ID: 962152138

View in Genome Browser
Species Human (GRCh38)
Location 3:132904213-132904235
Sequence ATTCTTGGGTGATCCTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962152138_962152144 5 Left 962152138 3:132904213-132904235 CCCCAGGAGGATCACCCAAGAAT No data
Right 962152144 3:132904241-132904263 AATCTACCCTATGAGAGAGAAGG No data
962152138_962152148 18 Left 962152138 3:132904213-132904235 CCCCAGGAGGATCACCCAAGAAT No data
Right 962152148 3:132904254-132904276 AGAGAGAAGGCATTTAGGTCAGG No data
962152138_962152147 13 Left 962152138 3:132904213-132904235 CCCCAGGAGGATCACCCAAGAAT No data
Right 962152147 3:132904249-132904271 CTATGAGAGAGAAGGCATTTAGG No data
962152138_962152149 19 Left 962152138 3:132904213-132904235 CCCCAGGAGGATCACCCAAGAAT No data
Right 962152149 3:132904255-132904277 GAGAGAAGGCATTTAGGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962152138 Original CRISPR ATTCTTGGGTGATCCTCCTG GGG (reversed) Intergenic
No off target data available for this crispr