ID: 962167853

View in Genome Browser
Species Human (GRCh38)
Location 3:133068917-133068939
Sequence TGTGAGGCTCAATATAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 205}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962167845_962167853 11 Left 962167845 3:133068883-133068905 CCAGAAGCCATCAGGAAAGGCTT 0: 1
1: 0
2: 6
3: 46
4: 266
Right 962167853 3:133068917-133068939 TGTGAGGCTCAATATAGACAGGG 0: 1
1: 0
2: 0
3: 7
4: 205
962167848_962167853 4 Left 962167848 3:133068890-133068912 CCATCAGGAAAGGCTTCCTGGGG 0: 1
1: 0
2: 6
3: 71
4: 564
Right 962167853 3:133068917-133068939 TGTGAGGCTCAATATAGACAGGG 0: 1
1: 0
2: 0
3: 7
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962167853 Original CRISPR TGTGAGGCTCAATATAGACA GGG Intronic
900432290 1:2608020-2608042 TGAGAGGCTGAATATACAAACGG - Intronic
902478176 1:16698958-16698980 AGAGAGGCTCAGGATAGACAGGG + Intergenic
902899595 1:19505480-19505502 TGTGAGGCTGAACAAAGACCTGG + Intergenic
904034722 1:27552363-27552385 TGAGGGGCTCACTATACACATGG - Intronic
904341173 1:29835828-29835850 TGTGAGGCTCAAAATTGTTATGG + Intergenic
904353974 1:29926684-29926706 TGAGAGGCTCAGAATGGACATGG + Intergenic
906044216 1:42815946-42815968 TATGTGGCTCAATATTGGCAGGG + Intronic
907327786 1:53652174-53652196 TGAGAGGCTCATTACATACAGGG - Intronic
909409435 1:75332051-75332073 TGTGATGAGCAATATAGATAAGG - Intronic
917597433 1:176543418-176543440 TGTGGGGCTCAATATTGAGAAGG - Intronic
923042409 1:230328631-230328653 TGTGATGTTCAAGATCGACATGG + Intronic
924604565 1:245521704-245521726 TGTAGTGCTCACTATAGACAAGG + Intronic
1062808882 10:447319-447341 TGTGATCCTGAATATCGACAGGG - Intronic
1062808938 10:447617-447639 TGTGATCCTGAGTATAGACAGGG - Intronic
1062808992 10:447917-447939 TGTGATCCTGAGTATAGACAGGG - Intronic
1062809056 10:448267-448289 TGTGATCCTGAGTATAGACAGGG - Intronic
1062809131 10:448668-448690 TGTGATCCTGAATATCGACAGGG - Intronic
1064095200 10:12419041-12419063 TGTGAGGTCCAAAAGAGACAGGG - Intronic
1064269203 10:13849833-13849855 TATGAGGGTGAATATAAACATGG + Intronic
1067471253 10:46540332-46540354 TGTGTGGCTCAGTGTGGACATGG - Intergenic
1070751630 10:78967355-78967377 TGTGAGTCTCTATTTAGAGATGG - Intergenic
1072892489 10:99336606-99336628 AGTGAAGCTCTATAGAGACAAGG - Intronic
1073743795 10:106442338-106442360 TGTTTGGCTTAATATAGATATGG - Intergenic
1073887609 10:108058134-108058156 TGGGATGCTCAATAAAGGCAGGG + Intergenic
1073979550 10:109139261-109139283 TGTGAGGCTGATTAGAGAGAAGG - Intergenic
1078317257 11:10304162-10304184 TGTGAAGCTCAAAGTAGACTGGG + Intergenic
1078970419 11:16403958-16403980 TGTTATTCTCAATATAGACTGGG - Intronic
1081493992 11:43588015-43588037 TGAAAGGCTCAAAACAGACATGG + Intronic
1087455763 11:98384028-98384050 TGAGAGGCTGAAGATAGATAGGG - Intergenic
1091391952 12:131174-131196 TGAGAGGCTCATTAGAGAGACGG + Intronic
1093607490 12:21110487-21110509 TGTGAGGTTCTTTATAAACATGG + Intronic
1099854889 12:88151327-88151349 TGTGAATCTCAATATAGGGATGG - Intronic
1099874252 12:88384590-88384612 TGTGAGGAACTACATAGACAAGG + Intergenic
1101786703 12:107890342-107890364 TGTGAGACTAGATATAAACAGGG - Intergenic
1108626290 13:52231653-52231675 TTTGAGGGGCAATATAGAAAAGG + Intergenic
1108659776 13:52574829-52574851 TTTGAGGGGCAATATAGAAAAGG - Intergenic
1109435924 13:62302641-62302663 AGTGAGGCTGAATAAAGGCATGG + Intergenic
1110090184 13:71435161-71435183 TGTGATTCTCAATGTAGAAAGGG - Intergenic
1111930975 13:94512938-94512960 TGGGAGGCTGAATATACAGAAGG + Intergenic
1112354253 13:98660998-98661020 TGAGAGGCTGAATATACAGATGG - Intergenic
1119579431 14:75763733-75763755 TATGAGGCCCAGTCTAGACAAGG - Intronic
1120731788 14:88011474-88011496 TGTGCGGCACAATAAAGCCACGG + Exonic
1125697113 15:41648167-41648189 AGTGATGCACAAAATAGACATGG + Intronic
1129500521 15:76032947-76032969 TGATAGGTTCAATATAGTCATGG - Intronic
1131439018 15:92444672-92444694 TGTGGGGCTCAAGACAGACCTGG + Exonic
1139485475 16:67254133-67254155 TATTAGTCTCAATTTAGACATGG + Intronic
1144117685 17:12115474-12115496 TGTGTGTCTAAATATAGAAAAGG + Intronic
1144298166 17:13899071-13899093 TGTGTGGTTCAATGTAGAGAAGG - Intergenic
1145051347 17:19664186-19664208 TGTGGGGCTCAGTAAAGACTGGG + Intronic
1145984475 17:29035998-29036020 TGTGAGGCACAAGAAAGACATGG + Intronic
1146060504 17:29603246-29603268 TATGAGGCTCCATAGAGACAGGG + Intronic
1147786967 17:42985755-42985777 TTTGAGACTCAAGAAAGACAAGG + Intronic
1147897431 17:43759851-43759873 TGTGTGGCTCATTATATGCAGGG - Intergenic
1155824081 18:30417090-30417112 TGTGATGCTTAATATTCACAGGG - Intergenic
1156005416 18:32435145-32435167 TGTCAAGATCAATAAAGACAAGG + Intronic
1157481478 18:48057823-48057845 TGTGAGGCTCAAGGGAGAAATGG + Intronic
1158080225 18:53581522-53581544 TCAGATGCCCAATATAGACATGG - Intergenic
1159811616 18:73024208-73024230 TGAGAGGCTCAGAATGGACAAGG + Intergenic
1160056099 18:75482398-75482420 TTGGAGGCTCAATGTGGACAAGG + Intergenic
1160505219 18:79423063-79423085 TGTGAGGCTCACGAGATACAGGG + Intronic
1162108926 19:8389857-8389879 AGTGAGTCCCAATATAGAGATGG + Intronic
1163507407 19:17716351-17716373 GTTGAGGTTTAATATAGACATGG - Intergenic
1167982442 19:53286273-53286295 TGTGAGGCTGGATATAGGGATGG + Intergenic
1167983708 19:53297757-53297779 TGTGAGGCTGGATATAGGGATGG - Intergenic
1202712197 1_KI270714v1_random:24786-24808 AGAGAGGCTCAGGATAGACAGGG + Intergenic
928753066 2:34493805-34493827 TGGGAGGATCAATTGAGACAGGG - Intergenic
929819937 2:45264847-45264869 TGTGAACCTCAATATATAAAGGG - Intergenic
929863604 2:45699570-45699592 TGTGTGGGTCACTGTAGACATGG + Intronic
934725644 2:96616626-96616648 TGTGAATCTAAATATAGTCATGG + Intronic
938257811 2:129873737-129873759 AGTGAGGCTGAATGTAGGCAGGG - Intergenic
943464017 2:188206270-188206292 TTTCAGGCTCAATATAGTAATGG - Intergenic
944758324 2:202786995-202787017 TCTGAGGCCCAATGTAGACAGGG + Intronic
1179369328 21:40790042-40790064 TTTGAGGCTCAGTACAGAAACGG + Intronic
1182781970 22:32875351-32875373 TGTGAGGCTGAAACGAGACAAGG - Intronic
1183028273 22:35082720-35082742 TGTGAGACACAATATATCCAGGG + Intronic
1183130526 22:35830665-35830687 TGTGTGTCTAAATATAGAAAAGG + Intronic
1183317679 22:37145893-37145915 TGAGAGGCTCAAGAGAGAGAAGG - Intronic
1183839411 22:40485683-40485705 TGTGGGTCTCAATGAAGACATGG + Intronic
1183954807 22:41373061-41373083 TGTGAGGGTCCTTACAGACAGGG - Intronic
1184258621 22:43301737-43301759 TGTGATGCTCAAAACAGACAGGG - Intronic
949766982 3:7537424-7537446 TGTGTGGCTTGAGATAGACAGGG + Intronic
950227245 3:11245791-11245813 TGGGAGGATCAATTGAGACAGGG - Intronic
952235603 3:31476358-31476380 AGTGAGGCTCCATCCAGACATGG + Intergenic
953896971 3:46810467-46810489 TATGAGGCCCAATGTTGACATGG + Intronic
954655806 3:52193478-52193500 TGTGAGCATCAAGGTAGACAAGG + Intergenic
958441499 3:94161692-94161714 TGGGAGGCTTACTATAGACGGGG - Intergenic
958833099 3:99113424-99113446 TGGGAGGCTCAAAATAAAAATGG - Intergenic
959411156 3:106023699-106023721 TGTGAGGCTCAAATCAGATAAGG + Intergenic
959903273 3:111683633-111683655 AGTGATGATCAATACAGACATGG + Intronic
960369145 3:116811855-116811877 TTTCAGGCTAAATATACACATGG + Intronic
962167853 3:133068917-133068939 TGTGAGGCTCAATATAGACAGGG + Intronic
962301304 3:134245550-134245572 TGTGAGGCTTAGCCTAGACAAGG + Intronic
963049204 3:141127330-141127352 GGTGAGGCTCATTTTAGCCATGG - Intronic
963744647 3:149114181-149114203 TGTGTGTGTCAATATAGTCATGG - Intergenic
966426598 3:179786648-179786670 TGTGTATCTCAATATATACAAGG + Exonic
971760436 4:30758193-30758215 TGAGATGCTCAATATTCACATGG - Intronic
972569529 4:40297772-40297794 GGTGGTGCTCAAGATAGACATGG - Intergenic
973001794 4:44961183-44961205 TGTGGGGGTCAAGATGGACAGGG + Intergenic
975190644 4:71457038-71457060 TGTCAGGCTACAAATAGACATGG + Intronic
978520271 4:109608578-109608600 TGGGAGGATCAATTTAGTCAGGG - Intronic
981002947 4:139845300-139845322 AGGGAGGCTCAATGTGGACATGG + Intronic
982402141 4:154979952-154979974 TGTGAGGGGCAATATTGACTTGG - Intergenic
986786610 5:11120387-11120409 GGTGAGGCTCAGTATACATACGG + Intronic
989127503 5:38071151-38071173 TAGGAGGCTGAACATAGACATGG + Intergenic
989779337 5:45245615-45245637 TGTTAGGGTCAATATTGACCTGG - Intergenic
989881791 5:46798991-46799013 TGTGAGGCTTAACATGGAAACGG + Intergenic
989881918 5:46801548-46801570 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989882134 5:46805806-46805828 TGTGAGGCTTAACATGGAAACGG + Intergenic
989882262 5:46808362-46808384 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989882705 5:46817054-46817076 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989882972 5:46822337-46822359 TGTGAGGCTTAACATGGAAACGG + Intergenic
989883192 5:46826596-46826618 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989883485 5:46832225-46832247 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989883785 5:46838195-46838217 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989884052 5:46843480-46843502 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989884311 5:46848761-46848783 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989884577 5:46854045-46854067 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989884857 5:46859500-46859522 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989885118 5:46864612-46864634 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989885329 5:46868702-46868724 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989885606 5:46874157-46874179 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989885887 5:46879611-46879633 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989886164 5:46885067-46885089 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989886446 5:46890523-46890545 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989886670 5:46894953-46894975 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989886884 5:46899041-46899063 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989887130 5:46903815-46903837 TGTGAGGCTTAATTTGGAAACGG + Intergenic
989887414 5:46909271-46909293 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989887679 5:46914555-46914577 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989887943 5:46919838-46919860 TGTGAGGCTTAACATGGAAACGG + Intergenic
989888069 5:46922393-46922415 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989888556 5:46931943-46931965 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989888833 5:46937397-46937419 TGTGAGGCTTAACATGGAAACGG + Intergenic
989889055 5:46941656-46941678 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989889333 5:46947111-46947133 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989889525 5:46951032-46951054 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989889888 5:46958020-46958042 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989889968 5:46959726-46959748 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989890163 5:46963650-46963672 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989890288 5:46966204-46966226 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989890569 5:46971659-46971681 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989890776 5:46975750-46975772 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989891056 5:46981206-46981228 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989891189 5:46983930-46983952 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989891404 5:46988189-46988211 TGTGAGGCTTAACATGGAAACGG + Intergenic
989891647 5:46992792-46992814 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989891978 5:46999271-46999293 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989892257 5:47004726-47004748 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989892496 5:47009328-47009350 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989892778 5:47014782-47014804 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989892902 5:47017338-47017360 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989893175 5:47022793-47022815 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989893598 5:47030975-47030997 TGTGAGGCTTAACATGGAAACGG + Intergenic
989893886 5:47036181-47036203 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989894318 5:47044534-47044556 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989894599 5:47049988-47050010 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989894851 5:47054931-47054953 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989895052 5:47058679-47058701 TGTGAGGCTTAACATGGAAACGG + Intergenic
989895226 5:47062308-47062330 TGTGAGGCTTAAGATGGAAACGG - Intergenic
989895409 5:47065889-47065911 TGTGAGGCTTAAGATGGAAACGG - Intergenic
989897294 5:47107455-47107477 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989897512 5:47111544-47111566 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989897736 5:47115632-47115654 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989898479 5:47129436-47129458 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989898913 5:47137613-47137635 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989899141 5:47141703-47141725 TGTGAGGCTTAAGATGGAAACGG + Intergenic
989899576 5:47149709-47149731 TGTGAGGCTTAACATGGAAACGG + Intergenic
992890571 5:81200337-81200359 TGTGAGCATCAATATCGATAGGG + Intronic
995479468 5:112580424-112580446 TATCAGGCTCTATATAGGCATGG - Intergenic
998750448 5:145315747-145315769 TGCGAGGCTGAATCTACACATGG + Intergenic
998962802 5:147506931-147506953 TTTGAAGCTGAGTATAGACATGG + Intronic
1003403933 6:5812759-5812781 TGAGAGGCTCAATTGAGACTTGG - Intergenic
1003980130 6:11381568-11381590 TGGGCGGCTCACTATGGACAGGG + Intronic
1004343236 6:14825932-14825954 AGAGAGGCTCAATAGAGACATGG + Intergenic
1009280799 6:61748481-61748503 TGTGAAACTTAATATAGACCTGG - Intronic
1011465810 6:87655727-87655749 TGTGAGGATCACTTGAGACAAGG - Intronic
1011893692 6:92198054-92198076 TGAGAGGCTGAATATATAAATGG - Intergenic
1013260358 6:108435352-108435374 TGTGAGGCTCAAAAATGTCAAGG + Intronic
1013834516 6:114317833-114317855 TATGAGGCTTATTTTAGACAGGG + Intronic
1014418648 6:121214531-121214553 TGTGAGGCTGCACCTAGACAAGG + Intronic
1015426882 6:133081213-133081235 TGTGAGGTTCAGTATAGAAAGGG + Intergenic
1016751849 6:147639052-147639074 TGTGATTCTAAAGATAGACAAGG + Intronic
1018619821 6:165719303-165719325 TGTGAAGCTCATTATCGGCAGGG + Intronic
1024116276 7:46196892-46196914 TGTGAAGCTCAGTCTAAACAGGG - Intergenic
1025498991 7:61259528-61259550 TTTGAGGCTTAATGTAGAAAAGG + Intergenic
1025503326 7:61385770-61385792 TTTGAGGCTTAATGTAGAAAAGG + Intergenic
1029209901 7:98898637-98898659 TGTCAGGCTCAAAATACAGATGG - Intronic
1029220481 7:98985120-98985142 TGTGAAGCTCAAGCTAGAAATGG + Intronic
1029958690 7:104667374-104667396 TGTGATGCTTAATACAGGCAGGG - Intronic
1030554942 7:111012035-111012057 TCTGTTACTCAATATAGACAGGG - Intronic
1032730258 7:134634705-134634727 TGTGAGGGTCCACATACACATGG + Intergenic
1036472115 8:9061419-9061441 TGTGAGGCAGAAAATAGACTTGG + Intronic
1036596906 8:10221387-10221409 TATGTAGCTTAATATAGACATGG - Intronic
1041452705 8:58024290-58024312 TGTGAGGAGCATTATAGAGAGGG + Intronic
1043473004 8:80579551-80579573 TGTGAGGCTGAACATAAAAACGG + Intergenic
1043776438 8:84276385-84276407 AGTGAGGTTCAGTAAAGACAGGG - Intronic
1055486753 9:76763736-76763758 TGGGAGGCCCAATATGGAGAAGG + Intronic
1058388665 9:104469317-104469339 CATTAGACTCAATATAGACAAGG + Intergenic
1059324842 9:113497864-113497886 CCTGAGGCTCAATCCAGACAGGG - Intronic
1060134621 9:121140807-121140829 TGTGAGGCCCACTCTAGACTTGG - Intronic
1060258918 9:122056762-122056784 GGTGAGGCTTGACATAGACATGG - Intronic
1060807380 9:126586248-126586270 TGAGAGGGTCAACCTAGACAAGG + Intergenic
1061344427 9:130010926-130010948 TGCAGGGCTCAAGATAGACATGG + Intronic
1061383203 9:130271874-130271896 TGTTTAGCTTAATATAGACACGG - Intergenic
1061842216 9:133365457-133365479 TAAGAGGCACAATTTAGACAGGG + Intronic
1192549631 X:72043692-72043714 TGTGTGGCTCAAGAGGGACAGGG - Intergenic
1194907884 X:99601349-99601371 TGTGATGCTCTACATATACAGGG - Intergenic
1195534985 X:106000758-106000780 TGTGAGGCTCAAAAATGTCAAGG + Intergenic
1195762055 X:108257216-108257238 TGTGAGCCACAACATTGACATGG + Intronic
1197810630 X:130439311-130439333 TGGGAGGCTCAGAATAGCCAAGG - Intergenic
1197832963 X:130664744-130664766 TGTGAGCCTCACAGTAGACATGG - Intronic
1198298631 X:135311177-135311199 TGTGAGGCTCAATTATGCCAAGG + Intronic
1198674065 X:139113174-139113196 TCTGTGGCTGAATCTAGACAGGG - Intronic