGGG - Intergenic
1099707305 12:86172436-86172458 CAGGTCTTCTGGTAGTCACTGGG + Intronic
1100487129 12:95041031-95041053 CAGGCTTGCTGGTACCAACTGGG + Intronic
1102402734 12:112644351-112644373 CAGTCCTGCTGGGGAACACTGGG + Intronic
1102855922 12:116293382-116293404 CAGGCCTACTGGTAGTAACTAGG - Intergenic
1103446651 12:120999398-120999420 CAGGCCTGCTGGCCCTCCCTTGG + Intronic
1103992750 12:124810162-124810184 GAGGCCTGCCGGTAATCACTGGG - Exonic
1104593279 12:130101701-130101723 CAGCCCTGCTGATACCCCCTAGG + Intergenic
1105443482 13:20434140-20434162 CATTTCTCCTGGTACTGACTTGG - Intronic
1107996380 13:45865236-45865258 GAGTCCTGCTGGTGCCCAGTTGG + Intergenic
1111431249 13:88150715-88150737 CAGTCCTGGTGGTACTGGTTGGG + Intergenic
1112102318 13:96202737-96202759 CAATCCTGCTGAGATTCACTGGG + Intronic
1116054707 14:39848999-39849021 CAGTACTGCTGGGCCACACTTGG - Intergenic
1117337328 14:54766557-54766579 GAGTCCTGGTGGTACAGACTCGG + Intronic
1117649551 14:57888971-57888993 CAGTCCTCATGCTAGTCACTGGG + Intronic
1119769833 14:77213593-77213615 CAGTTCTGCTGGTGGTCATTGGG - Intronic
1119975049 14:79015973-79015995 CAGTCCTGTTCCTACACACTGGG - Intronic
1121727439 14:96163021-96163043 GAGTTCTCTTGGTACTCACTGGG - Intergenic
1123025880 14:105423682-105423704 CCGTGCTGCTGGTCTTCACTGGG + Intronic
1123404144 15:20010401-20010423 GGCTCCTCCTGGTACTCACTAGG - Intergenic
1123513482 15:21017047-21017069 GGCTCCTCCTGGTACTCACTAGG - Intergenic
1125316518 15:38438164-38438186 CAGTCATGCAGGAACTCACTGGG + Intergenic
1126351055 15:47745198-47745220 CAGGCTTCCTGGTACTCACCTGG + Intronic
1128314412 15:66651276-66651298 CAGTCATGGTGACACTCACTTGG - Intronic
1128551109 15:68598564-68598586 CAGGCATGCTGGTGCTCACCAGG - Intronic
1132662553 16:1068133-1068155 CAGTCCCGCAGGAAGTCACTGGG - Intergenic
1136244510 16:28966219-28966241 AAGTCCAGCTGGTACACACCGGG + Exonic
1138216609 16:55210359-55210381 CACCCCTGCTGGTACTTCCTGGG - Intergenic
1138577041 16:57914693-57914715 CATTCCTTCTGGCACTCACTGGG - Intronic
1141935067 16:87232921-87232943 TAGTCCTTCTTGTGCTCACTGGG - Intronic
1143019630 17:3910486-3910508 CAGTCCTTCTGGTCCTCCCTCGG + Intronic
1143811070 17:9472328-9472350 GAGTACTGCTAGTATTCACTTGG + Intronic
1143922304 17:10340131-10340153 AAGATCTGCTGGTACTCACCAGG + Exonic
1144388886 17:14775344-14775366 CTGTGCTGCTGGTCCACACTGGG - Intergenic
1146057466 17:29588667-29588689 CAGGCCTGCTGGTGGTGACTGGG - Intronic
1146197545 17:30825841-30825863 CTGTCCTGCTGGTCATCTCTTGG - Intergenic
1148816222 17:50329960-50329982 CAGTACTCCTGGGACCCACTGGG + Intergenic
1151570948 17:74925054-74925076 CGGTCCTCCTGGTCCTCCCTAGG - Intronic
1155740926 18:29286725-29286747 CAGTCCTGTACGTACTCTCTTGG + Intergenic
1156549388 18:37999633-37999655 GAGTCCAACAGGTACTCACTGGG - Intergenic
1158388495 18:57022105-57022127 CAGTGCTGTGGATACTCACTGGG - Intronic
1160015265 18:75135327-75135349 CGGGCCTGCTGGTATGCACTTGG - Intergenic
1161285866 19:3468086-3468108 AAGTCCTGCTGGTACTGCTTTGG - Intronic
1161569659 19:5023578-5023600 GAGGCCGGCTGGGACTCACTGGG + Intronic
1163120438 19:15214054-15214076 CACTCCTGCTGGTTCTCACTAGG - Intergenic
1165428811 19:35759988-35760010 CAGGGCTGCTGGTACTTACTTGG - Exonic
1165839410 19:38778935-38778957 GTGTCCTGCTGGCCCTCACTGGG - Intergenic
1166157943 19:40929057-40929079 CAGCCATGCAGGAACTCACTGGG + Intergenic
1166431639 19:42732808-42732830 CACTGCGGCTGGCACTCACTGGG + Exonic
1166434754 19:42758026-42758048 CACTGCGGCTGGCACTCACTGGG + Exonic
1166444627 19:42848047-42848069 CACTGCGGCTGGCACTCACTGGG + Intronic
1166447610 19:42871791-42871813 CACTGCGGCTGGCACTCACTGGG + Exonic
1166452065 19:42910604-42910626 CACTGCGGCTGGCACTCACTGGG + Exonic
1166454520 19:42929466-42929488 CACTGCGGCTGGCACTCACTGGG + Exonic
1166484071 19:43198021-43198043 CACTGCGGCTGGCACTCACTGGG + Exonic
1167062353 19:47157558-47157580 CAGTTCTGATGGTGCCCACTGGG + Intronic
926564722 2:14456472-14456494 CACTCCTGGTGGTACTGATTGGG - Intergenic
928993241 2:37257841-37257863 AAGTGTTGCTGTTACTCACTGGG - Intronic
929055388 2:37872409-37872431 CAGTCCTGCCGGGATCCACTGGG + Intergenic
931821099 2:65953247-65953269 TAGGCCTGCTGGTATGCACTGGG - Intergenic
932844805 2:75124132-75124154 CAGTCCTGATGGCCCTCAGTGGG - Intronic
933987482 2:87603973-87603995 CAGTCCTGGCGTGACTCACTGGG + Intergenic
934683304 2:96301953-96301975 CACTCCAGGTGGTAGTCACTTGG + Intronic
936306357 2:111346835-111346857 CAGTCCTGGCGTGACTCACTGGG - Intergenic
937544931 2:123005026-123005048 CAGTCCTGCGGGTAAACAGTCGG - Intergenic
938097943 2:128475509-128475531 CAGGCCTCCTGGTACACAGTTGG + Intergenic
938119537 2:128623901-128623923 CGGTCCTGCTGGTCCTAACGTGG + Intergenic
941929110 2:170923592-170923614 CAGTCCTGCTGCCACACTCTGGG + Intergenic
945548426 2:211187896-211187918 GAGTCCTCCTTGTAGTCACTTGG - Intergenic
947670901 2:231934749-231934771 CAGGACTGCTGGGACTCACCTGG + Intergenic
948800263 2:240430242-240430264 CTGGCCTGCTGGTCCTCTCTGGG - Intergenic
948922950 2:241074332-241074354 CAGTCCTCCTGGTGCTCACAGGG - Intronic
949079630 2:242086487-242086509 GTGTCCTGCTGTTACTCTCTGGG + Intergenic
1170571991 20:17637721-17637743 CCGTGCTCCTGGTACTCTCTGGG + Intronic
1172667602 20:36611471-36611493 GAGTCCTGCTGGGACTCAACAGG - Intronic
1173162141 20:40661014-40661036 GTGTCCAGCTGGGACTCACTGGG + Intergenic
1173257870 20:41407706-41407728 CAGTCCAGCTGCTGCTCATTTGG - Intronic
1173795174 20:45854951-45854973 CACACCTGCTGGGACTCACTGGG - Intronic
1173857738 20:46261664-46261686 CAGTGCCGCTGGGACTCAGTGGG - Intronic
1174373613 20:50111356-50111378 CAGCCCTGCTTGCAGTCACTCGG - Intronic
1178803139 21:35815836-35815858 AAGTACTGCAGGTACTAACTGGG + Intronic
1178818643 21:35954795-35954817 CAGTCCTTCTGGTACTGGCTGGG - Intronic
1182147144 22:28003498-28003520 CAGGCCTGCAGGTCCTCCCTGGG + Intronic
1182442766 22:30373806-30373828 CAGGCCTGCAGGCACTCAGTTGG - Intronic
950640495 3:14345320-14345342 CAGTCCTGCTGCAAGTCTCTTGG - Intergenic
950693893 3:14683027-14683049 CAGTGCTGCTGGCAACCACTGGG + Exonic
952293035 3:32036854-32036876 CATTCCTGATGATACTCACTCGG + Intronic
954782507 3:53071900-53071922 CAGCCCTGCTGCCCCTCACTGGG - Intronic
957914541 3:86671379-86671401 CACTTCTGCTGGTGCTAACTGGG - Intergenic
958985421 3:100775264-100775286 CAGGCCTACTGGAACTCCCTTGG - Exonic
960760561 3:121070317-121070339 CAGCCATGCAGGAACTCACTGGG + Intronic
960761778 3:121079359-121079381 CAGCCATGCAGGAACTCACTGGG + Intronic
962134803 3:132722376-132722398 CAGTCCTGCTGGTACTCACTAGG - Exonic
962463901 3:135639308-135639330 CATCCCTGCTGGTACTCCCCTGG + Intergenic
963110434 3:141683709-141683731 CAGCCCTGCTGGGAGTCTCTAGG + Intergenic
967038261 3:185664549-185664571 CTGTCCTGCTGAATCTCACTAGG - Intronic
972481592 4:39502229-39502251 CAGTCATGTTGTTACTCACTAGG + Intronic
975406465 4:73996256-73996278 TAGTCCTGGTGGGACACACTGGG - Exonic
975865862 4:78723090-78723112 CAGGCCCTGTGGTACTCACTGGG - Intergenic
976155915 4:82144703-82144725 CAGTCCTGCTGGGGATCTCTGGG - Intergenic
981633973 4:146854075-146854097 CAGTCCTGCTGGGACGCTCTAGG - Intronic
982173203 4:152681489-152681511 AAGACCTGCTGGTACTGAGTTGG + Intergenic
983898957 4:173113035-173113057 CAGTCCTGTTCCTCCTCACTGGG + Intergenic
984787020 4:183576626-183576648 AAGTCCTGCAGCTTCTCACTAGG + Intergenic
989384952 5:40845898-40845920 CAGTTCTGCTGGTCTTCCCTGGG + Intronic
990997066 5:61743579-61743601 CCCTCCTGATGGTACTCACTTGG - Intronic
991992885 5:72358722-72358744 CATTCCTGATGGTGCTTACTGGG - Exonic
995498282 5:112772912-112772934 AGGTCCTGCAGGTCCTCACTAGG + Intronic
996923034 5:128790859-128790881 CATTCCTGCTACTACTCACTTGG + Intronic
998982009 5:147714624-147714646 GATTCTTGCTGGTATTCACTGGG - Intronic
998986662 5:147765428-147765450 CAGCCCTGCTGGTCTTCACTTGG + Intronic
999721638 5:154402914-154402936 CAGTCCTCATGTGACTCACTGGG + Intronic
1000313247 5:160064670-160064692 GAGTCCTGCTGGCTCTCTCTGGG - Intronic
1000698854 5:164422568-164422590 CAATCCTGCTACTCCTCACTGGG - Intergenic
1005928742 6:30465335-30465357 CTGTCCTGCAGGTCCTCACAAGG + Intergenic
1007478811 6:42136731-42136753 CAGGCCTGCTGGGACTTGCTGGG - Intronic
1015811098 6:137163085-137163107 CAGTCATGCAGGAACTCACTGGG - Intronic
1015812037 6:137170454-137170476 CAGTCATGCAGGAACTCACTGGG - Intronic
1020491794 7:8794836-8794858 CATTTCTGCTTTTACTCACTTGG + Intergenic
1020894661 7:13924964-13924986 CACTCCTGCTGCTACTCATGAGG - Intronic
1023073567 7:36461251-36461273 CCATCCTGCTTGTACTCCCTCGG - Intergenic
1028619520 7:92809586-92809608 CAGTCCTGCTATAACTCATTTGG - Intronic
1029674980 7:102062344-102062366 CAGCCGTGCTGGCACTCACATGG + Intronic
1030673798 7:112364635-112364657 CAGGCCTGCTGTTACACAATGGG - Intergenic
1035812488 8:2504372-2504394 CAGTCCCGCCAGTGCTCACTGGG + Intergenic
1037704987 8:21310902-21310924 CAGTCCGGCTGGAAGTCAGTGGG + Intergenic
1037705233 8:21311902-21311924 CAGTCCGGCTGGGAGTCAGTGGG + Intergenic
1037705623 8:21313451-21313473 CAGTCCGGCTGGGAGTCAGTGGG + Intergenic
1037705817 8:21314294-21314316 CAGTCCAGCTGGGAGTCAGTGGG + Intergenic
1039574405 8:38611807-38611829 CAGTCCACCTGGTACTCGGTTGG - Intergenic
1041706325 8:60850072-60850094 CAGTCCTGCAGGAACTCGCATGG - Intronic
1041781798 8:61585234-61585256 CAGTCCTGCTGGTGCACAACTGG + Intronic
1041800501 8:61792717-61792739 AAGTCCTGCATGTTCTCACTCGG + Intergenic
1041972162 8:63756164-63756186 CTGTCCTGATGGTATTTACTAGG + Intergenic
1044158881 8:88887697-88887719 GCCTCCTGCTGCTACTCACTTGG - Intergenic
1046401797 8:113714005-113714027 CAGACCTACTGTTACTCAATAGG - Intergenic
1049350002 8:142159351-142159373 CAGTCCTGCTGGGGCTGAGTGGG - Intergenic
1052993124 9:34533816-34533838 CAGTCTTTCTGGTACTCAGAAGG + Intergenic
1055283562 9:74702889-74702911 GAGTTCTGCAGGTGCTCACTGGG + Intergenic
1059284067 9:113157783-113157805 CAGTCCTGCTGGTAAGAATTGGG + Exonic
1061608639 9:131730854-131730876 CTGTCCTGCTGGAGCTCACAGGG - Intronic
1061778840 9:132984212-132984234 CAGTCCTCCTCCTGCTCACTGGG + Intronic
1188722427 X:33539578-33539600 CAATCCTGCTGGTATTCTCTGGG - Intergenic
1193325365 X:80173505-80173527 CAGTCGTGCAGGAACTCACTCGG + Intergenic
1194594025 X:95836100-95836122 CAATCCTGCTCCTCCTCACTGGG - Intergenic
1195823254 X:108970060-108970082 CACCCCTGCTGGTGTTCACTAGG - Intergenic
1201372151 Y:13277657-13277679 AAATTCTGCTGGTACCCACTGGG + Intronic