ID: 962152573

View in Genome Browser
Species Human (GRCh38)
Location 3:132908372-132908394
Sequence GAAGTGTTCCACATCTTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962152573_962152580 22 Left 962152573 3:132908372-132908394 CCAATAAAGATGTGGAACACTTC No data
Right 962152580 3:132908417-132908439 CATTTGAGGTTAGAGTTTAAGGG No data
962152573_962152579 21 Left 962152573 3:132908372-132908394 CCAATAAAGATGTGGAACACTTC No data
Right 962152579 3:132908416-132908438 TCATTTGAGGTTAGAGTTTAAGG No data
962152573_962152577 8 Left 962152573 3:132908372-132908394 CCAATAAAGATGTGGAACACTTC No data
Right 962152577 3:132908403-132908425 CCCAAAATTGCTGTCATTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962152573 Original CRISPR GAAGTGTTCCACATCTTTAT TGG (reversed) Intergenic
No off target data available for this crispr