ID: 962146686

View in Genome Browser
Species Human (GRCh38)
Location 3:132847029-132847051
Sequence ATGTCCTTGTAGAGGTATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962146686_962146691 11 Left 962146686 3:132847029-132847051 CCATCATACCTCTACAAGGACAT No data
Right 962146691 3:132847063-132847085 CTGCCTGTCTAACCTTGGACTGG No data
962146686_962146690 6 Left 962146686 3:132847029-132847051 CCATCATACCTCTACAAGGACAT No data
Right 962146690 3:132847058-132847080 AGCAACTGCCTGTCTAACCTTGG 0: 5
1: 40
2: 62
3: 87
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962146686 Original CRISPR ATGTCCTTGTAGAGGTATGA TGG (reversed) Intergenic
No off target data available for this crispr