ID: 962168603

View in Genome Browser
Species Human (GRCh38)
Location 3:133077165-133077187
Sequence CAGCACAGCCCCAAACGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 192}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962168603_962168607 -9 Left 962168603 3:133077165-133077187 CCTGGCCGTTTGGGGCTGTGCTG 0: 1
1: 0
2: 1
3: 13
4: 192
Right 962168607 3:133077179-133077201 GCTGTGCTGGCGGTGAGCAGAGG 0: 1
1: 0
2: 2
3: 34
4: 462
962168603_962168608 -6 Left 962168603 3:133077165-133077187 CCTGGCCGTTTGGGGCTGTGCTG 0: 1
1: 0
2: 1
3: 13
4: 192
Right 962168608 3:133077182-133077204 GTGCTGGCGGTGAGCAGAGGAGG 0: 1
1: 0
2: 1
3: 49
4: 867

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962168603 Original CRISPR CAGCACAGCCCCAAACGGCC AGG (reversed) Intronic
900946382 1:5833525-5833547 CCGCAGAGCCCCAAATGCCCTGG + Intergenic
901876025 1:12167455-12167477 CTGCTCAGCCCCAAATGCCCCGG - Intronic
904038816 1:27572668-27572690 CAGCACAGTCCCACACTGCGTGG - Intronic
904575343 1:31501799-31501821 CAGCACAGCCCTAAAAACCCAGG - Intergenic
904886702 1:33743563-33743585 CAGGACAACCCCAGACGGGCTGG + Exonic
905224122 1:36468033-36468055 CCCCACAGCCCCAGAAGGCCTGG - Intronic
913486371 1:119335508-119335530 CTGCAGAGCCCCAAGCGGCATGG + Intergenic
1063037002 10:2296350-2296372 CAGTACAGCCCCAGGCTGCCTGG + Intergenic
1063114863 10:3066690-3066712 CACCACAGCCCCCATGGGCCCGG + Intronic
1064084294 10:12333718-12333740 CATCGCAGTCCCAGACGGCCAGG - Intergenic
1065810630 10:29439499-29439521 CACCACAGCCCCAAACTCCCAGG - Intergenic
1067351063 10:45475606-45475628 CATCACAGCCGCAAACTGCTTGG + Intronic
1068827219 10:61453328-61453350 CAGCGCAGCCCCAGACTCCCTGG - Exonic
1076458159 10:130618195-130618217 TAGCACAGGCCCAACAGGCCAGG - Intergenic
1076902572 10:133347303-133347325 CAACAAAGCCCCAATTGGCCTGG + Exonic
1077097303 11:804556-804578 CAGCCCAGGCCCAGATGGCCTGG - Intronic
1077121833 11:912435-912457 CTGCAGAGCTCCCAACGGCCGGG + Intronic
1080695595 11:34600662-34600684 CAGCACAGCGCCAAACCTCTTGG + Intergenic
1084605092 11:70167736-70167758 CAGCGCAGCCCGACACAGCCTGG + Intronic
1090614893 11:128505853-128505875 CACCACAGCCCCAAGCTCCCCGG + Intronic
1091544442 12:1492005-1492027 CAGCACAGCCCCATCAGTCCAGG + Exonic
1093086783 12:14874344-14874366 CAGCAAAGGCCAAAAGGGCCAGG - Intronic
1096455475 12:51781342-51781364 CAGCCCAGTCCCAAATGGACTGG + Intronic
1096783675 12:54005141-54005163 CAGAACAGGCCCACCCGGCCCGG + Intronic
1096841000 12:54379172-54379194 CCGCACAGCCCCGAGCCGCCCGG - Intronic
1097033723 12:56107951-56107973 CAGCACAGCCTCAATCTCCCAGG - Intronic
1102457202 12:113078035-113078057 CAGAACAACCTCAACCGGCCCGG + Exonic
1104899036 12:132178299-132178321 CAGTACAGCCTCAAACTCCCGGG - Intergenic
1104972007 12:132534965-132534987 CAGGACAGCCCCACAGGGCAGGG + Intronic
1107135985 13:36944774-36944796 CACCACAGCCCCAAACTCCTGGG + Intergenic
1108472752 13:50783902-50783924 CAGCACAGGCCTAGAGGGCCTGG - Intronic
1108601502 13:51999045-51999067 CAGCACAGCCACCAACAGTCAGG + Intronic
1118210741 14:63763738-63763760 CAGTACAGCCTCAAACTCCCAGG + Intergenic
1118568902 14:67172961-67172983 CTCCCCAGCCCCAAACGTCCAGG + Intronic
1120745494 14:88147444-88147466 CAGCCCAGCCCCCAACCTCCTGG - Intergenic
1121611478 14:95283995-95284017 CATCACAGCCCCAGAGGCCCAGG + Intronic
1122775749 14:104116423-104116445 CAGCCCAGCCCCGAACGTCCTGG - Intergenic
1123904857 15:24911386-24911408 CATCACAGGCCCAAAGTGCCAGG + Intronic
1127398974 15:58566228-58566250 CAGCACAGCCCCAAGTGTACGGG - Intronic
1128038295 15:64546546-64546568 CACCACAGCCCCAACCTCCCAGG + Intronic
1128495027 15:68192881-68192903 CAGCACAGTCCTAAAAGGGCTGG - Exonic
1131660295 15:94506858-94506880 CATCACAGCCTCAAACTCCCGGG - Intergenic
1133363075 16:5189345-5189367 CAACACATCCCAAAACAGCCAGG - Intergenic
1137036853 16:35575314-35575336 CAGAGCAGCCCCAAAGGGCCTGG - Intergenic
1138187473 16:54987465-54987487 CAGAAGAACCCCAAAAGGCCTGG + Intergenic
1139280747 16:65768335-65768357 CAGCACAGCCCCAGCAGGCCTGG + Intergenic
1140178031 16:72684448-72684470 CACCACAGCCCCAACCTCCCAGG - Intergenic
1140641725 16:76981689-76981711 CATCACAGAGCCAAACTGCCTGG - Intergenic
1141647703 16:85376395-85376417 CAGCCCAGCCCTAATGGGCCGGG - Intergenic
1142055816 16:87995214-87995236 CGGGACAGCCCCTGACGGCCAGG + Intronic
1142712418 17:1730680-1730702 CAGCACAGCCCTGCAGGGCCAGG + Intronic
1145035734 17:19539360-19539382 CAGCACAGTCCCAGAGGGTCTGG + Intronic
1146903399 17:36602277-36602299 CAGCACAGCCCCAAAATTCCGGG - Exonic
1147765636 17:42833796-42833818 CAGCCCAGCCCCCAACTCCCGGG + Intronic
1148194356 17:45702494-45702516 CAGCACTGCCCCAGATGGTCAGG + Intergenic
1148687831 17:49510461-49510483 CAGCACAGCCCCCAGCACCCAGG + Exonic
1150203973 17:63386926-63386948 CACCACAGCCTCAAACTCCCGGG + Intronic
1152577646 17:81149827-81149849 CAGCCCAGCCTCAAAATGCCCGG + Intronic
1152656187 17:81520121-81520143 CAGCCCAGCCGCAAACAACCTGG - Intronic
1157245605 18:46051672-46051694 CAGAAAAGCCCCAAACCCCCAGG + Intronic
1157499652 18:48180557-48180579 CAGCACAGCCCCAAGGGCCCAGG + Intronic
1157519891 18:48338238-48338260 CAGTGCAGCCCCAAACGCCCAGG + Intronic
1160818637 19:1047728-1047750 CCCCCCACCCCCAAACGGCCTGG - Intronic
1161153265 19:2720573-2720595 CAGCCCACCCCCAGACGTCCAGG + Intronic
1161248392 19:3267608-3267630 CAGCAAAGTCCCAAAGGTCCTGG - Intronic
1165362026 19:35342591-35342613 CAGCACAGCGGCAGATGGCCTGG - Intronic
1166104352 19:40590055-40590077 CACCGCAGCCCCAAACACCCAGG - Intronic
1167199435 19:48054120-48054142 CAGCACAGCTCCATTCGGCCTGG + Intronic
1167300138 19:48673226-48673248 CAGGACAGCCCCGAGCAGCCTGG + Intergenic
1202647659 1_KI270706v1_random:157100-157122 CAGCACAGACCCAGGCGGGCCGG - Intergenic
925260012 2:2520758-2520780 CTGCTCAGCCCCAGACAGCCCGG - Intergenic
926030202 2:9579890-9579912 CACCACAGCCCCAAACTCCTGGG + Intergenic
926037472 2:9646701-9646723 CAGCACTGCCCCAGAGGACCAGG - Intergenic
926058673 2:9791884-9791906 CAGAACAGCCCCCACCGTCCTGG - Intergenic
930024174 2:47020386-47020408 CAGCTCAGCCTCAGCCGGCCAGG - Intronic
930150096 2:48050641-48050663 CAGCACAACTCCAAACTTCCAGG + Intergenic
931754634 2:65361893-65361915 CAGCAGAGCCCCACAGGGCCAGG + Intronic
932564602 2:72897974-72897996 CAGAACAGCCACAAAATGCCAGG + Intergenic
935680204 2:105629193-105629215 CCCCACAGCCCCAGACTGCCTGG - Intergenic
935701877 2:105819980-105820002 TAGCACAGTCCCAAACTGTCAGG - Intronic
935710488 2:105893708-105893730 AAGCACAGCCCCAAAGGCACTGG - Exonic
935930405 2:108118002-108118024 AAGATCAGCCCCAAATGGCCAGG - Intergenic
937276204 2:120685703-120685725 CAGCAGAGCCCCCAAGGGCATGG + Intergenic
938943080 2:136186509-136186531 CAGCACAGCCACACTCTGCCTGG + Intergenic
943771696 2:191724324-191724346 CAGCACAGACCTACAGGGCCTGG + Intergenic
944044014 2:195388285-195388307 CATCACAGGCCCAAGAGGCCAGG + Intergenic
944577933 2:201107825-201107847 CACCACAGCCCCAACCTCCCAGG + Intergenic
944643857 2:201757687-201757709 CACCTCAGCCCTAAACAGCCTGG - Exonic
946815119 2:223569158-223569180 CTGCACAGCCCAAAACATCCTGG + Intergenic
947775633 2:232706868-232706890 CAGTACAGCCTCAAACTCCCAGG - Intronic
1169171746 20:3471019-3471041 CAGCCCCGCCCCGCACGGCCAGG + Exonic
1169797628 20:9481571-9481593 CTGCACAGCCCCCAAAGACCTGG - Intergenic
1171767352 20:29297567-29297589 CGGCACAGCCCCGGCCGGCCGGG + Intergenic
1171962053 20:31501951-31501973 CACCACAGCCTCAAACTCCCAGG + Intergenic
1172601099 20:36183505-36183527 CAGCACAGCCTCAATCCCCCTGG + Intronic
1172696940 20:36829450-36829472 CAGCACAGCCCCAGAAAGCTGGG + Intronic
1174379512 20:50147591-50147613 CAGGACTGCCCCGAACGTCCAGG - Intronic
1174950994 20:55041494-55041516 CATCACAGGCCCGAACGCCCAGG + Intergenic
1175215014 20:57387609-57387631 CAGCACAGCCCCATCCAGGCAGG - Intergenic
1176604201 21:8815660-8815682 CAGCACAGACCCAGGCGGGCCGG + Intergenic
1177477606 21:21644588-21644610 CATCACAGGCCCAAAGGCCCAGG + Intergenic
1178715710 21:34962602-34962624 AAGCACAGCCTCAAAATGCCAGG - Intronic
1180092200 21:45538882-45538904 CACCCCCGCCCCACACGGCCAGG + Intronic
1180281975 22:10708312-10708334 CATCACAGCCCCAAACTCCTAGG + Intergenic
1180346492 22:11707267-11707289 CAGCACAGACCCAGGCGGGCCGG + Intergenic
1180354255 22:11825391-11825413 CAGCACAGACCCAGGCGGGCCGG + Intergenic
1180384000 22:12166964-12166986 CAGCACAGACCCAGGCGGGCCGG - Intergenic
1181480938 22:23198667-23198689 CTCCACAGCCCCACAAGGCCAGG - Intronic
1182109670 22:27713995-27714017 CACCCCAGCCCCAGAAGGCCAGG - Intergenic
1183875008 22:40772710-40772732 CAGTACAGCCTCAATCTGCCGGG + Intronic
1183978222 22:41525368-41525390 CAGGACAGCCCCACCCTGCCAGG + Intronic
1185102550 22:48849392-48849414 CAGCCCAGCCCCGGACAGCCTGG - Intronic
1203239217 22_KI270732v1_random:39475-39497 CATCACAGCCCCAAACTCCTAGG + Intergenic
952412484 3:33062241-33062263 CACCACAGCCCCAACCTCCCAGG + Intronic
954417446 3:50400269-50400291 CAGCAGAGGCCCACAGGGCCAGG - Intronic
961241153 3:125412792-125412814 CATCACAGCCTCAAACGCCTGGG + Intergenic
961825098 3:129595158-129595180 CAGCCCAGCCGCACACAGCCAGG + Intronic
962168603 3:133077165-133077187 CAGCACAGCCCCAAACGGCCAGG - Intronic
968666055 4:1822947-1822969 CAGGACAGCCCCACGCGGCACGG + Intronic
969554466 4:7896858-7896880 CACCCCAGCCCCCAACCGCCCGG + Intronic
969867547 4:10085523-10085545 CAGCACAGCCCCCACCAGCAGGG + Intronic
971021222 4:22538013-22538035 CAGCAAATCCCCAGAGGGCCAGG - Intergenic
971743574 4:30551273-30551295 CATCACAGGCCCAAAGGTCCGGG + Intergenic
972305509 4:37826555-37826577 CAGCGCACCCGCAAACGGCAAGG + Intergenic
973246672 4:48017070-48017092 CAGCACAGCCCGAATCGCCTAGG - Intronic
973373917 4:49275289-49275311 CAGCACAGACCCAGGCGGGCCGG - Intergenic
973383495 4:49334950-49334972 CAGCACAGACCCAGGCGGGCCGG + Intergenic
973387100 4:49519964-49519986 CAGCACAGACCCAGGCGGGCCGG + Intergenic
974569593 4:63627931-63627953 CATCACAGACCCAAAAGCCCAGG + Intergenic
974798006 4:66779261-66779283 CAACACAGGCCCAAACTGCAAGG + Intergenic
977452264 4:97213733-97213755 AAGCACTGACCCAAACTGCCTGG + Intronic
978669756 4:111232606-111232628 CATCAGAGCCCCAGACTGCCAGG + Intergenic
979114154 4:116799755-116799777 CACCGCAGCCCCAAATGGCTAGG - Intergenic
982721424 4:158864107-158864129 CACCACAGCCCCAACCACCCAGG + Intronic
984885258 4:184444069-184444091 CAGCACAGCCCCCTAAGGGCAGG + Intronic
985540021 5:483544-483566 CCGCCCAGCCCCCCACGGCCTGG + Intronic
985614091 5:909183-909205 CAGCCCAGCCTCACAGGGCCAGG + Intronic
992413107 5:76526756-76526778 CTGCAGAGCCCCAAAAGGTCTGG + Intronic
992739561 5:79759600-79759622 AAGCACAACCTCAAACTGCCTGG - Intronic
995142484 5:108749127-108749149 CGGCACAGCCCCCAACGCCCTGG - Intronic
995690996 5:114825527-114825549 CATCACAGCCCCAAAGGCCTAGG - Intergenic
996190227 5:120531399-120531421 CTGCAAAGCCCCAGACAGCCAGG + Intronic
997584453 5:135035956-135035978 CAGCACAGCTCCTTAGGGCCTGG + Intronic
998320662 5:141226708-141226730 CAGCACAGGCCACTACGGCCTGG + Intergenic
1001834423 5:174819732-174819754 AAGCACAGCTCCAAGCGGCAGGG - Intergenic
1002257535 5:177969073-177969095 CAGCTCAGGCCCCAACGGCTAGG - Intergenic
1002602721 5:180363207-180363229 CAGCTCAGCACCAAAGGGCATGG + Intergenic
1007477355 6:42127726-42127748 CAGCCCAGGCCTAAACAGCCAGG - Intronic
1007690174 6:43695729-43695751 CAGGCCAGCCCAAAGCGGCCAGG - Intergenic
1010506012 6:76660491-76660513 CAGCACTGCCCCCAACTGCAAGG + Intergenic
1010800523 6:80168943-80168965 CAACACAGCCCCAAGGGGACCGG - Exonic
1012105937 6:95158457-95158479 CAGCACAACCCCAAACCACAAGG + Intergenic
1012554271 6:100492508-100492530 CTGCACAGGACCAAAGGGCCAGG + Intergenic
1013267981 6:108518946-108518968 CAGACCAGCTCCAAACAGCCAGG + Intronic
1013270488 6:108541074-108541096 CAGCGCAGCCTCAAACACCCAGG - Intergenic
1014110880 6:117617521-117617543 AAGCACAGCACCAAACAGCAAGG + Intergenic
1018005580 6:159619216-159619238 CCTCACAGCCCAAAAAGGCCAGG + Intergenic
1018137368 6:160790407-160790429 AAGCACAGAGCCAAACAGCCAGG + Intergenic
1018218172 6:161551250-161551272 CAGCACAGCCCCAAATGCCAAGG + Intronic
1018708319 6:166478935-166478957 CCGCTCAGGCCCACACGGCCAGG + Intronic
1019147794 6:169986035-169986057 CAGCTCAGCCTCAAACAGCGTGG + Intergenic
1019306993 7:340328-340350 CAGGACAGCCCCAAAGTGCCAGG - Intergenic
1019350914 7:553562-553584 CCCCACAGCCCCAGCCGGCCTGG + Intronic
1020095281 7:5365185-5365207 CACCACAGCCTCAAGCTGCCAGG + Intronic
1020492011 7:8798295-8798317 CAGCACTGCCCCATAATGCCTGG - Intergenic
1021724009 7:23532389-23532411 CACCACAGCCTCAAACTCCCGGG + Intergenic
1021825064 7:24542071-24542093 CACTACAGCCCCAAACTCCCAGG + Intergenic
1022275100 7:28847467-28847489 CAGTTCATCCCCAAACGCCCTGG + Intergenic
1023519817 7:41039096-41039118 CACCACAGCCTCAAACTCCCAGG + Intergenic
1025093088 7:56078970-56078992 CACTACAGCCTCAAACTGCCAGG + Intronic
1025099902 7:56125422-56125444 CAGCACAGCCGGACAGGGCCAGG + Intergenic
1026907262 7:74069484-74069506 CTGCACAGCCCCGCACGCCCTGG - Intronic
1030533228 7:110735925-110735947 CATCATAGGCCCAAACTGCCAGG + Intronic
1031275266 7:119712940-119712962 CACCACAGACCCAAAGGGCTAGG - Intergenic
1035254870 7:157619816-157619838 CAGCACAGCCCCCCACGCCAGGG - Intronic
1035397368 7:158543988-158544010 CAGGGCAGCCCCAACTGGCCGGG + Intronic
1035599917 8:891345-891367 CAGCAGAGGCCCAAAAGGTCAGG + Intergenic
1036444000 8:8805993-8806015 AAACAAACCCCCAAACGGCCAGG - Intronic
1036776452 8:11616185-11616207 CAGCACAGCCCCTGAGGGTCAGG - Intergenic
1040979832 8:53234979-53235001 CAGCACATCCCCAAAAGGCCAGG + Exonic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1043927671 8:86056215-86056237 CAGTGCAGCCCCAAACTCCCTGG - Intronic
1044698901 8:94949160-94949182 CCGCGCAGCCCCGCACGGCCCGG - Exonic
1047607152 8:126486897-126486919 CAGCATAGCCCCAAACTTCTTGG + Intergenic
1048244197 8:132775596-132775618 CAGCTCGGCCCCGGACGGCCCGG + Exonic
1049126200 8:140791260-140791282 CACCACAGCCTCAAACCCCCGGG + Intronic
1052913100 9:33901987-33902009 CAGCACAGCCTCAACCTCCCGGG + Intronic
1054333305 9:63781480-63781502 CAGCACAGACCCAGGCGGGCGGG - Intergenic
1054351070 9:64017104-64017126 CAGCACAGACCCAGGCGGGCCGG + Intergenic
1057577499 9:96255109-96255131 CAACACAACCCCAATGGGCCAGG + Intronic
1059336912 9:113574833-113574855 CAGCAGAGCCCCAGGGGGCCTGG + Intronic
1059524106 9:114974056-114974078 GAGCAGAGCCCCAAATGGTCCGG + Intergenic
1061208258 9:129176724-129176746 CAGCTCAGCCCCGAGTGGCCCGG + Exonic
1061642536 9:131970327-131970349 CAGCACAGCACCTGAAGGCCAGG + Intronic
1061662207 9:132137708-132137730 CAGCACAGCCCCTTACAGCCTGG + Intergenic
1062041078 9:134404600-134404622 CATCACAGCCCCACAGGCCCTGG - Intronic
1062049723 9:134441021-134441043 CAGCCCAGCCCCAGACAGCATGG - Intergenic
1203697616 Un_GL000214v1:113259-113281 CAGCACAGACCCAGGCGGGCCGG - Intergenic
1203551598 Un_KI270743v1:167757-167779 CAGCACAGACCCAGGCGGGCCGG + Intergenic
1185581609 X:1214081-1214103 CACCACAGCCTCAAACAGCTTGG + Intergenic
1185880275 X:3734224-3734246 CACCACAGCCCCAACCTCCCAGG + Intergenic
1191020873 X:55858801-55858823 CATCACAGACCCAAAGGCCCAGG - Intergenic
1195155143 X:102115609-102115631 CAGGAAAGCCCCAAATGGCAGGG + Intergenic
1196200211 X:112878298-112878320 CAGCACAGCCACAAAGTTCCAGG + Intergenic
1197741275 X:129896149-129896171 CACCACAGCCTCAAACTCCCAGG - Intergenic
1200750744 Y:6942077-6942099 CACCACAGCCCCCAACTCCCGGG - Intronic
1201342569 Y:12950638-12950660 CACCACAGCCTCAAACTGCTGGG + Intergenic