ID: 962152143

View in Genome Browser
Species Human (GRCh38)
Location 3:132904236-132904258
Sequence TCTCTCATAGGGTAGATTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962152143_962152147 -10 Left 962152143 3:132904236-132904258 CCACAAATCTACCCTATGAGAGA No data
Right 962152147 3:132904249-132904271 CTATGAGAGAGAAGGCATTTAGG No data
962152143_962152148 -5 Left 962152143 3:132904236-132904258 CCACAAATCTACCCTATGAGAGA No data
Right 962152148 3:132904254-132904276 AGAGAGAAGGCATTTAGGTCAGG No data
962152143_962152149 -4 Left 962152143 3:132904236-132904258 CCACAAATCTACCCTATGAGAGA No data
Right 962152149 3:132904255-132904277 GAGAGAAGGCATTTAGGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962152143 Original CRISPR TCTCTCATAGGGTAGATTTG TGG (reversed) Intergenic
No off target data available for this crispr