ID: 962137783

View in Genome Browser
Species Human (GRCh38)
Location 3:132755823-132755845
Sequence AAGAGGGACCAGAAGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962137781_962137783 -10 Left 962137781 3:132755810-132755832 CCTAGTCATGTGTAAGAGGGACC No data
Right 962137783 3:132755823-132755845 AAGAGGGACCAGAAGCAGGAAGG No data
962137778_962137783 8 Left 962137778 3:132755792-132755814 CCATGTTTTAAATTTATTCCTAG No data
Right 962137783 3:132755823-132755845 AAGAGGGACCAGAAGCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962137783 Original CRISPR AAGAGGGACCAGAAGCAGGA AGG Intergenic
No off target data available for this crispr