ID: 962152144

View in Genome Browser
Species Human (GRCh38)
Location 3:132904241-132904263
Sequence AATCTACCCTATGAGAGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962152139_962152144 4 Left 962152139 3:132904214-132904236 CCCAGGAGGATCACCCAAGAATC No data
Right 962152144 3:132904241-132904263 AATCTACCCTATGAGAGAGAAGG No data
962152140_962152144 3 Left 962152140 3:132904215-132904237 CCAGGAGGATCACCCAAGAATCC No data
Right 962152144 3:132904241-132904263 AATCTACCCTATGAGAGAGAAGG No data
962152141_962152144 -9 Left 962152141 3:132904227-132904249 CCCAAGAATCCACAAATCTACCC No data
Right 962152144 3:132904241-132904263 AATCTACCCTATGAGAGAGAAGG No data
962152142_962152144 -10 Left 962152142 3:132904228-132904250 CCAAGAATCCACAAATCTACCCT No data
Right 962152144 3:132904241-132904263 AATCTACCCTATGAGAGAGAAGG No data
962152138_962152144 5 Left 962152138 3:132904213-132904235 CCCCAGGAGGATCACCCAAGAAT No data
Right 962152144 3:132904241-132904263 AATCTACCCTATGAGAGAGAAGG No data
962152135_962152144 21 Left 962152135 3:132904197-132904219 CCAGTCAGTCGATGATCCCCAGG No data
Right 962152144 3:132904241-132904263 AATCTACCCTATGAGAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962152144 Original CRISPR AATCTACCCTATGAGAGAGA AGG Intergenic
No off target data available for this crispr