ID: 962152149

View in Genome Browser
Species Human (GRCh38)
Location 3:132904255-132904277
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962152140_962152149 17 Left 962152140 3:132904215-132904237 CCAGGAGGATCACCCAAGAATCC No data
Right 962152149 3:132904255-132904277 GAGAGAAGGCATTTAGGTCAGGG No data
962152143_962152149 -4 Left 962152143 3:132904236-132904258 CCACAAATCTACCCTATGAGAGA No data
Right 962152149 3:132904255-132904277 GAGAGAAGGCATTTAGGTCAGGG No data
962152142_962152149 4 Left 962152142 3:132904228-132904250 CCAAGAATCCACAAATCTACCCT No data
Right 962152149 3:132904255-132904277 GAGAGAAGGCATTTAGGTCAGGG No data
962152141_962152149 5 Left 962152141 3:132904227-132904249 CCCAAGAATCCACAAATCTACCC No data
Right 962152149 3:132904255-132904277 GAGAGAAGGCATTTAGGTCAGGG No data
962152138_962152149 19 Left 962152138 3:132904213-132904235 CCCCAGGAGGATCACCCAAGAAT No data
Right 962152149 3:132904255-132904277 GAGAGAAGGCATTTAGGTCAGGG No data
962152139_962152149 18 Left 962152139 3:132904214-132904236 CCCAGGAGGATCACCCAAGAATC No data
Right 962152149 3:132904255-132904277 GAGAGAAGGCATTTAGGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type