ID: 962167594

View in Genome Browser
Species Human (GRCh38)
Location 3:133065800-133065822
Sequence TTTTCAAGGCTTAAAATGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 237}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962167588_962167594 10 Left 962167588 3:133065767-133065789 CCAGTATGTGCCTATTTCTACAT 0: 1
1: 0
2: 1
3: 20
4: 242
Right 962167594 3:133065800-133065822 TTTTCAAGGCTTAAAATGGGTGG 0: 1
1: 0
2: 1
3: 17
4: 237
962167589_962167594 0 Left 962167589 3:133065777-133065799 CCTATTTCTACATAGTTCAGCCA 0: 1
1: 0
2: 1
3: 20
4: 177
Right 962167594 3:133065800-133065822 TTTTCAAGGCTTAAAATGGGTGG 0: 1
1: 0
2: 1
3: 17
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962167594 Original CRISPR TTTTCAAGGCTTAAAATGGG TGG Intronic
901725271 1:11236851-11236873 TTTTTAAGACTTAAAATGGCAGG + Intronic
901861443 1:12077230-12077252 GTTTCAAGGATTAGAATGTGTGG - Intronic
902789138 1:18753553-18753575 TTTTCATGCATTAAGATGGGTGG - Intergenic
904083347 1:27885977-27885999 TTTTAGAGGCTTAAAATGGTTGG - Exonic
904254972 1:29249089-29249111 GTTTCAAGTATTCAAATGGGAGG - Intronic
904923451 1:34027337-34027359 GTTTCATGGATTAAAATGGGTGG - Intronic
904963677 1:34355011-34355033 TTTGCAAGGCTGAAGAGGGGTGG + Intergenic
907752152 1:57272977-57272999 TTTGCAAGGGCTGAAATGGGGGG - Intronic
907845901 1:58206414-58206436 TTTTTAAGGAATAGAATGGGAGG + Intronic
910568948 1:88678917-88678939 TTTTCCAGGCAAAAAAAGGGTGG - Intergenic
910603579 1:89057908-89057930 TTTTCAATGCTGAAACTAGGTGG + Intronic
910783891 1:90972770-90972792 TTATGCAGACTTAAAATGGGAGG + Intronic
911728203 1:101264693-101264715 TTTTCTAGGCTCAAAATGGATGG - Intergenic
911785420 1:101940386-101940408 TTTTCAAAGCTCAAAAAGAGAGG - Intronic
913011665 1:114689447-114689469 TTTCCCATTCTTAAAATGGGGGG + Intronic
913295703 1:117317728-117317750 TTTTAAATGGTTAAAATGGCTGG + Intergenic
914956941 1:152171454-152171476 TTTTCAAGCCTTAAAAAGATGGG - Intergenic
915247236 1:154565097-154565119 CTTGAAAGGCTTAAAATTGGTGG - Intergenic
916292458 1:163181483-163181505 TTTTCCACTTTTAAAATGGGGGG - Intronic
916328169 1:163586862-163586884 TTTTTAATGCTTAAAAAGGGAGG - Intergenic
917297588 1:173537990-173538012 TTCTCAAGTCTTAAAATTTGAGG + Intronic
919351467 1:196460096-196460118 TGTTCAAGGCATAAATTTGGGGG + Intronic
922007323 1:221544901-221544923 TTTTGCAGGATTAAAATGGATGG + Intergenic
923077598 1:230623878-230623900 TTATCCAGCCTTAAAATGGAAGG - Intergenic
924374388 1:243390299-243390321 TCTTCAAGGCTTGAAATAGATGG + Intronic
924843028 1:247734546-247734568 TTTTAAAGACTTAAAAATGGAGG + Intergenic
1062952707 10:1516622-1516644 TTATTAAGGCATAAAACGGGAGG - Intronic
1065537920 10:26732796-26732818 TTTTAATGGATTAAAATGTGTGG - Intronic
1065737321 10:28765850-28765872 ACTTCAAGGCATAAAGTGGGAGG + Intergenic
1066982778 10:42434742-42434764 TTTTAATGGGTTAAAATGAGAGG - Intergenic
1067371719 10:45690010-45690032 TTTTAATGGGTTAAAATGAGAGG + Intergenic
1067388062 10:45836139-45836161 TTTTAATGGGTTAAAATGAGAGG - Intronic
1067418061 10:46121141-46121163 TTTTAATGGGTTAAAATGAGAGG + Intergenic
1067446205 10:46348465-46348487 TTTTAATGGGTTAAAATGAGAGG + Intergenic
1067503418 10:46827704-46827726 TTTTAATGGGTTAAAATGAGAGG + Intergenic
1067591174 10:47512306-47512328 TTTTAATGGGTTAAAATGAGAGG - Intronic
1067638292 10:48020398-48020420 TTTTAATGGGTTAAAATGAGAGG - Intergenic
1067875201 10:49999960-49999982 TTTTAATGGGTTAAAATGAGAGG + Intronic
1068312954 10:55302576-55302598 TTTTTAAGGCTTCAAGTGGTTGG + Intronic
1068971169 10:62959974-62959996 TTTTGAATGCTTTAAATGGAAGG - Intergenic
1069246940 10:66218304-66218326 TTTTCTAGGTTTAGAATGTGTGG + Intronic
1070134897 10:73684824-73684846 TTTTAATGGGTTAAAATGAGAGG - Intronic
1070212539 10:74340815-74340837 TTTTGAAAGATTAAAATGGCTGG + Intronic
1070468768 10:76755615-76755637 TTATCTAGTCTTAAAAAGGGAGG - Intergenic
1070579803 10:77710828-77710850 TTGACAGGGCTTAAAAAGGGGGG - Intergenic
1073539301 10:104305477-104305499 TTTCCAAGGGTTAAAATGTGAGG + Intergenic
1073547135 10:104360100-104360122 TTGACAAGGAATAAAATGGGTGG - Intronic
1074320376 10:112396561-112396583 TTTTCAAGTCATAAAAGAGGAGG - Intronic
1074632110 10:115269888-115269910 TTTTCAGAACTTAAAATGGAGGG + Intronic
1074724182 10:116290495-116290517 TTATCCAGCCTTAAAAAGGGAGG - Intergenic
1075579361 10:123605224-123605246 CTTTCAAGGCTTAAAGTGTTTGG - Intergenic
1077733054 11:4755655-4755677 CTTTGCAGGCTTAAAATCGGAGG - Intronic
1077738267 11:4815439-4815461 TTTTATAGGAATAAAATGGGAGG + Intronic
1077823873 11:5782768-5782790 TTTTCATGGGATAAAATAGGTGG - Intronic
1078344557 11:10534948-10534970 TTTTCCAGGCAGAAAATGTGAGG - Intronic
1079750993 11:24197058-24197080 TCTTTAAGGCTTAAAATATGTGG - Intergenic
1080226160 11:29963157-29963179 TTTTCATGGCTTAAGATAGAAGG - Intergenic
1085655621 11:78312036-78312058 TTTTCAAGCCTAGACATGGGAGG - Intronic
1086210942 11:84317956-84317978 TTTTCAAGGTTTAAAACTGATGG + Intronic
1086405425 11:86495253-86495275 ATTGCAAGGCTTAAACTGAGTGG + Intronic
1086613895 11:88791186-88791208 TTTTCAAGACTTAAACCAGGAGG + Intronic
1086976169 11:93135568-93135590 GTTTGATGGCTTAAAATGTGAGG - Intergenic
1087065266 11:94021984-94022006 TTTTCAACGTTTAAAAGAGGGGG + Intronic
1087477310 11:98652257-98652279 TTTTCTAGGATTAAAGTGGAAGG + Intergenic
1087698321 11:101406931-101406953 GTTTGAGGGCTTAAAAGGGGAGG + Intergenic
1088151019 11:106745444-106745466 TTTTTATTGTTTAAAATGGGAGG - Intronic
1088622861 11:111704412-111704434 TTTTCAAGGTTTTAAGAGGGTGG + Intronic
1094111952 12:26871282-26871304 TTTTACAGGCTAAAAATGTGAGG - Intergenic
1096306057 12:50477026-50477048 TTTTAAAGGCTTAATTTGGGAGG + Exonic
1098350943 12:69559379-69559401 TTTTCAAGAGTTAAAAAGAGGGG + Intronic
1098793798 12:74863183-74863205 TATTCAAGGCTTAAAATAGCTGG + Intergenic
1099466669 12:82996447-82996469 TTTAAAAGGCTTAAAATTGCAGG + Intronic
1101595633 12:106162390-106162412 TTATCCAGCCTTAAAGTGGGAGG - Intergenic
1101867740 12:108534273-108534295 TTTTCCACTCTTAAAATTGGAGG - Intronic
1102171736 12:110847598-110847620 TTTTTAAGGATTATTATGGGAGG - Intronic
1102392398 12:112559860-112559882 TTTACATGGTTTAAAAGGGGAGG + Intergenic
1102900224 12:116630890-116630912 TTTTCAGAGCTTAAAATGGGAGG - Intergenic
1103050281 12:117773261-117773283 ATTTCAAGTCTTGAAATGGGTGG + Intronic
1105252728 13:18715139-18715161 TCTTCCAGGCTGAAAGTGGGAGG + Intergenic
1105465747 13:20638007-20638029 ATTTCAGGGCTTCAAGTGGGAGG + Intronic
1106461894 13:29978005-29978027 TTTTCAAGGCTCCATATTGGAGG - Intergenic
1109119699 13:58439009-58439031 TTTTCGTGGGTGAAAATGGGCGG + Intergenic
1109416811 13:62051476-62051498 GTTTCTAGGCCTATAATGGGAGG - Intergenic
1109967553 13:69721027-69721049 TTTTCTAGGAATAGAATGGGAGG - Intronic
1110890223 13:80689389-80689411 TTGTTAAGGCATAACATGGGTGG + Intergenic
1110897163 13:80768604-80768626 TCTTGAAGTCTTAAACTGGGGGG + Intergenic
1111846665 13:93517877-93517899 TATTCAATGCTTAAAATCAGTGG + Intronic
1112400437 13:99072888-99072910 CTTGCAAGGCTGAAGATGGGAGG + Intronic
1113341427 13:109429884-109429906 TTCTCAAGTTTTAAGATGGGAGG + Intergenic
1115159900 14:30382029-30382051 TTTTCAAGGCCAAAATTGGGAGG - Intergenic
1115497310 14:34018984-34019006 GATTCAAAGCTCAAAATGGGAGG + Intronic
1116103088 14:40466146-40466168 TTCCCAAGCCTTAAAATGGTTGG + Intergenic
1118579463 14:67279791-67279813 ATTTCAAGGCTTTAAATGTTAGG - Intronic
1119372193 14:74156150-74156172 TTTACCTGGCTTAAAATAGGAGG - Intronic
1120258473 14:82151621-82151643 TTTTAAAGGATTAAAAAGAGTGG - Intergenic
1122080070 14:99260994-99261016 CTTTCAACGCTGAAAGTGGGAGG - Intronic
1122471894 14:101973980-101974002 TTTGTAAGGTGTAAAATGGGTGG - Intronic
1123797123 15:23783280-23783302 TTTTGAATGCTTAAAAGCGGTGG + Intergenic
1124808997 15:32915493-32915515 TTTTCAAAGTATAAAATGGAGGG - Intronic
1125158912 15:36620787-36620809 TTTTAAAGGCTTAATTTTGGGGG + Intronic
1127146752 15:56032831-56032853 ATTTCAAAGGTTAAAATGGGCGG - Intergenic
1128354247 15:66913411-66913433 TTTTAAAGTATAAAAATGGGAGG - Intergenic
1130372004 15:83292990-83293012 ATTTCAAAGCTTCAAATGTGTGG - Intergenic
1131520953 15:93114568-93114590 TTTTAAAGGCTTAGGATGGGTGG + Intergenic
1131867691 15:96729681-96729703 TTTTTAAGGATTTAAATAGGAGG + Intergenic
1132200829 15:99953594-99953616 TTTTCTAGGCCCAAGATGGGTGG + Intergenic
1133078553 16:3299360-3299382 TTTTCAAGGCTTAGAACATGGGG - Exonic
1139448113 16:67011074-67011096 TTATCCAGCCTTAAAATGGAAGG - Intergenic
1139654542 16:68379355-68379377 TTACCAAGGCTTAACATGTGAGG - Intronic
1143294799 17:5862895-5862917 TTTGCATGGCTTAAAATATGAGG + Intronic
1145355112 17:22137238-22137260 TATTTAAGGCTGAAAATGTGAGG + Intergenic
1146076486 17:29735004-29735026 TATTCAAGGTTCAAAATTGGGGG + Intronic
1149230139 17:54523685-54523707 TTTTAATGGCTTAAAATTTGGGG - Intergenic
1149828371 17:59850029-59850051 TTTTTAAGGAATAGAATGGGGGG - Intergenic
1151223935 17:72634710-72634732 TTCTCAGGGCCCAAAATGGGTGG + Intergenic
1153158132 18:2172271-2172293 TTTTAAAGGGTTTAAATGAGTGG - Intergenic
1155286795 18:24297204-24297226 TTTTCCTGGCTTAATCTGGGAGG + Intronic
1155648223 18:28107893-28107915 TTTTAATGGCCTAGAATGGGAGG - Intronic
1156345962 18:36257460-36257482 TTTTAAAGGCTAAAAAAGAGTGG + Intronic
1159431876 18:68362817-68362839 TTTTAAGGGCTTAGAATAGGGGG - Intergenic
1160657896 19:282657-282679 TTTTCCAGCTGTAAAATGGGTGG - Intronic
1165172554 19:33904300-33904322 ATTTCAAGGCATATAATGTGGGG + Intergenic
1165985523 19:39765598-39765620 TTTCCAAGGCTGGAAATGGATGG + Intergenic
1167193854 19:48013214-48013236 TTCTCAGAGCATAAAATGGGGGG - Intronic
1168572883 19:57484741-57484763 TTTTCAAGGCTTGACCTGGGAGG + Intergenic
925598293 2:5580563-5580585 TTTTTCAGCCTTAAAAAGGGTGG + Intergenic
926250137 2:11150742-11150764 TATTCAGGAATTAAAATGGGAGG - Intergenic
927505808 2:23613928-23613950 TTTTTAAGGGATAGAATGGGAGG - Intronic
928148206 2:28802082-28802104 ATTTTAAAGCTTAAAATAGGTGG + Exonic
930327585 2:49939642-49939664 TTTTCCTGGCTGAAAATTGGTGG - Intronic
931524197 2:63134824-63134846 TTTTCAAAGCTCAAGATTGGGGG + Intronic
932354803 2:71059952-71059974 TTTTCCATTTTTAAAATGGGAGG - Intergenic
933948460 2:87308475-87308497 TTCTCAAGGCTGAAAATGTTGGG - Intergenic
934533123 2:95108454-95108476 TTTTCAAGTGTTAAAATGTCAGG + Intronic
936293842 2:111249689-111249711 TTTTCAAGAGTTAAATTGAGGGG - Intergenic
936331739 2:111553120-111553142 TTCTCAAGGCTGAAAATGTTGGG + Intergenic
936712681 2:115150500-115150522 TTTTCAATAATTATAATGGGTGG - Intronic
939901372 2:147854435-147854457 TTTTCAAAGCTTAAAGTAGCTGG - Intronic
941387612 2:164872511-164872533 TTTTTGAGGCTTAAAATGAGTGG + Intergenic
941753083 2:169154142-169154164 TTTTCAAGGTGTACAATGGTAGG + Intronic
942222060 2:173780105-173780127 TTTTGATGTCTTAAATTGGGTGG + Intergenic
942671909 2:178384907-178384929 TTTTTTAGGAATAAAATGGGAGG + Intronic
942749025 2:179267196-179267218 TTTACAAGGCTGCATATGGGGGG - Intergenic
942795967 2:179819509-179819531 GTTTCAAGGCTTGGAAGGGGTGG - Intronic
945850138 2:214995822-214995844 TTTCCAAGGCTTTAAAAAGGGGG + Intronic
946027598 2:216681248-216681270 TTTTTGAGGATTAAAATGCGTGG - Intronic
946505723 2:220298773-220298795 TTTTCAAGGAATAGAATGGGAGG + Intergenic
947766002 2:232637861-232637883 TTTTCAAGGCTTAAAAAAACTGG + Intronic
948206464 2:236165068-236165090 TTTGCCAGGTTTAAAATAGGAGG - Intergenic
948527427 2:238580340-238580362 TTTTGTAGGCTGGAAATGGGTGG - Intergenic
1170294195 20:14806489-14806511 GTTTCAAGCCCTAAACTGGGCGG + Intronic
1170357585 20:15508955-15508977 TTGTAAAAACTTAAAATGGGTGG - Intronic
1176838242 21:13815026-13815048 TCTTCCAGGCTGAAAGTGGGAGG + Intergenic
1177609446 21:23425998-23426020 TTTTCAAGGGATCAAATGGAGGG - Intergenic
1177717374 21:24856309-24856331 TTTTCCAGCATTAAAATTGGAGG - Intergenic
1178372267 21:32036202-32036224 TTGTGAAGGTTCAAAATGGGGGG - Intronic
1183407232 22:37636321-37636343 TTTCAGAGGCTTAAGATGGGAGG - Intronic
1184667719 22:45997414-45997436 TCTTTCAGGCTTAAAATGGCAGG - Intergenic
1184748154 22:46468426-46468448 TTATCCAGCCTTAAAAAGGGAGG + Intronic
950137064 3:10588998-10589020 TTTTAAGGGCATAAACTGGGCGG + Intronic
952107431 3:30086587-30086609 TTATTAAGGAATAAAATGGGAGG - Intergenic
952212337 3:31240870-31240892 CTTTCAAGGCTGAAAATGAAGGG + Intergenic
952752100 3:36832976-36832998 TATTGTAGGCTTAAAATGTGAGG - Exonic
953933513 3:47019831-47019853 TTTTCGAGGCCTAAAAATGGAGG + Exonic
955660503 3:61294019-61294041 TTTTAAAAGCTTAAAATGAAAGG + Intergenic
956723385 3:72137633-72137655 TTTTCAAGTCCTAAATTTGGGGG - Intergenic
956947651 3:74241413-74241435 TTTTTTAAGCTTAAAATGGCAGG - Intergenic
957337961 3:78857143-78857165 TTTTTTAGGCCTCAAATGGGTGG + Intronic
957343702 3:78934679-78934701 TATTCCAAGCTCAAAATGGGGGG + Intronic
958500104 3:94894597-94894619 TTTTACAGGCTTAAAAGTGGAGG + Intergenic
960414472 3:117367570-117367592 TGTTCCAGGCCTAAAATGTGAGG - Intergenic
960912685 3:122665102-122665124 TTTTCAAAAATAAAAATGGGAGG - Intergenic
962147715 3:132857822-132857844 TTATCCAGCCTTAAAAGGGGAGG + Intergenic
962167594 3:133065800-133065822 TTTTCAAGGCTTAAAATGGGTGG + Intronic
962838520 3:139212113-139212135 GATTAAAGGCTTAAAATGTGAGG + Intronic
963337996 3:143999718-143999740 TTTTAAAGGTTTGAAATGGTAGG + Intronic
964491925 3:157246104-157246126 TTTTAAAGCATAAAAATGGGTGG + Intergenic
964698757 3:159539755-159539777 TTTTATTAGCTTAAAATGGGGGG - Intronic
964994041 3:162852274-162852296 TTTGCAAGCCATAAAATGGTTGG - Intergenic
965128374 3:164660230-164660252 TTTTCAATGCTTGAATTTGGGGG + Intergenic
965230479 3:166045104-166045126 GTTTTCAGGCATAAAATGGGAGG - Intergenic
971002405 4:22337911-22337933 TGTTCAAGCCTTGCAATGGGAGG - Intergenic
971592713 4:28488927-28488949 TTGTCAAGGGTTAGAATGGAAGG - Intergenic
971600750 4:28588221-28588243 TTTTCAAGTCTGAAAATGAAGGG - Intergenic
974409124 4:61516535-61516557 TTTTCAAAGCATAAAATGCATGG + Intronic
974902437 4:68017859-68017881 TTTTTTAAGCTTAAAAAGGGTGG + Intergenic
976472961 4:85450913-85450935 TTTTTAAGGCTCAAAAGAGGAGG - Intergenic
977986133 4:103385445-103385467 GTTTCAAGCCTAAAACTGGGTGG + Intergenic
977994416 4:103484785-103484807 GTTTCAAGACTAAAACTGGGTGG + Intergenic
978725081 4:111960037-111960059 TTTTCAAGTATCAAAAGGGGAGG + Intergenic
980241427 4:130181733-130181755 TTTTAAATGTTTAAAATGGAAGG - Intergenic
984537284 4:180992146-180992168 CTTTCAAGGCTTAGAAGTGGGGG - Intergenic
985298690 4:188463659-188463681 TTTTTCAGCCTTAAAATGGAAGG + Intergenic
985925015 5:3009102-3009124 TTATTAAGCCTTAAAAAGGGAGG + Intergenic
987747577 5:21995937-21995959 GATTCAAGACATAAAATGGGTGG - Intronic
991767758 5:70005737-70005759 GATTCAAGACATAAAATGGGCGG - Intergenic
991846992 5:70880813-70880835 GATTCAAGACATAAAATGGGCGG - Intergenic
992604862 5:78445060-78445082 ATTTCAAGGGCTAAGATGGGGGG - Intronic
995896518 5:117018598-117018620 TTTTCATGGTTTAAAAGTGGAGG - Intergenic
995921178 5:117315067-117315089 TTTTCAAGGTTTAAAAAGAGTGG + Intergenic
995933061 5:117474160-117474182 TTTTCAAAACTTAAAATGCATGG - Intergenic
1000469000 5:161615710-161615732 TTCTCAAGGCTTAAAGTGTTTGG - Intronic
1001050094 5:168407102-168407124 TTTTCAAGGAATGAAATGGAGGG + Intronic
1002895150 6:1374757-1374779 CTTTCAAAGCTTAAATTTGGGGG - Intergenic
1003761701 6:9185749-9185771 TTTTAAAGGGTTTAAATGGTTGG - Intergenic
1003809547 6:9764589-9764611 TTTCCAAGGGTTAAAATAGAGGG - Intronic
1004815772 6:19310488-19310510 TTGTCCAGTCTTAAAATGGAAGG + Intergenic
1008198288 6:48553472-48553494 ATTTCAAGGCATAAATTGGTAGG + Intergenic
1008278304 6:49566292-49566314 TTTCCAGGGCTTAAACTGGAAGG - Intergenic
1009718297 6:67428471-67428493 TTTTCAAGGACAAAATTGGGTGG - Intergenic
1010950828 6:82035061-82035083 TGATCAAAGCTTAAGATGGGTGG + Intergenic
1015040605 6:128713604-128713626 TTTTAAAAGCTGAAAATGGTAGG + Intergenic
1017663948 6:156700933-156700955 TTTTTAACGTTTAAAATTGGTGG + Intergenic
1018282379 6:162200539-162200561 TTTTTATGGCTTTAAATGGTTGG - Intronic
1020569223 7:9837418-9837440 TTTTCAAGTCTTGAAGTTGGAGG + Intergenic
1024674634 7:51627026-51627048 TTTGCAATGCTTGACATGGGTGG - Intergenic
1027428633 7:78086876-78086898 TTTGGGAGGCTAAAAATGGGTGG - Intronic
1030234974 7:107248666-107248688 TTTTTAAAGCTTAAAATATGTGG + Intronic
1031075242 7:117206062-117206084 TTGGCCAGGCTTAAAATGGCTGG - Intronic
1031337276 7:120551209-120551231 TTTTATATGCTTAAAATGGTGGG - Intronic
1031820177 7:126490858-126490880 TTTCCAATTTTTAAAATGGGAGG - Intronic
1032413558 7:131718787-131718809 TTTTCCAGGATAAAAATAGGTGG + Intergenic
1032607425 7:133370626-133370648 TTTTTAAGGACTAGAATGGGAGG + Intronic
1033174429 7:139111628-139111650 TTTTCATGGCTTCAAATTGGAGG - Intergenic
1033830338 7:145243748-145243770 TTTTTAAGGCTTTAAATGCTAGG + Intergenic
1033866375 7:145695387-145695409 TTTAGAAGCCTTAAAATGTGTGG + Intergenic
1033936422 7:146591377-146591399 ATTTAAAGGGTCAAAATGGGTGG + Intronic
1035030925 7:155859114-155859136 TATTGAAGACTTAAAATGTGAGG - Intergenic
1036218617 8:6901914-6901936 TTATCTAGGAATAAAATGGGAGG + Intergenic
1038170023 8:25122669-25122691 TATTCAAGGCTTCAAATGATTGG - Intergenic
1039728357 8:40247541-40247563 TGTTCAAGGCAAAAAAGGGGTGG - Intergenic
1041346381 8:56902574-56902596 TTTTATGGGCTCAAAATGGGGGG + Intergenic
1041986885 8:63932251-63932273 TTTTCAAGCCTTGAAGAGGGAGG - Intergenic
1042540110 8:69899520-69899542 TTTTCTAAGTTTCAAATGGGAGG - Intergenic
1042935511 8:74054268-74054290 TTTGGAAGGCTTAAGGTGGGAGG - Intergenic
1044472231 8:92583500-92583522 TCTCCAAGGCTTTAAATGGAAGG - Intergenic
1045207045 8:100053995-100054017 TTTTCAAGCCTTAAATTTGAAGG + Intronic
1045834385 8:106503367-106503389 TTTTCAAGGCTTTATTTGGTGGG - Intronic
1047985705 8:130231165-130231187 TTTTTAAGGCAAAAAATGTGTGG - Intronic
1049608802 8:143542608-143542630 TTTTTCAGCCTTAAAATGGAAGG + Intergenic
1056078411 9:83063870-83063892 TTTAAAAGGATCAAAATGGGTGG - Intergenic
1056315261 9:85382370-85382392 TCTTCAAGGCTTGTAATGTGAGG + Intergenic
1058449625 9:105083974-105083996 TTTTTAAGGAATAGAATGGGAGG + Intergenic
1059051850 9:110935021-110935043 TTTTCAAGGTTTAATTAGGGAGG + Intronic
1059378888 9:113907996-113908018 GTCTCAAGACTTAAATTGGGAGG + Intronic
1186596818 X:10990688-10990710 ATTTCAGGGCTTGAAGTGGGAGG - Intergenic
1188280272 X:28259551-28259573 TTTTCATGCCTTAAATTGAGAGG + Intergenic
1191648852 X:63513956-63513978 TTTTGAAGGCAAAAAATGGCAGG - Intergenic
1193269747 X:79515390-79515412 TTTTCAAACCTTAAACTGGTTGG + Intergenic
1194810008 X:98377515-98377537 TTATCAAGGCTTTGAATGGAAGG - Intergenic
1196128471 X:112125750-112125772 TTTTTAATTCTTTAAATGGGGGG - Intergenic
1197812273 X:130455768-130455790 TTTTAAAGGTTTTAAATGGCAGG + Intergenic
1198628253 X:138603740-138603762 TTTTCAAGGCATGAAATAGTAGG + Intergenic
1199837717 X:151609403-151609425 TTTTCAAAGCTGGAAATGGATGG - Intronic
1201646380 Y:16237037-16237059 TGTTTCAGGCATAAAATGGGTGG - Intergenic
1201656433 Y:16348280-16348302 TGTTTCAGGCATAAAATGGGTGG + Intergenic