ID: 962169241

View in Genome Browser
Species Human (GRCh38)
Location 3:133083185-133083207
Sequence CAGGCTGAGGAGTGGGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 887
Summary {0: 1, 1: 0, 2: 7, 3: 69, 4: 810}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962169241 Original CRISPR CAGGCTGAGGAGTGGGGCGG CGG (reversed) Intronic
900185404 1:1331003-1331025 CAGGCTGTGGAGAGGAGAGGGGG - Intergenic
900227461 1:1539960-1539982 CAGGCTGGGGAGGGGAGCGCAGG + Intronic
900227517 1:1540098-1540120 CAGGTTGGGGAGGGGAGCGGAGG + Intronic
900262356 1:1738289-1738311 CAGGCGGAGGGGTGGGGCCCAGG + Intronic
900303575 1:1990454-1990476 CGGGGTGGGGAGTGGGGTGGGGG + Intronic
900619633 1:3580838-3580860 CAGGCTCCGGGGTGGGGCAGGGG - Intronic
900769951 1:4532938-4532960 CAGGCTGAGGTGGGGGCAGGGGG + Intergenic
901056412 1:6450500-6450522 GAGGCTGAGGCGCGGGGTGGGGG + Intronic
901210294 1:7520659-7520681 CTGGCTGCAGAGTTGGGCGGTGG + Intronic
901263110 1:7888325-7888347 CAGTCTGAGGGATGGGGAGGAGG - Intergenic
901280020 1:8026527-8026549 CAGGCAGAGGAGCGGAGCTGCGG - Intergenic
901374317 1:8826608-8826630 GAGGCCGAGGAGTGGGGGAGTGG + Intergenic
901823552 1:11846126-11846148 CAGGCTGGGGTGGGGGCCGGTGG - Intronic
902477937 1:16697985-16698007 GAGGCTGAGGCGCGGGGTGGGGG - Intergenic
902511127 1:16967579-16967601 CAGGCTCAGGATAGGGGCTGGGG + Intronic
902614400 1:17616006-17616028 CAGGCCGAGGCCTGGGGAGGCGG + Intronic
902644435 1:17788643-17788665 CAGCAAGAGGAGTGGGGTGGGGG + Intronic
902864373 1:19268781-19268803 CAGGGTGTGGGGTGGGGCAGTGG - Intergenic
902869608 1:19306227-19306249 CAGGGTGTGGGGTGGGGCAGTGG - Intronic
903044235 1:20553668-20553690 CAGGCGGCGCAGTGGGGCGCGGG - Exonic
903234116 1:21938396-21938418 CAGGCTGAGGCTGGGTGCGGTGG - Intergenic
903337607 1:22635436-22635458 GAGCCTGAAGGGTGGGGCGGGGG + Intergenic
903674093 1:25053659-25053681 CAGGGTGTGGAGTGTGGTGGTGG - Intergenic
903759934 1:25690718-25690740 GGGGCTGTGGAGTGGGGCAGGGG + Intronic
903849649 1:26298104-26298126 GAGGCTGAGTTGTGGGGGGGAGG + Intronic
903858623 1:26352037-26352059 GAGGCTGAGGAGGGGGCGGGGGG + Intronic
904226541 1:29025823-29025845 CAGAGTGAGGAGTGGGTCCGTGG + Intronic
904542121 1:31239987-31240009 ACGGCAGAGGGGTGGGGCGGGGG + Intergenic
904607213 1:31704370-31704392 AAGGCTGCGGGGTGGGGGGGCGG + Intergenic
904650655 1:32003535-32003557 CAGGCTCAGGCCTGGGGCTGGGG - Intergenic
904697340 1:32337693-32337715 CAGTCTGTGAAATGGGGCGGGGG - Intergenic
904896693 1:33823161-33823183 CTGGCTGAGGAAAGGGGAGGCGG - Intronic
905092030 1:35437362-35437384 CAGGTAGAGGAGTGGTGCGTTGG - Intronic
905291465 1:36924478-36924500 CTGGCTGTGGAGAGGGGAGGGGG + Intronic
905302893 1:36997686-36997708 CAGTCTGAGGAGTGCCGTGGTGG + Intronic
905390727 1:37634149-37634171 CAGGCTGCGGACTGGGGTGGGGG + Intronic
905446516 1:38031271-38031293 TAGGGTGAGGAGTGGGGAGCAGG - Intergenic
905463069 1:38133998-38134020 CAGGCCGAGGAGGGAGGCGGCGG + Intergenic
905485381 1:38292420-38292442 CAGGCTGGGCAGCGGGCCGGTGG - Intergenic
905973836 1:42161633-42161655 CATCTTGAGGAGTGGGGTGGAGG - Intergenic
905976200 1:42175715-42175737 CATACTGAGGATTGGGGCCGTGG - Intergenic
906140499 1:43531262-43531284 CAGGCTGGGGCGTGGAGGGGGGG - Intronic
906148984 1:43576948-43576970 CAGGCTGAGTAGATGGGCAGGGG - Intronic
906281719 1:44559214-44559236 AAGGCTGAGGACTGGGGCTGGGG - Intronic
906675918 1:47693560-47693582 GAGGTTGGGGAGTGGGGCTGGGG + Intergenic
907020327 1:51060494-51060516 CAGTGTGACGAGTGGGGTGGAGG - Intergenic
907450346 1:54542267-54542289 CAGGCTGAAGGGAGGCGCGGAGG - Intronic
907461155 1:54606390-54606412 CAGGCAGGGGAGTGGGGAGGAGG + Intronic
908316208 1:62935368-62935390 CAGGGTGGGGAGTGGAGCTGGGG - Intergenic
908693660 1:66811626-66811648 GAGAGTGAGGAGTGGGGAGGAGG + Intergenic
908703294 1:66924885-66924907 GAGGCCGAGGAGGAGGGCGGAGG + Exonic
909818491 1:80027690-80027712 CAGTCAGAGGAGGGGGGCAGTGG + Intergenic
910210904 1:84791902-84791924 GTGGCTGAGGTGTGGGGCCGGGG + Intergenic
910796053 1:91098972-91098994 GAGGCTGGGGAGTGTGGCTGTGG + Intergenic
912168545 1:107069446-107069468 GAGGATGAGGAGGGGGGAGGAGG + Intergenic
912624681 1:111197330-111197352 AAGGCTGAGGGCTGGGGAGGGGG + Intronic
913326429 1:117632300-117632322 CAGGCTGGAGAGGAGGGCGGGGG + Intergenic
913688028 1:121252641-121252663 CAGGGTGTGGATTGGGGTGGTGG + Intronic
914039885 1:144040281-144040303 CAGGGTGTGGATTGGGGTGGTGG + Intergenic
914149574 1:145027639-145027661 CAGGGTGTGGATTGGGGTGGTGG - Intronic
915004424 1:152623302-152623324 CAGGCAGGGGAGAGGGCCGGAGG - Intergenic
915126716 1:153670701-153670723 CGGGCCCAGGAGTGGGGAGGGGG - Intronic
915284181 1:154842388-154842410 CAGGCCGAGGAGAGGGGCCCTGG + Intronic
915406196 1:155661481-155661503 CAGGCTGGTGAATGGGGTGGTGG + Intronic
915419403 1:155767599-155767621 CAGGCTGGTGAATGGGGTGGTGG + Intronic
915599392 1:156913063-156913085 GAAGATGAGGAGTGGGGAGGAGG + Intronic
916144749 1:161728211-161728233 GAGGCTGAGGCGGGGGGGGGGGG + Intergenic
916159734 1:161897328-161897350 CAGGCTGAGGCGGGGGTGGGTGG + Intronic
917517692 1:175721845-175721867 CAGGCTGGTCAGTGGGGTGGGGG - Intronic
917565326 1:176207040-176207062 GAGGCTGAGGGGAGGGGAGGCGG - Exonic
917925369 1:179785165-179785187 CAGGGTGAGGAATGGGGGGTGGG - Intronic
918048834 1:180956940-180956962 AAGGCTGAGGAGTGGGGAGAGGG - Intergenic
918072607 1:181143987-181144009 CAGGCTGGGGAATGGGGTGAAGG - Intergenic
918313722 1:183305294-183305316 CAGGGGGTGGAGTGGGGCAGGGG + Intronic
918703596 1:187635574-187635596 TAGGCTGCGGAGTGGGGAGATGG - Intergenic
919883547 1:201916642-201916664 CAGGCCGTGGTGTGGGGAGGAGG + Intronic
919923366 1:202179124-202179146 CAGGGTGGGCAGTGGGGCCGAGG - Intergenic
920380500 1:205532127-205532149 CAGACTGATGAGCTGGGCGGGGG - Intronic
920414564 1:205790097-205790119 CTGGTTGAGCAATGGGGCGGTGG + Exonic
920475350 1:206271140-206271162 CAGGGTGTGGATTGGGGTGGTGG + Intronic
920646591 1:207808166-207808188 GAGGCTGGGGAGTGGGGGGAGGG + Intergenic
921031603 1:211339526-211339548 CAGGCTCAGTTGTGGGGTGGGGG + Intronic
922142852 1:222907456-222907478 CCCGGTGAGGAGTGGGGAGGAGG + Intronic
922471592 1:225880423-225880445 CAGGCTGAGGAGAAGGCAGGGGG + Intronic
922478544 1:225923306-225923328 GAGGCTGAGGTGGGAGGCGGAGG + Intronic
922706198 1:227791653-227791675 CAGGGTTAGGGTTGGGGCGGTGG - Intergenic
922822616 1:228494489-228494511 GAGGCACAGGAGTGGGGTGGGGG - Exonic
923482233 1:234396456-234396478 CAGGGTGAAGAGAGGGACGGAGG - Intronic
924036558 1:239943956-239943978 CAGGCAGAGGTGTGCGGCAGGGG - Intergenic
924772543 1:247089767-247089789 CTGGCTGAGGGCTGGGGCTGGGG - Intergenic
1062899759 10:1134261-1134283 GAGTCTGTGGAGTGGGGGGGGGG - Intergenic
1063121323 10:3106941-3106963 CAGGGTGAGGAGAGGGGCAGGGG - Intronic
1063582848 10:7324827-7324849 CAGGCAGAGAAGGGAGGCGGAGG + Intronic
1063585664 10:7350068-7350090 AAGGCTGTGGAGTGGGGCTGTGG - Intronic
1063964852 10:11338923-11338945 CAGGGTGAGGATGGGGGTGGGGG - Intergenic
1064364917 10:14699045-14699067 CAGGCAGAGGTGGGGGGCAGGGG + Intronic
1065187740 10:23185414-23185436 CAGACTCAGAAGTGGGGTGGTGG + Intergenic
1065371412 10:24990854-24990876 GAGGCTGAGGGGTGGGGGGGTGG + Intronic
1065698844 10:28404920-28404942 AAGGCGGGGGGGTGGGGCGGGGG + Intergenic
1066395787 10:35020261-35020283 AATGCTGAGAAGTGGGGAGGTGG + Intronic
1066616947 10:37304754-37304776 GAGGCTGAGGAGGGAGGCTGAGG - Intronic
1067081209 10:43213436-43213458 CAGGGTGAGAAGAGGGGAGGGGG + Intronic
1068731475 10:60363079-60363101 CGGGCGGGGGAGGGGGGCGGGGG + Intronic
1068936355 10:62639061-62639083 CAGGTTGAGGAGGGGTGAGGAGG + Intronic
1069705539 10:70457005-70457027 CAGGCAGGGGAGGGGGGCAGGGG - Intergenic
1070368091 10:75755769-75755791 CAGGCTGTGCAGTGGGGAGCAGG + Intronic
1070810084 10:79293268-79293290 GAGGTGGAGGAGTGGGGAGGGGG - Intronic
1071289272 10:84176884-84176906 CTGGCTGAGGACTGTGGAGGTGG + Intronic
1071524645 10:86351387-86351409 CAGGCTGGGGAGGTGGGCTGAGG + Intronic
1071550305 10:86561408-86561430 CAGGGTGGGGGGTGGGGGGGCGG + Intergenic
1072241010 10:93495958-93495980 CAGACAGCGGAGTGGGGGGGGGG - Intergenic
1072407505 10:95168759-95168781 CAGCAGGAGGAGTGGGGCAGGGG + Intergenic
1072491236 10:95907785-95907807 CGGGCAGAGGCGAGGGGCGGGGG + Intronic
1072742643 10:97919029-97919051 GAGGCTGAGGCGGGGGGGGGTGG - Intronic
1072755623 10:98019020-98019042 CAGGGTGAGGGGTGCTGCGGAGG + Intronic
1073098953 10:100997231-100997253 CTGGGTGAGTGGTGGGGCGGCGG + Intronic
1073242123 10:102065772-102065794 CTGGCCGAGGTGTGGGGCGCGGG + Exonic
1074173461 10:110970206-110970228 GAGGCTGAGAAGGGTGGCGGGGG - Intronic
1075015971 10:118910292-118910314 GAGGCGGAGGAGAGGGGCTGGGG - Intergenic
1075375955 10:121978381-121978403 AAGGCTGAGAAGTGGGGTGCAGG - Intergenic
1075393946 10:122113401-122113423 CTGGCAGAGGAGTGTGGCTGCGG + Intronic
1075512188 10:123081509-123081531 CTGGCTGGGGAGAGGGGCGGCGG - Intergenic
1075546785 10:123361191-123361213 CAGGGTGAGCAGTGGGTCAGGGG + Intergenic
1075939355 10:126375983-126376005 GAGGCTGGGGGGTGGGGAGGGGG - Intronic
1076276627 10:129204894-129204916 CGGAGTGAGGAGTGGGGCAGAGG + Intergenic
1076379573 10:130015794-130015816 CAGGCTGGGGATTGGGGAGCAGG + Intergenic
1076478261 10:130767436-130767458 AAGGCTGAGGAGAGGGAGGGGGG - Intergenic
1076518400 10:131062886-131062908 CAGGCAGAGGAGGGGCACGGAGG + Intergenic
1076685468 10:132196666-132196688 CAAGCTGGGAAGTGAGGCGGAGG - Intronic
1076711558 10:132338538-132338560 CAGGCTGAGGAGGGGAAAGGAGG - Intronic
1076739932 10:132478089-132478111 CAGGCTGAGGAGAGGGGCCCTGG + Intergenic
1077376049 11:2205526-2205548 GAGGCTGAGAGGTGGGGAGGTGG - Intergenic
1078043804 11:7894192-7894214 CAGGGAGAGGAGTGGTGCTGAGG - Intergenic
1078375717 11:10791763-10791785 GAGGCTGAGGAGAAGGGCGCCGG - Intergenic
1078406772 11:11077032-11077054 CAGGATGAGGCTGGGGGCGGTGG - Intergenic
1078708035 11:13764217-13764239 TTGGCTGGGGAGTGGGGCAGAGG - Intergenic
1079150431 11:17894198-17894220 CATGATGAGGAGTGGGGTGGTGG - Intronic
1079503885 11:21132761-21132783 CATGGTGAGCAGTGGGGTGGGGG + Intronic
1080216157 11:29843682-29843704 GAGGATGAGGGGTGGGGTGGGGG - Intergenic
1080244481 11:30164044-30164066 CAGACTGGGTAGTGGGGTGGGGG + Intergenic
1080672630 11:34395170-34395192 CAGCCAGAGGAGTGGGGTTGTGG - Intergenic
1081179090 11:39965760-39965782 CAGGCTTAAGAGTGGGGGGTGGG - Intergenic
1081520975 11:43880850-43880872 CAGACTGCGGAGTGGGTCAGGGG + Exonic
1081612506 11:44571018-44571040 CAAGTTGCGGGGTGGGGCGGCGG - Intronic
1081654983 11:44851194-44851216 CAGCCTGAGCAGTGGGCCAGCGG + Intronic
1082001765 11:47397080-47397102 GAGGCTGTGGAGTGGGGCCTTGG + Intergenic
1082053940 11:47797312-47797334 CAGGGTGGGGCGGGGGGCGGAGG - Intronic
1083306564 11:61764838-61764860 CAGGCAGAGGAGTGGAGCTCTGG + Intronic
1083595140 11:63915519-63915541 CAGGCTGTGAAGTGGGGTGGGGG - Intronic
1083624872 11:64067298-64067320 GAGGCTGAGCAGTGGGGAGGAGG - Intronic
1083638256 11:64131889-64131911 GAAGCTGAGGAGGGGGGCAGGGG + Intronic
1083962107 11:66020386-66020408 CAGGCTGGGGAGAGGGACAGGGG + Exonic
1083993577 11:66261156-66261178 GAGGCTGGGGAGAGGGGTGGGGG + Intronic
1084047070 11:66575241-66575263 CAGCCTGGGGAGCGGGGAGGAGG - Intergenic
1084179383 11:67438870-67438892 GAGGCTGAGGAGTGGGTGAGCGG - Exonic
1084194460 11:67516553-67516575 CAGGCTGAGGCCTGGGGAGGTGG + Intergenic
1084266934 11:68010018-68010040 GAGGAGGAGGAGTGGGGCAGTGG - Intronic
1084276751 11:68055755-68055777 CAGGCTGAGGCCGGGCGCGGTGG + Intronic
1084471760 11:69365746-69365768 GAGGGTGAGGAGTGGGGAGGAGG + Intronic
1084739046 11:71126808-71126830 GAGGCTGAGGTGGGAGGCGGAGG - Intronic
1084953330 11:72678579-72678601 AAGGCTGTGGACTGGGGCCGAGG - Intergenic
1085200196 11:74697173-74697195 TGGGCTGAGGAATGGGGCCGGGG - Intronic
1085258172 11:75188923-75188945 CAGGCTCAGCAGTGGGTGGGAGG - Intronic
1085259357 11:75195529-75195551 CAGGGTGTGGAGTGGGGAAGTGG - Intronic
1085356260 11:75840398-75840420 CTGGCAGAAGAATGGGGCGGGGG + Intronic
1085390250 11:76178625-76178647 CAGGCAGAGGTGTGGGGCTGTGG + Intergenic
1085395721 11:76206274-76206296 CAGGCCAGGGACTGGGGCGGCGG - Intronic
1086855485 11:91860520-91860542 CAACCTGAGGAGAGGGGAGGGGG - Intergenic
1088818202 11:113435503-113435525 CAGGTGGAGGTGTGGGGCTGGGG + Intronic
1089096424 11:115923479-115923501 CACGGTGGGGATTGGGGCGGGGG + Intergenic
1089302597 11:117507661-117507683 CAGGCTGAGGTGTGGGGCTGTGG - Intronic
1089334340 11:117712847-117712869 CAGGGTGGGGAGAGAGGCGGGGG - Intronic
1089461902 11:118658596-118658618 CACACTGAGGCCTGGGGCGGGGG + Intronic
1089653819 11:119932867-119932889 CAGGGTGAGGGATGGGGCAGGGG - Intergenic
1089678678 11:120107499-120107521 GAGGCAAAGGAGTGGGGAGGGGG - Intergenic
1089849237 11:121482158-121482180 CAGGCAGAGGACTGGGGCTTTGG + Intronic
1090258646 11:125303331-125303353 CAGGCTGAGGAATGTGCCTGGGG + Intronic
1091216443 11:133905235-133905257 CAGGCTTGGGGGTGGGGTGGGGG - Intergenic
1091285345 11:134405630-134405652 CAGGCAGATGTGTGGGGCTGGGG - Intronic
1092099442 12:5871090-5871112 CAGGCTAACGACTGGGGCCGTGG - Intronic
1092253280 12:6913261-6913283 CAGGCAGAGGAGTTGGTGGGGGG + Intronic
1092476797 12:8826488-8826510 CAGGCTGTGGAGTGCAGTGGCGG + Intronic
1092488272 12:8921704-8921726 CTGGTTGAGGGGTGGGGAGGTGG - Exonic
1092875718 12:12845876-12845898 AAGGCTGAGGCCAGGGGCGGTGG - Intergenic
1092878921 12:12872740-12872762 CAGGCTGATGGGTGGAGCGGAGG + Intergenic
1095961041 12:47834545-47834567 AAGGCTGAAGAGTGGGGTGGAGG + Intergenic
1095989884 12:48027392-48027414 AAGGCTGAGGCCTGGGGCGAGGG - Intergenic
1096214797 12:49792983-49793005 CAGGCTGGGGAGGGGAGGGGAGG + Exonic
1096255149 12:50058017-50058039 GTGGCTGGGGAGGGGGGCGGGGG + Intronic
1096393698 12:51249174-51249196 TAGGGTGAGGTGTGGGGAGGGGG - Intronic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1096788076 12:54029220-54029242 CAGTCTGAGGAGAAGGGAGGGGG + Intronic
1096946589 12:55414305-55414327 CTGGTTGAGGGGTGGGGAGGTGG + Intergenic
1097751051 12:63353265-63353287 GAGGCTGGGGTGGGGGGCGGGGG + Intergenic
1098018358 12:66130258-66130280 CAGTCTGGGGAGAGGGTCGGGGG - Intronic
1098512388 12:71332011-71332033 GAGGCTGAGCTGTGGGGAGGGGG + Intronic
1100505574 12:95217358-95217380 CAGGCTGCGCCGCGGGGCGGCGG - Exonic
1101232446 12:102755268-102755290 CAGGGTGAGAAGTGGAGAGGTGG - Intergenic
1101733481 12:107445488-107445510 CATGCTGAGGAGTGGTGCCCAGG + Intronic
1102022187 12:109691429-109691451 GAGGCTGAGGGGGGGGGGGGGGG - Intergenic
1102238333 12:111308547-111308569 GGGGCTGAGGGCTGGGGCGGGGG + Intronic
1102402395 12:112640882-112640904 TATGCTGCGGAGTGGGGAGGAGG - Intronic
1102471046 12:113160111-113160133 CAGGCTGAGAAGTGAGGTGTGGG + Intronic
1102498153 12:113333651-113333673 CAGGGTGGGGTGGGGGGCGGGGG - Intronic
1102534534 12:113570653-113570675 CAGGGTGGGCAGGGGGGCGGGGG + Intergenic
1102574581 12:113848230-113848252 CAGGCTAAAGAGTGGGGAGAAGG + Intronic
1103627445 12:122230845-122230867 CAGGCTGTGGTGGGGGGCAGGGG - Exonic
1103704516 12:122864120-122864142 GAGGCTGAGGTGGGGGGGGGGGG - Intergenic
1103840086 12:123855860-123855882 CAGGCAGAGGAGTGAGGCCAGGG - Intronic
1103910449 12:124349313-124349335 CCCTCTGAGGGGTGGGGCGGGGG - Intronic
1104391897 12:128397851-128397873 GAGGCTGAGCAGAGGGGAGGTGG - Intronic
1105313824 13:19237889-19237911 GAGGCTGGGAAGTGGGGAGGGGG + Intergenic
1105516936 13:21099192-21099214 GAGGCTGAGGTGGGAGGCGGAGG + Intergenic
1105717728 13:23084104-23084126 AAGGCTGGGGAGGGGGGCAGGGG + Intergenic
1106173469 13:27308690-27308712 CAGGCTGGCGGGTGGGGGGGGGG + Intergenic
1107936035 13:45346094-45346116 GAGGCTGAGGAGGGAGGTGGAGG - Intergenic
1111336126 13:86825997-86826019 CATGCTGAGGAGTGGGGCCTTGG + Intergenic
1111540632 13:89663309-89663331 GAGGCTGAGGCGGGGGGCTGAGG - Intergenic
1112310755 13:98315614-98315636 AAGGCTGAGGAGTGCAGCAGTGG + Intronic
1112796076 13:103058006-103058028 CAGACTGAGGGCTGGGGAGGGGG + Intronic
1113147232 13:107220825-107220847 CAGAGAGAGGAGTGGGGTGGAGG + Intronic
1113228378 13:108183453-108183475 CAGGCAGAGGGGTGGGTCAGGGG + Intergenic
1113385290 13:109842788-109842810 CAGGCCCAGGAGTGGGGATGGGG - Intergenic
1113424388 13:110195973-110195995 CAGGGTGTGGAGTGGGGCTGTGG + Intronic
1113929987 13:113963223-113963245 GAGGCTGAGGACAGGGGCCGAGG - Intergenic
1113930062 13:113963493-113963515 GAGGCTGAGGACAGGGGCCGAGG - Intergenic
1113930077 13:113963548-113963570 GAGGCTGAGGACTGGAGCGAGGG - Intergenic
1113930111 13:113963677-113963699 GAGGCTGAGGACAGGGGCCGTGG - Intergenic
1113977399 13:114238621-114238643 CAGGCAGAGGAGTGGAGCACTGG - Intronic
1114626096 14:24131412-24131434 CAGGTGGGGGAGAGGGGCGGGGG - Exonic
1115180679 14:30622294-30622316 CCGGCTGGGGAGCGGAGCGGGGG - Exonic
1117882231 14:60323376-60323398 CAGGCTGAGGGGTGGGGTCATGG + Intergenic
1119182148 14:72612538-72612560 GATGCTAAGGAGTGGGGTGGAGG - Intergenic
1119190614 14:72679601-72679623 CAGCCTGTGGAGGGTGGCGGGGG - Intronic
1119483390 14:74973659-74973681 CAGAGCGAGGAGTGGGGCTGGGG + Intergenic
1120669441 14:87347295-87347317 CGAGCTGAGGAGTGGGGGTGGGG + Intergenic
1121096380 14:91220644-91220666 CGGGCTGGGGAGTGTGGCAGCGG - Intronic
1121300022 14:92862782-92862804 CAGGGTGTGGAGTGGGGTGGGGG - Intergenic
1121437681 14:93929755-93929777 GAGGGTGAGGAGGGGAGCGGAGG + Intergenic
1121448526 14:93993539-93993561 CAGGATGCAGAGTGGGGCTGCGG - Intergenic
1121529275 14:94641128-94641150 GAAGCTGAGGGGTGGGGAGGAGG + Intergenic
1121539006 14:94711225-94711247 CAGGCGGAGGGGTGGAGAGGGGG - Intergenic
1121544996 14:94756647-94756669 CAGGGTGTGGGGTGGGGAGGCGG - Intergenic
1121609781 14:95269874-95269896 CAGCCTGTGGATTGGGGTGGGGG - Intronic
1121615521 14:95311220-95311242 CCAGCTGAGAACTGGGGCGGCGG - Intronic
1121823948 14:96995129-96995151 CAGGCTGGGCAGTGGGATGGAGG + Intergenic
1122464062 14:101918486-101918508 AAGGCTGAGGGGTGGGGGGAGGG - Intronic
1122464093 14:101918554-101918576 AAGGCTGAGGGGTGGGGGGAGGG - Intronic
1122819087 14:104332305-104332327 GAGGCTGAGGCGTGGGGGGCTGG - Intergenic
1122972784 14:105159134-105159156 CAGTCGGAGGTGTGGGGCGGGGG - Intronic
1123036299 14:105473310-105473332 CAGGCTGGTCAGTCGGGCGGGGG + Exonic
1123061650 14:105597262-105597284 GAGGCTGGGGAGTGAGGCCGTGG + Intergenic
1123069673 14:105636328-105636350 CAGGCTGAAGAGAGGGGCAGAGG - Intergenic
1123086388 14:105718992-105719014 GAGGCTGGGGAGTGAGGCCGTGG + Intergenic
1123088768 14:105732111-105732133 CAGGCTGAAGAGACGGGCAGAGG - Intergenic
1123094697 14:105761368-105761390 CAGGCTGAAGAGAGGGGCAGAGG - Intergenic
1123428052 15:20188695-20188717 TAGGCTGAGGAGTGGGGTTGGGG + Intergenic
1123998717 15:25736735-25736757 AAGGCTTAGGAGTGGGGGGAAGG + Intronic
1125200220 15:37096135-37096157 CAGGCTCAGGGATGGGGAGGAGG + Intronic
1125522792 15:40357504-40357526 CAGGCTGAGGTGGGGTGGGGGGG + Intergenic
1125702805 15:41703370-41703392 GAGGGTGGGGAGTGGGGGGGGGG - Intronic
1127169204 15:56281548-56281570 CGGACTTAAGAGTGGGGCGGGGG - Intronic
1127298972 15:57634176-57634198 CAGGCTGGTGAGTGTGGTGGGGG + Intronic
1127378448 15:58406775-58406797 CAGGCTGAGGAGATGGGGTGGGG - Intronic
1127383774 15:58451208-58451230 CAGGTAGAGCAGTGGGGTGGAGG + Intronic
1127595688 15:60479566-60479588 CTGGATGGGGAGTGGAGCGGAGG - Intergenic
1127620020 15:60724894-60724916 CAGTGTGAGGAGCGGGGAGGAGG - Intronic
1127637989 15:60889333-60889355 CAGGGAAGGGAGTGGGGCGGGGG + Intronic
1127921487 15:63497887-63497909 CAGGCTGGTGAGTGGGGGTGGGG - Intergenic
1127975050 15:63990934-63990956 CAGGCAGAGGAGTAGGGAGGGGG - Intronic
1128345287 15:66849282-66849304 CAGGTTCAGGTGTGGGGCCGTGG - Intergenic
1128674725 15:69600164-69600186 CAGGCAGAGGGGTGGGAGGGGGG + Intergenic
1129165618 15:73775487-73775509 GAGGCTGAGGAGTAGGGAGAGGG + Intergenic
1129183974 15:73894523-73894545 CAGGATGGGGAGTGGGCTGGGGG + Intergenic
1129318664 15:74761793-74761815 CAGGCAGTGCAATGGGGCGGAGG + Intergenic
1129389800 15:75214830-75214852 CAGGCTGAGGCTAGGGGCTGTGG - Intergenic
1129717404 15:77860302-77860324 CAGTCTGAGGTGGGGGGAGGGGG - Intergenic
1129752795 15:78077612-78077634 CGGGCGGAGGAGGGCGGCGGCGG - Exonic
1129842936 15:78755040-78755062 TGGGCTGAGGGGTGGGGTGGGGG - Intergenic
1130116961 15:81013775-81013797 CAGGCTGAGGACTGCGGAAGCGG - Intronic
1130226104 15:82059185-82059207 GAGGAAGAGGAGTGGGGAGGAGG - Intergenic
1130902099 15:88214966-88214988 CGGGCAGAGGAGTGGGGAGCAGG - Intronic
1131499908 15:92952317-92952339 CAGGCTGGGGAGGAGGGAGGGGG + Intronic
1131619985 15:94057928-94057950 CATGCTGAGGTGTGGGGCATTGG + Intergenic
1132145210 15:99425421-99425443 GAGGCTGGGGTGGGGGGCGGGGG + Intergenic
1132385550 15:101397736-101397758 AAGGCTGAGGAAGGGGGAGGAGG - Intronic
1132618369 16:853169-853191 CAGGCCGAGGAGGGCGGCTGCGG - Intergenic
1132618767 16:854753-854775 CAGGCTGAGGAGCCGGGTCGGGG - Intronic
1132645311 16:996810-996832 CAGGGTCAGGGCTGGGGCGGGGG + Intergenic
1132647152 16:1004373-1004395 CAGGCCCAGGAGTGGGGCTGGGG - Intergenic
1132670751 16:1101453-1101475 CAGGCTGGGGAATGAGGTGGAGG - Intergenic
1132722034 16:1321219-1321241 CAGGCGGAGCAGTGGGGGGTCGG - Intronic
1132725954 16:1338456-1338478 CAGGCGGGGGGGTGGGGGGGTGG - Intronic
1132730000 16:1356492-1356514 CAGGCGGAGGGGAGGGGCCGTGG + Intronic
1132755979 16:1485767-1485789 CATCCTGGGGAGTGGGGAGGTGG - Intergenic
1132783487 16:1641762-1641784 CAGGCTGTGGAGTAGGGTGGCGG - Intronic
1132819734 16:1858467-1858489 GAGGCCGAGCAGTGGGGAGGAGG - Intronic
1132975034 16:2706831-2706853 CAGGCTGAGGTGCAGGGCCGAGG + Intronic
1132976095 16:2711881-2711903 GAGACTGAGGGATGGGGCGGAGG + Intergenic
1133229806 16:4361133-4361155 CAGGCTCAGGAATGGGGCTGGGG - Intronic
1133255270 16:4512706-4512728 CAGGCTGAGGCCTGCTGCGGAGG + Intronic
1133379233 16:5316023-5316045 CAAGGAGAGGAGTAGGGCGGGGG - Intergenic
1134222580 16:12366582-12366604 CAGGCTGGTGAGTGGGTGGGAGG - Intronic
1135024075 16:18985818-18985840 CAGTCCGTGGGGTGGGGCGGGGG + Intronic
1135285241 16:21187618-21187640 CTGGTTGAGGGTTGGGGCGGGGG - Intergenic
1135315978 16:21444673-21444695 CAGTCCGTGGGGTGGGGCGGGGG - Intronic
1135368903 16:21876935-21876957 CAGTCCGTGGGGTGGGGCGGGGG - Intronic
1135442913 16:22494208-22494230 CAGTCCGTGGGGTGGGGCGGGGG + Intronic
1135496733 16:22958412-22958434 CAGACAGAGGAGTGGGGAGGAGG - Intergenic
1136081759 16:27856850-27856872 TTGGGTGAGGAGTGGGGTGGTGG + Intronic
1136141919 16:28293482-28293504 AAGGCTAGGGAGTGGGGTGGGGG - Intronic
1136296872 16:29308891-29308913 CAGGCAGAGGAGACGGGCAGAGG - Intergenic
1136312654 16:29423408-29423430 CAGACCGTGGGGTGGGGCGGGGG - Intergenic
1136326088 16:29525157-29525179 CAGTCCGTGGGGTGGGGCGGGGG - Intergenic
1136440777 16:30265141-30265163 CAGTCCGTGGGGTGGGGCGGGGG - Intergenic
1136856257 16:33661066-33661088 TAGGCTGAGGAGTGGGGATAGGG - Intergenic
1137462917 16:48681856-48681878 AAGCCTGAGGAGAGGGGCTGTGG + Intergenic
1137486768 16:48897792-48897814 GATGCTGAGGAGTGGGGAGGAGG + Intergenic
1137673564 16:50292832-50292854 CAGGGTGAGGAGTGGGGGCCGGG - Intronic
1137805182 16:51297867-51297889 CAGAATGAGGAGTGGGGTGGAGG + Intergenic
1138025496 16:53519277-53519299 CTGGCTGTGGAGTGGGGACGTGG - Intergenic
1138496989 16:57415055-57415077 CAGGGAGAGGAGCGGGGCAGGGG - Intronic
1138529489 16:57627342-57627364 CAGGCTGAGGCCTGGGGTGCTGG + Intronic
1138573439 16:57890960-57890982 AAGGCTGAGGTGTGGGTGGGAGG - Intronic
1138581159 16:57941266-57941288 GAGTCTGAGGGGTGGGGAGGGGG - Intronic
1139258176 16:65563456-65563478 GAGGCTGGGGTGGGGGGCGGGGG - Intergenic
1139328938 16:66172828-66172850 CAGACAGAGGAGTGGGGCCAAGG + Intergenic
1139468334 16:67165700-67165722 CCGTCTGGGGAGTGGGGCGTGGG - Exonic
1139548035 16:67658876-67658898 CAGGGTGAGGAGTTGGGCAAGGG - Intronic
1139887292 16:70217460-70217482 CAGTCCGTGGGGTGGGGCGGGGG - Intergenic
1140479147 16:75253222-75253244 CAGGCTGAGGAGTGGGTGGCTGG - Intronic
1140790496 16:78386626-78386648 CAGGCTGGGGGGTGGGGCGGGGG - Intronic
1140816426 16:78625241-78625263 GAGGCTAAAGAGTGGGGCTGGGG - Intronic
1141054518 16:80803705-80803727 CCGGCGGGGGTGTGGGGCGGGGG - Intronic
1141201885 16:81904569-81904591 CAGGCTGGGCAGGGTGGCGGGGG - Intronic
1141783478 16:86181587-86181609 CAGGCTGAGGGTTGGGGAGCTGG - Intergenic
1141828603 16:86497476-86497498 CAGGCTGAATGGAGGGGCGGGGG - Intergenic
1141995157 16:87632300-87632322 CAGGCAGAGGAGGGTGGGGGAGG - Intronic
1142030881 16:87837971-87837993 CGTGCTGAGTTGTGGGGCGGTGG - Intronic
1142189440 16:88711074-88711096 CGGGTTGAGGAGTGGGGTGTTGG + Intronic
1142262825 16:89050712-89050734 CAGGCTCAGGGGTGGGGGGCGGG - Intergenic
1203117842 16_KI270728v1_random:1509544-1509566 TAGGCTGAGGAGTGGGGATAGGG - Intergenic
1142960182 17:3547706-3547728 CAGGCGGTGGAGGGGGGCAGCGG + Intronic
1144148462 17:12420644-12420666 CTGGATGTGGAGTGGGTCGGGGG + Intergenic
1145901763 17:28494521-28494543 CAGGCTGAGGAGGGGGCTGGGGG - Intronic
1146034132 17:29390930-29390952 GAGGGTGAGGAGTGAGGAGGAGG - Exonic
1146744193 17:35313714-35313736 CAGGCAGAGCACTTGGGCGGTGG + Intergenic
1147050074 17:37787596-37787618 CAGGCTGAGGGATGTGGCAGAGG - Intergenic
1147155276 17:38541616-38541638 GAGGCTGAGGAGTGGGGCACAGG + Intronic
1147743005 17:42679308-42679330 CAGGGCGGGGGGTGGGGCGGGGG + Exonic
1147775988 17:42901616-42901638 GAGGCTGAGGTGAGAGGCGGAGG + Intronic
1148071959 17:44913874-44913896 AAGGCTGAGGAATGGGGAGAAGG - Intronic
1148407012 17:47424206-47424228 CAGGCTGTGCAGGGGGGCTGCGG + Intronic
1148742428 17:49900395-49900417 ATGTCTGAGGAGTGGGGCTGAGG - Intergenic
1148861377 17:50606032-50606054 CAGGCTCAGAGGTGGGGCTGTGG + Intronic
1149431067 17:56595920-56595942 CAGGCTGGGCCGAGGGGCGGGGG + Intergenic
1149627329 17:58089007-58089029 GAGGCTGAGGGATGGGGTGGGGG + Intronic
1150130641 17:62666990-62667012 CAGTCTGGGGAGGGGGGTGGAGG - Intronic
1150987419 17:70213944-70213966 CAGGCAGAGGAGTGCTGCAGGGG + Intergenic
1151156929 17:72131369-72131391 AAGGCTGAGGGGTGGGGCATTGG - Intergenic
1151278973 17:73057648-73057670 CAGGCTGAGGCCAGGCGCGGTGG + Intronic
1151322442 17:73360005-73360027 CAGGCTGAGAGGTGGGGAGGTGG - Intronic
1151408864 17:73907507-73907529 CAGGCTGGGGGCTGGGGCTGGGG - Intergenic
1151491116 17:74432676-74432698 CCGGCTGGGGACTGGGGGGGTGG + Intronic
1151580188 17:74973020-74973042 AAGGGTGAGGACCGGGGCGGGGG - Intronic
1151804912 17:76399252-76399274 GAGACTGAGGAGTGGTGCAGAGG - Intronic
1152473392 17:80502850-80502872 CCAGCTGAGGTGTGGGGCAGAGG - Intergenic
1152626653 17:81390719-81390741 CAGGCAGATGGGTGGGGTGGGGG + Intergenic
1152654615 17:81513979-81514001 CAGGCTGGGGGGCGGGGCCGGGG + Intronic
1152655606 17:81517930-81517952 CAGGCTGTGGCCTGGGACGGTGG - Intronic
1152743824 17:82030284-82030306 AAGGCTGGGGAGTGAGGCGAGGG - Intronic
1152965734 18:112090-112112 CAGGCGGCGGGGTGGGGCGGTGG + Intergenic
1152992753 18:377863-377885 CCTGGTGAGGAGTGGGGCTGGGG + Intronic
1153632720 18:7087491-7087513 CATCCTGAGGAGTGGGCCAGGGG - Intronic
1154121727 18:11657730-11657752 GGTGCTGAGGAGTGGGGCTGAGG - Intergenic
1155152837 18:23136003-23136025 CAGGACGCGGAGTGGGGCGGTGG + Exonic
1155378462 18:25188884-25188906 GAGGCTGAGGATTGTGGCTGAGG - Intronic
1156292403 18:35759452-35759474 GAGGCTGGGGAGGGGGGAGGGGG + Intergenic
1157116572 18:44867723-44867745 CAGGATGGGGAATGGGGGGGTGG + Intronic
1157567405 18:48688992-48689014 GGGGCTGAGGAGTGGGGCCCCGG - Intronic
1157583493 18:48786962-48786984 CAGGCTGAGTGGTGGGGTAGGGG - Intronic
1157618335 18:49001168-49001190 TGGGCTGTGGGGTGGGGCGGAGG + Intergenic
1157712993 18:49862894-49862916 CTGGCTGGGGAGGGGGGTGGGGG - Intronic
1158610358 18:58935086-58935108 GAGGAGGAGGAGTGGGGAGGAGG - Intronic
1158610364 18:58935102-58935124 GAGGAGGAGGAGTGGGGAGGAGG - Intronic
1158610370 18:58935118-58935140 GAGGAGGAGGAGTGGGGAGGAGG - Intronic
1158610376 18:58935134-58935156 GAGGAGGAGGAGTGGGGAGGAGG - Intronic
1158610382 18:58935150-58935172 GAGGAGGAGGAGTGGGGAGGAGG - Intronic
1158610388 18:58935166-58935188 GAGGAGGAGGAGTGGGGAGGAGG - Intronic
1158725730 18:59969760-59969782 CAGGCTGTGCAGGGGGGCGGCGG + Intergenic
1160072761 18:75642987-75643009 CAGGCTGCGGAGTGGACAGGAGG + Intergenic
1160284097 18:77523217-77523239 CAGGCTGAGCCATGGGGCTGGGG + Intergenic
1160325328 18:77941686-77941708 GAGGGTGAGGGGTGGGGAGGTGG - Intergenic
1160667972 19:342160-342182 CAGACGGAGGAGTGGGGTGCTGG - Intronic
1160752519 19:741224-741246 CAGGGTGAGGATGGGGCCGGGGG + Intronic
1160769122 19:822370-822392 CGGGCGGAGGCGCGGGGCGGGGG - Intergenic
1160791940 19:927205-927227 CAGGCAGGGGTGGGGGGCGGAGG - Intronic
1161038488 19:2097973-2097995 CAGGCTGAGGGGCGTGCCGGTGG + Intronic
1161075327 19:2282428-2282450 CAGGCTGGGGTGCGGGGCAGTGG + Intronic
1161335165 19:3709036-3709058 CAGGGTGAGGGGTTGGGGGGCGG - Intronic
1161408465 19:4103152-4103174 CAGGCTGTGGGGAGGGGCCGAGG - Intronic
1161438776 19:4279211-4279233 CAGGGGGAGGGGAGGGGCGGGGG + Exonic
1161494959 19:4581577-4581599 CCGGCTGGGGAGGGGGGCTGGGG + Intergenic
1162261836 19:9540249-9540271 AAGGCAGTGGAGTGGGGTGGGGG - Intergenic
1162340049 19:10086695-10086717 CAGCCTAAGGTGTGGGGGGGCGG - Intronic
1162349020 19:10137699-10137721 AAGGCTGAGGACTCGGGAGGAGG + Intronic
1162525548 19:11204146-11204168 GGGGATGAGGAGTGGGGCTGAGG + Intronic
1163005282 19:14393570-14393592 CAGGAAGAGGAGTGGTGCAGAGG + Intronic
1163026037 19:14512918-14512940 CAGTGTGAGGAGTGGGACGGTGG - Intergenic
1163047921 19:14658597-14658619 CAGGCAGAGGGGTGGGCAGGTGG + Intronic
1163329582 19:16627987-16628009 CGGGCTGAGGCGGGGGACGGGGG + Exonic
1163415395 19:17183421-17183443 CAGGATGCCGAGTGGGGCGGAGG - Intronic
1163586794 19:18168707-18168729 CTGGCTGGGGTGGGGGGCGGTGG - Exonic
1163633737 19:18429230-18429252 GAGGCGGGGGAGGGGGGCGGGGG + Intronic
1163769261 19:19180729-19180751 CAGGCTGAGGAGGGCGGGGGTGG + Exonic
1163848826 19:19652280-19652302 GAGGCTGGGGAGTTGGGTGGGGG - Intronic
1164531861 19:29054976-29054998 CAGGATGAGGAGTGGAGGTGGGG - Intergenic
1164650169 19:29885731-29885753 CAGGCTCAGGAGCTGGGAGGGGG - Intergenic
1165086385 19:33350989-33351011 CAGACTGGGGAGGGGGGTGGGGG + Intergenic
1165760505 19:38318762-38318784 CTGGCAGAGGAGTGGGGCTTGGG - Intergenic
1165902542 19:39175435-39175457 CAGGGTGAGGGGACGGGCGGCGG + Exonic
1165914142 19:39247667-39247689 CTGGCGGGGGAGAGGGGCGGCGG + Intergenic
1166790495 19:45396110-45396132 AAGGTCGAGGAGTGGGGTGGGGG - Intronic
1166936243 19:46334951-46334973 CAGGTTCAGGAGTGGGGTGCTGG - Exonic
1167037163 19:47001318-47001340 AAGGCTGTGGAGTGGGACGGTGG - Exonic
1167120207 19:47512285-47512307 CTTGCTGGGGAGTGGGGCCGGGG - Intronic
1167483417 19:49746538-49746560 CAGGCTGGGGAATGGGGCCTCGG - Exonic
1167612556 19:50514427-50514449 GAGGCTGTGGACAGGGGCGGAGG - Intronic
1167648719 19:50718797-50718819 CCGGCCGGGGAGAGGGGCGGGGG + Intronic
1168039298 19:53745400-53745422 CAGGTTTAGGTGGGGGGCGGAGG - Intergenic
1168041212 19:53760466-53760488 CAGGCTTAGGTGGGAGGCGGAGG - Intergenic
1168287538 19:55342113-55342135 CAGGCTAAGGAGAGGGCCGAGGG - Intronic
1202711957 1_KI270714v1_random:23812-23834 GAGGCTGAGGCGCGGGGTGGGGG - Intergenic
925169781 2:1743754-1743776 CAGGACGAGGAACGGGGCGGAGG + Intronic
925436455 2:3842426-3842448 CAGGGTGAGGAAGGGGGTGGTGG + Intronic
925900712 2:8507545-8507567 CAGGTTGAGGAGGGTGGGGGAGG - Intergenic
926288792 2:11511931-11511953 CAGTCAGAGGAAAGGGGCGGTGG - Intergenic
926671190 2:15578400-15578422 GAGGCTGGGGAATGGGGCAGGGG - Intergenic
927095777 2:19746850-19746872 CTGGCTGGGGGTTGGGGCGGGGG - Intergenic
927441079 2:23118405-23118427 CAGGCTGAGGTGTGGGTTGCAGG - Intergenic
927787126 2:25981939-25981961 CAGGCTGCGGAGGGGCTCGGGGG - Exonic
927929026 2:27032419-27032441 GAGGCTGAGGGGTGGGGGTGGGG + Intergenic
928363450 2:30683969-30683991 CAGTATGTGGAGTGGAGCGGAGG - Intergenic
928363570 2:30684943-30684965 GGGGCTGGGGAGTGGGGAGGGGG + Intergenic
928366532 2:30707151-30707173 CAGCCTGAGGAGGAGGGCTGTGG + Intergenic
928402006 2:30985814-30985836 AAGGCTGAGGGGAGGGGAGGGGG - Intronic
929314830 2:40464666-40464688 CAGTCTGAGAAGTGGGGATGTGG + Intronic
929452084 2:42044719-42044741 CAGGCTTAGGTGGGGGGCTGGGG + Intergenic
929711348 2:44270164-44270186 CTGGGTGGGGAGTGGGGCTGGGG - Intergenic
929777383 2:44937727-44937749 GAGGCTAAGGCGGGGGGCGGGGG + Intergenic
930692100 2:54374832-54374854 CACGCAGGGGAGTGGGGCGAGGG - Intronic
931777872 2:65555678-65555700 GAGGCTGAGGAGGGAGGCAGAGG - Intergenic
932140552 2:69273612-69273634 GAGGCTGAGGATTGGGAGGGAGG - Intergenic
932374789 2:71226511-71226533 CAGCCCGGGGAGAGGGGCGGGGG + Intronic
932485656 2:72082787-72082809 CCGGCTGAGGGGTGGGCCGGAGG + Intergenic
932485859 2:72083952-72083974 CAGGCTGCGGAGTGGGACTTGGG + Intergenic
933773260 2:85756828-85756850 CAGGCTGGGGGCTGGGGGGGTGG - Intronic
933813510 2:86048166-86048188 CAGCCTGAGGAGTGGGGAGGAGG - Intronic
933981048 2:87551070-87551092 GAGGCTGAGGTGGGAGGCGGAGG + Intergenic
934103863 2:88678651-88678673 AGGGCTGAGGATTGGGGCAGTGG + Intergenic
934503694 2:94876550-94876572 CAGGCTGTTGAGTGAGGTGGAGG + Exonic
936105071 2:109615819-109615841 TCGGCTGAGGGGTGGGTCGGAGG + Exonic
936312784 2:111399715-111399737 GAGGCTGAGGTGGGAGGCGGAGG - Intergenic
936538731 2:113332981-113333003 CAGACTGAGGTGTGGGGTGCAGG + Intergenic
937061477 2:118983244-118983266 CAGGCAGAGGACAGGGGTGGAGG - Intronic
937123100 2:119454233-119454255 CAGGCGGCAGAGTGGGGCTGGGG + Intronic
937292027 2:120787546-120787568 CAGGCTGAGGGCTGGGGTGAAGG - Intronic
937867650 2:126766058-126766080 CAGGCTGTGGAATTGGGGGGTGG + Intergenic
937917246 2:127105402-127105424 CAGGTTGTGGGGTGGGGGGGTGG - Intronic
938726501 2:134113408-134113430 AAGACTGAGGAGGGGGGAGGGGG - Intergenic
939815702 2:146894382-146894404 CATGCTGAGGAGTTGGGGTGGGG - Intergenic
940105683 2:150097282-150097304 GAGGCTGAGGCATGAGGCGGAGG - Intergenic
940360436 2:152790848-152790870 TAGGCACAGGTGTGGGGCGGCGG - Intergenic
942455730 2:176137010-176137032 CATGCTGGGGAGCGGGGAGGGGG - Intergenic
942617488 2:177809097-177809119 CAGGCTGAAGAGAGGGGAGTGGG + Intronic
942654863 2:178204704-178204726 CAGGCAGAGGAGTGAAGTGGAGG + Intronic
945129321 2:206551334-206551356 CAGTCTGGGGAGTGTGGCAGTGG - Intronic
946043271 2:216800644-216800666 CAGGCTGGGGAGTGGTGGGAAGG - Intergenic
946194422 2:218024633-218024655 CTGGCTGATGTGTGGGGCAGGGG - Intergenic
946332217 2:219016872-219016894 GAGGCTGAGGAGGCGGGCAGGGG - Intronic
946337698 2:219049533-219049555 CAGGCTGAGGTGTGGGAGGTGGG + Intergenic
946633846 2:221702275-221702297 AAAGCTGAGGATGGGGGCGGGGG + Intergenic
946679085 2:222194575-222194597 CAGGCTGAGGACTCGAGCAGAGG - Intergenic
946779569 2:223179023-223179045 AAGGCTGGGGAGTGGGGGTGGGG + Intronic
946966573 2:225042757-225042779 CAGGCTGCGGGGGAGGGCGGGGG + Intergenic
947200877 2:227613507-227613529 TTGGGTGAGCAGTGGGGCGGGGG - Intronic
947807060 2:232976347-232976369 GAGGAAGAGGAGTGGTGCGGTGG - Intronic
948483852 2:238267684-238267706 GAGGCTGAGGCATGGGGCAGGGG + Intronic
948627032 2:239275719-239275741 CAGCCTGAGGGGTGGGGAGTGGG - Intronic
948658655 2:239492610-239492632 AAGGCTGTGCAGGGGGGCGGAGG + Intergenic
948702460 2:239768794-239768816 CGGGCTGTGGAGTGGGGCCCAGG + Intronic
948711273 2:239827249-239827271 CAGGCCAAGGACTGGGGCAGGGG - Intergenic
948765389 2:240216672-240216694 CAGGGTGAGGGGTGGGGGTGGGG + Intergenic
948765578 2:240217089-240217111 CAGGGTGAGGGGTGGGGGGGTGG + Intergenic
948777867 2:240299239-240299261 CAGGCTGAGGAGCCCGGAGGAGG - Intergenic
949058289 2:241941818-241941840 CGGGCTTAGGGGTGGGGTGGTGG + Intergenic
1168952623 20:1812746-1812768 GAGGCCGAGGGGTGGGGGGGGGG + Intergenic
1169132152 20:3171959-3171981 CAGGTTGAGGGGTGGGTTGGAGG - Intronic
1169171778 20:3471137-3471159 AAGGCTGAGGAGGAGGACGGCGG + Exonic
1169197025 20:3688833-3688855 CAGGCTTGGGAGTGGGGAAGAGG + Intronic
1169244488 20:4015230-4015252 CAGGCTGAGGAGGGACGCGGAGG - Intronic
1169557864 20:6768658-6768680 AAGGCCGAGGAGTGGAGGGGCGG - Exonic
1169908083 20:10623786-10623808 CAGGCTGAGGAGCAGGGGGATGG - Exonic
1170628566 20:18048621-18048643 GAGGCTGAGGTGGGGGGCGGCGG + Intronic
1170665631 20:18383714-18383736 CTGGCTGAGGAGAGAGGTGGTGG + Exonic
1170778839 20:19405116-19405138 GAAGCTGGGGATTGGGGCGGGGG - Intronic
1171276128 20:23857955-23857977 CAGATTGGGGGGTGGGGCGGGGG - Intergenic
1171370699 20:24660523-24660545 GTGGCTGACGAGTGGGGAGGAGG - Intronic
1171780107 20:29410380-29410402 CTGGCTGAGGAGTGGTTCAGCGG + Intergenic
1172100804 20:32483288-32483310 CAGCCGGAGAAGGGGGGCGGCGG + Intronic
1172329183 20:34062852-34062874 AAGGCATAGGAATGGGGCGGGGG + Intronic
1172644084 20:36459087-36459109 CAGGCTGGGGATTAGGGAGGGGG + Intronic
1172811232 20:37649727-37649749 GAGGCTGAGGGTTGGGTCGGGGG + Intergenic
1172842718 20:37911661-37911683 CAGGATGGGGAGAGGGGCTGGGG + Intronic
1173433263 20:43010200-43010222 CAGGCTGATGATTGGGGGGATGG - Intronic
1173617110 20:44410484-44410506 CAGGCTGAGGAGGGGTGGTGGGG - Intronic
1173750089 20:45469810-45469832 CAGGCTGAGGAGGAGGGCGGCGG - Exonic
1173755848 20:45515469-45515491 CAGGCTGGGGGGCGGGGTGGTGG - Intronic
1173782962 20:45771774-45771796 GAAGCTGAGGAGCAGGGCGGGGG + Intronic
1173870930 20:46341707-46341729 CAGGCTGGGAAGTGGGGATGGGG + Intergenic
1174505527 20:51015227-51015249 CTGGCTGAGGAATGGGGCCTGGG + Intronic
1174761416 20:53210405-53210427 CTGGATGAGGAGTTGGGAGGGGG + Intronic
1175299541 20:57933243-57933265 CAGGCAGGGGAGAGGGGCTGAGG - Intergenic
1175738525 20:61404244-61404266 CAAGCAGAGGAAGGGGGCGGGGG - Intronic
1176085314 20:63293123-63293145 CAGGCCGAGGGGTGGGTCGGGGG + Intergenic
1176098866 20:63356113-63356135 CAGGGTGAGGGGTGTGGGGGAGG + Intronic
1176098951 20:63356313-63356335 CAGGGTGAGGGGTGTGGGGGAGG + Intronic
1176233082 20:64041876-64041898 CAGGCTGGGGTGGGGGCCGGTGG - Intronic
1176254131 20:64141714-64141736 AAGGCTGAGGCGGGGCGCGGTGG + Intergenic
1178007611 21:28240653-28240675 CAGGCTGTGGAGGAGGGAGGAGG - Intergenic
1178846683 21:36179963-36179985 CAGGCAGAGGAGAGGGGCAAAGG - Intronic
1178883383 21:36465846-36465868 CAGGCTGAGTAGTGGTGGGAAGG + Intronic
1178926653 21:36780931-36780953 CAGCCTGGGGGGTGGGGGGGTGG - Intronic
1178983589 21:37284708-37284730 GAGGCTGAGGTGGGTGGCGGAGG - Intergenic
1179313686 21:40221249-40221271 CAGGCTGGGTAGTGTGGTGGTGG - Intronic
1179453699 21:41483531-41483553 GAGGCCGAGGTGGGGGGCGGAGG - Intronic
1179788900 21:43744213-43744235 CAGGCTAGGGAGTGGGGGGAGGG + Intronic
1179987014 21:44927681-44927703 CAGGCTGGGGGCAGGGGCGGGGG + Intronic
1180051194 21:45331743-45331765 CACGCTGTGGAGTGTGGCAGAGG + Intergenic
1180085627 21:45506829-45506851 CAGGCCTAGGAGGGGGCCGGTGG - Intronic
1180102376 21:45594901-45594923 CAGGCAGGGGAGTGGGAGGGAGG - Intergenic
1180102408 21:45594998-45595020 CAGGCAGGGGAGTGGGAGGGAGG - Intergenic
1180102421 21:45595031-45595053 CAGGCAGGGGAGTGGGAGGGAGG - Intergenic
1180152940 21:45961342-45961364 CAGGCAGAGGAGTGCTGCAGCGG - Intergenic
1180635968 22:17263258-17263280 CAGACAGAGCAGTGGGGAGGTGG + Intergenic
1180981346 22:19879535-19879557 CAGGATGTGGTGGGGGGCGGGGG + Intronic
1181637426 22:24180947-24180969 CAGGCTGAGCCCTGGGGCGGAGG - Intergenic
1182257379 22:29048960-29048982 CAGGCAGAGCAGTGGGGAGTTGG + Intronic
1182275641 22:29186870-29186892 GAGGCTGAGGAGTGGGGTGGGGG + Intergenic
1182439819 22:30356704-30356726 CAGGCTGAGGGGCGGGGGAGAGG + Exonic
1182443923 22:30379536-30379558 CAGGCTGAGGACCGGGGTGCAGG + Exonic
1182977865 22:34640371-34640393 CAGGCTGAGGACTCGGGGGCAGG + Intergenic
1183132600 22:35853731-35853753 CAGGCGGTGGAATGGGGTGGTGG + Intronic
1183233217 22:36596142-36596164 CGAGCTGAGGCGTGGGGAGGAGG + Intronic
1183314043 22:37127572-37127594 CAGGCTGAGAAGTGGGGCTGAGG + Exonic
1183318551 22:37149825-37149847 CTGGCTGAGACATGGGGCGGTGG + Exonic
1183387484 22:37523442-37523464 GAGGATGAGGAGTGGAGCAGGGG + Intergenic
1183498076 22:38161797-38161819 CAGGCTGAGGGGAGGGAAGGAGG + Intronic
1183519158 22:38286510-38286532 CAGCCAGAGGAGTGGGGCATCGG - Intergenic
1183545791 22:38454424-38454446 CAGGCTGGGGAGGGAGGCAGAGG - Intronic
1183777296 22:39974920-39974942 GAGGCTGAGGAGGGAGGCAGGGG - Intergenic
1183831953 22:40422929-40422951 CAGGCAGAGGTGTGGGGCTGGGG + Intronic
1183947628 22:41335708-41335730 CAGGCTCAGGTGTGGGAAGGAGG + Intronic
1183994230 22:41620956-41620978 CGGGCTGAGGGGTGGGGGAGAGG + Exonic
1184151702 22:42643441-42643463 CAGGGTGGGGGGTGGGGGGGCGG - Intronic
1184462751 22:44648636-44648658 CAGCCTGAGGTCTGGGGCCGAGG - Intergenic
1184533355 22:45070762-45070784 CAGGGTGAGGGGTAGGGCAGGGG - Intergenic
1184564538 22:45284440-45284462 GAGGCTGGGGGGTGGGGCAGGGG - Intergenic
1184853642 22:47135058-47135080 CCAGCTGGGGACTGGGGCGGGGG - Intronic
1184901437 22:47448810-47448832 CATGCAGAGGAGTGCGGCCGTGG + Intergenic
1184911835 22:47540366-47540388 CTGGCTGGGGGGGGGGGCGGGGG - Intergenic
1185004654 22:48268610-48268632 CAGGCTGTCCCGTGGGGCGGAGG - Intergenic
1185024275 22:48398726-48398748 AAGGCTGAGCAGTGGGCAGGAGG - Intergenic
1185051676 22:48557354-48557376 CAGGCTGAGGAGGGCGGCGCCGG + Intronic
1185274562 22:49944724-49944746 CAGCCTGAGGTCTGGGGTGGAGG - Intergenic
1185285468 22:49997947-49997969 CAGGGCGGGGAGTGGGGCAGGGG - Intronic
1185373858 22:50473248-50473270 TGGGCTGAGGGCTGGGGCGGGGG - Intronic
949959756 3:9302317-9302339 CAGGCTGGGGAGGGGTGAGGGGG - Intronic
950061938 3:10078860-10078882 GAGGCTGAGGCATGGGGAGGAGG + Intronic
950112193 3:10426430-10426452 CAGGCTGAAGACTGGGGAGCTGG + Intronic
950203477 3:11060972-11060994 CAGGCTGGAGAGCGGGGCGCGGG + Intergenic
950215113 3:11153758-11153780 CAAGGGGAGGAGTGGGGTGGGGG - Intronic
950259250 3:11532073-11532095 CAGGGTGGCGTGTGGGGCGGAGG - Intronic
950487142 3:13280615-13280637 CAGGGTGAGCAGTGAGGCTGTGG - Intergenic
950886583 3:16367734-16367756 CAGGTTGAAGAGTGGGGTGACGG + Intronic
952564160 3:34635060-34635082 CAGGCTGTGCAGTGGGGGTGTGG + Intergenic
952708599 3:36406149-36406171 CAGGCTGCTGGGTGGGGAGGGGG - Intronic
952883480 3:37999199-37999221 CAGGATGAGGAAAGGGGCGTGGG + Intronic
952902817 3:38121121-38121143 GAGGCTGAGCAGTGGAGCCGAGG + Intronic
953169012 3:40490588-40490610 CAGGCTGAGAAGGGGAGAGGAGG - Intergenic
953237644 3:41120294-41120316 GAGGCTGGGGAGTGGGGAGAAGG - Intergenic
953350012 3:42208460-42208482 CAGGCCGAGGTGGGAGGCGGTGG - Intronic
953409760 3:42684127-42684149 CAGGCGGGGGAGTGGGGGAGGGG - Intergenic
953661705 3:44895511-44895533 CAGGCAGAGCTGTGGGGAGGGGG + Intronic
954109339 3:48425427-48425449 CAGGCTGGGCGGTGGGGAGGGGG - Intronic
954176147 3:48847420-48847442 CAGGCTCTGGCGTGGGGTGGCGG + Exonic
954290770 3:49648870-49648892 CAGGCAGAGGAATGGGGCAGTGG - Intronic
954434752 3:50490073-50490095 CAGGCTGTGGAGTGGGCGGCAGG + Intronic
954713132 3:52514682-52514704 CAGGCTGGGGAGAGGGATGGAGG - Exonic
954872834 3:53780780-53780802 CAGGCTGAGGAGTGACCAGGAGG + Intronic
955204405 3:56882556-56882578 CAGGCTGGGGTGCGGTGCGGTGG + Intronic
956192705 3:66622456-66622478 GAGGCTGAGGAGAGAGGCAGGGG - Intergenic
956420455 3:69081447-69081469 AAGGCTGAAGGGTGGGGTGGCGG - Intergenic
956726918 3:72163833-72163855 CAGCCAGAGGGGTGGGGCAGGGG + Intergenic
957576126 3:82010513-82010535 AAGGCTGTGGGGTGGGGGGGGGG + Intergenic
958035905 3:88170406-88170428 GAGGCTGGGGGGTGGGGGGGGGG + Intergenic
958466818 3:94469979-94470001 CAGGCTTCAGGGTGGGGCGGTGG + Intergenic
958963853 3:100536835-100536857 CAGGCTGGGGTGTGGGGCCAGGG - Intronic
961015527 3:123465423-123465445 CAGGTTGGGGAGTGGGGCTGTGG - Intergenic
961018063 3:123482466-123482488 CAGGCTGTAGGGTGGGGTGGGGG + Intergenic
961086962 3:124076452-124076474 GAGGGTGTGGTGTGGGGCGGTGG + Intergenic
961200214 3:125039456-125039478 GAGGCTGAGGTGTGGGGGTGGGG - Intronic
961555049 3:127691585-127691607 CAGGCTTTGCAGAGGGGCGGGGG - Exonic
961715458 3:128854293-128854315 GAGGCTGAGCAGTGGGGCAGTGG - Intergenic
961809706 3:129514773-129514795 CAGGCTGAGGGCTGAGGCCGGGG - Intronic
962169241 3:133083185-133083207 CAGGCTGAGGAGTGGGGCGGCGG - Intronic
962205051 3:133427562-133427584 CTGGCTGAGGAGCAGGGAGGTGG - Intronic
962793151 3:138829588-138829610 CAGGATGGTGAGTGGGGCAGCGG + Intronic
963188827 3:142447245-142447267 CCAGCTGGGGAGTGGGGCGTAGG - Intronic
967312403 3:188118256-188118278 CAGGCAGAGGATTGGGGCTAAGG + Intergenic
968123127 3:196140417-196140439 CGGGCAGAGGTGGGGGGCGGGGG - Intergenic
968235755 3:197029379-197029401 CGGGCTGAGGCGTGGTGGGGAGG - Intronic
968439279 4:613370-613392 CACACTGAGGAGTGGGGCCACGG + Intergenic
968456134 4:700950-700972 CAGGGAGAGGAGCTGGGCGGAGG - Intergenic
968487637 4:871579-871601 CAGGCTGAGCTGTGGGGAGCAGG + Intronic
968848239 4:3059671-3059693 GAGGCTGAGGAGGGAGGTGGAGG - Intergenic
969056998 4:4408289-4408311 CAGGCTGCTGGGAGGGGCGGTGG + Intronic
969131116 4:4991729-4991751 CCGTCTGTGGAGTGGGGCAGTGG + Intergenic
969364378 4:6685703-6685725 CAGGCTGAGGCCTGGAGCAGAGG - Intergenic
969367963 4:6710482-6710504 CAGGCTGACAGGAGGGGCGGAGG - Intergenic
969457736 4:7309780-7309802 CAGGCTGGGGAGAGGGCCTGAGG + Intronic
969517275 4:7654707-7654729 CAGGCTGAGCAGTGGAAGGGGGG - Intronic
969618351 4:8266615-8266637 CAGGCTGATGGGTGGGGGGTGGG - Intergenic
971609144 4:28700021-28700043 CAGATTGAGGCCTGGGGCGGTGG + Intergenic
972762363 4:42119438-42119460 CAGGCAGAGGGGTGGGAAGGAGG - Intronic
973806090 4:54527490-54527512 AAGCGTGAGGAGTGGGGCGGCGG - Intergenic
974779156 4:66528965-66528987 CAGGCAGAGGTGTAGGGCAGAGG + Intergenic
975199604 4:71570903-71570925 AAGGTTGAGGAGTGGGGCTGGGG + Exonic
975471394 4:74773006-74773028 GAGGCAGAGTACTGGGGCGGAGG + Intronic
976258618 4:83124813-83124835 CAGGCAGAGGAGAGGAGAGGAGG + Intronic
976398440 4:84582724-84582746 GAGGCTGAGGAGCTGGGAGGCGG - Intergenic
977290732 4:95161857-95161879 GAGGCTGAGGGGAGGGGTGGGGG + Intergenic
977578142 4:98696458-98696480 CAGGCTGGGGAGTGGGAAGAGGG + Intergenic
977891707 4:102319619-102319641 CAGGGGTAGGAGTGGGGAGGGGG - Intronic
979491696 4:121335590-121335612 CGGGGAGAGGAGTGGGGCAGGGG + Intronic
980893470 4:138838786-138838808 CAGGGTAAGGAGAGGGGCGCGGG - Intergenic
981567504 4:146116095-146116117 TATTCTGAGGAGTGGGGTGGTGG + Intergenic
982066282 4:151657471-151657493 CAGAGTGAGGAGTGGGGGTGGGG + Intronic
982217342 4:153093984-153094006 CAGGCTGAGGAGAGCAGGGGAGG - Intergenic
983233435 4:165152439-165152461 GAGGCTGGGGCGGGGGGCGGGGG - Intronic
983353041 4:166618691-166618713 AAGGCGGGGGAGGGGGGCGGGGG + Intergenic
983679876 4:170341369-170341391 GAGGCTGAGGAAGGAGGCGGAGG - Intergenic
984463016 4:180059239-180059261 GAGGCTGAGGAGAGAGTCGGTGG - Intergenic
984706540 4:182851266-182851288 CACTCTGAGGAGTGGAGGGGGGG - Intergenic
984942904 4:184950124-184950146 CAGGCTGCGGAGTGGGGGGGGGG + Intergenic
985007638 4:185549943-185549965 CAGGAGGAGGAGTGTGGGGGAGG + Intergenic
985011574 4:185587967-185587989 CCTGCTGAGGAGGGGGGCGGAGG + Intronic
985244976 4:187971260-187971282 AAGGCTGGGGTGTGGGGCGGAGG - Intergenic
985384819 4:189434389-189434411 CAGACAGGGGACTGGGGCGGGGG - Intergenic
985397539 4:189559955-189559977 CTTGCTGAGGACTGGGGAGGAGG - Intergenic
985521354 5:375344-375366 CTTGCTGAGCAGTGGGGTGGAGG + Intronic
985526188 5:403197-403219 CGGGCTGAGGAGGGGAGTGGGGG + Intronic
985676192 5:1232413-1232435 CTGGATGAGAGGTGGGGCGGGGG + Intronic
985703498 5:1387408-1387430 CAGGCTGGGGTGAGGGGAGGAGG + Intergenic
985790931 5:1926506-1926528 CAGGCTCAGGGGCGGGGCAGGGG - Intergenic
985790953 5:1926570-1926592 CAGGCTCAGGGGCGGGGCAGGGG - Intergenic
986255104 5:6095869-6095891 CTGGTTGGGGAGTGGGGAGGAGG + Intergenic
986330561 5:6713779-6713801 CGGGCTCCGGCGTGGGGCGGCGG - Intergenic
986713016 5:10501575-10501597 CAGGGTGTGGAGTAGGGCTGGGG - Intergenic
989110378 5:37901745-37901767 CTGGCAAAGGAGTGGGGAGGAGG + Intergenic
989499876 5:42153021-42153043 GATGCTGAGGAGTGGTGGGGTGG + Intergenic
989600233 5:43193459-43193481 CGGGATGAGGAATGGGGTGGGGG - Exonic
990713395 5:58609033-58609055 CATGTTGGGGAGTGGGGAGGAGG + Intronic
991045582 5:62219013-62219035 TAGGCTGAGGAGTGGGGATAGGG + Intergenic
991594488 5:68288628-68288650 CAGGCTGGGGGGAGGTGCGGGGG + Intronic
992111374 5:73497883-73497905 CATTCTGAGGAGTGGGGCTCGGG + Intergenic
992826197 5:80552395-80552417 CAGGCTGAGGAACTGGGGGGCGG + Intergenic
993386398 5:87267954-87267976 CAGGCAGATGAGAGGGGTGGGGG - Exonic
993905725 5:93621273-93621295 CTGGCTGAGGGGCGGGGCGCGGG - Intronic
994171258 5:96662162-96662184 CCGGGTGAGGACCGGGGCGGAGG + Intronic
996483952 5:124008648-124008670 GAGGCTGAGGGGGGGGGGGGTGG + Intergenic
996670295 5:126110194-126110216 CGGGGTGTGGAGTGGGGTGGGGG + Intergenic
997215071 5:132103389-132103411 CAGGCTGAGGCCTGGGCCAGAGG - Intergenic
997222425 5:132180604-132180626 CAAGCTGGGGTGTGGGGAGGGGG + Intergenic
997635379 5:135400187-135400209 CAGCCTGAGGACTGGGGGGTGGG - Intergenic
998007387 5:138666008-138666030 CAGGCCCAGCAGTGGGGCTGAGG + Intronic
998066975 5:139167195-139167217 GAGGCTGAGGCGGGGGGTGGGGG - Intronic
999246953 5:150160122-150160144 CAGGCAGAGTTGTGGGGTGGGGG + Intergenic
999319798 5:150606850-150606872 CAGGCTCAGGAGTTGGGGGCAGG - Intronic
999655609 5:153807753-153807775 CAGGCAGAGGGGAGGGGCAGGGG - Intronic
999711817 5:154324463-154324485 CAGGCAGAGGAGTGAGGAAGAGG - Intronic
1000275328 5:159729163-159729185 CAGGCTGGGGAGGTGTGCGGTGG + Intergenic
1001326769 5:170734047-170734069 CAGGTTGAGGAGTGGAACTGTGG - Intronic
1001384553 5:171328093-171328115 CTGGCTGAGGACTGGGGGTGGGG + Intergenic
1001476978 5:172057531-172057553 CAGGCAGAGGTGGGGGGCAGGGG - Intronic
1001654982 5:173342393-173342415 CAGGCTGAGCAGTGGGCTTGAGG + Intergenic
1001910372 5:175512409-175512431 CAGACTGAGGAGTGCGGGGAGGG + Intronic
1001972507 5:175967898-175967920 CAGGCTAGGGAGAGGGGCCGTGG - Intronic
1002244932 5:177875882-177875904 CAGGCTAGGGAGAGGGGCCGTGG + Intergenic
1002534682 5:179869739-179869761 CTGGCTGGGGAGTGGGCAGGAGG + Intronic
1002562679 5:180092996-180093018 CAGGCAGAGGAGAGGAGCCGAGG - Intergenic
1002799041 6:503861-503883 CAGGCTGAGGAGGAAGGCGAGGG - Intronic
1003133253 6:3413456-3413478 CAGGCTGGGGAAGGGGGCAGAGG + Intronic
1003264345 6:4552351-4552373 TAGGCTGAGGAGTTTGGAGGAGG - Intergenic
1004562476 6:16762568-16762590 CAGGCGGAGGGGCGGGGTGGTGG - Intergenic
1005372898 6:25153693-25153715 CAGGCTGAGAAAAGGGGCAGAGG + Intergenic
1006014782 6:31071509-31071531 GAGGCCGAGGAGGCGGGCGGAGG + Intergenic
1006171953 6:32098069-32098091 CTGGCTGGGGAGGGGGCCGGGGG + Intronic
1006393319 6:33771613-33771635 CAGGCTGAGGAGCTGGCGGGAGG + Exonic
1006405280 6:33841463-33841485 CGGGCTGGGGAGAGGGGCTGTGG + Intergenic
1006425232 6:33959328-33959350 CAGGCTGAAGTGTGGGGGTGAGG + Intergenic
1006509681 6:34515190-34515212 CAGGCTGGGGAGCGGGGTGTGGG + Intronic
1006626412 6:35401199-35401221 CAGGCTGAGGAGTTGAGGGATGG - Intronic
1006981949 6:38154268-38154290 CAGGCAGAGGAGGGGGCGGGGGG - Exonic
1007258070 6:40542398-40542420 CAGGCTGATGGGTGGGCGGGAGG + Intronic
1007397462 6:41585918-41585940 CAGGCTGAGGTAAGGGGAGGTGG - Intronic
1007496839 6:42266001-42266023 CAGCTCCAGGAGTGGGGCGGTGG - Intronic
1007697044 6:43740566-43740588 AAGGCAGTGGAGTGGGGAGGAGG + Intergenic
1007777055 6:44229803-44229825 CAGGCTGGGGGCTGGGGAGGGGG - Intronic
1008382424 6:50849971-50849993 CGGGGTGGGGTGTGGGGCGGGGG + Intergenic
1010249851 6:73696238-73696260 CACGCAGAGGAGGTGGGCGGCGG - Exonic
1010703354 6:79077944-79077966 CAGGCTGAGCGGTCGGGCGGCGG + Intronic
1011128932 6:84034468-84034490 CGGGTTGCGGGGTGGGGCGGCGG - Intronic
1011411697 6:87073317-87073339 GAGGCTGAGGAGGGAGGCGGAGG - Intergenic
1011636978 6:89383631-89383653 TAGGCTGGGGAGCGGGGCTGGGG + Intronic
1013619171 6:111872521-111872543 GAGGTGGAGGAGTGGGGCAGGGG + Intronic
1014661759 6:124181017-124181039 CAGGCTGAGGTGTGCTGCAGCGG - Intronic
1015812273 6:137172647-137172669 CCTGCTGCGGAGTGGGGCCGAGG - Intronic
1016388299 6:143549808-143549830 CATGCTTAGGAGTGGGGGTGGGG + Intronic
1017079975 6:150658743-150658765 CAGGGTGAGGAGCAGGGAGGAGG - Intronic
1017091927 6:150766916-150766938 CAGGATGAGGGGCGGGGCAGGGG - Intronic
1018900514 6:168049680-168049702 CAGGCTCAGGAGAGGAGAGGAGG + Intergenic
1019109536 6:169698773-169698795 AAGGCTGAGGAGAGGGGCCACGG + Intronic
1019215173 6:170438785-170438807 CAGGCTGGGGGGTGGGCTGGAGG + Intergenic
1019229854 6:170550897-170550919 GAGGCTGAGGGGGGGGGGGGGGG + Intronic
1019448978 7:1086707-1086729 CAGGCAGAGGACTGGGGTGCTGG - Intronic
1019725986 7:2602988-2603010 AAGGCTGAGGACTAGGGCAGTGG - Intronic
1020014332 7:4822093-4822115 CAAGCAGAAGAGTGGGGCTGCGG + Intronic
1020016833 7:4836200-4836222 GAGGCTGTGGAGTGGGATGGCGG - Intronic
1020244911 7:6422460-6422482 CAGGCTGCGGAGTGGGCATGGGG + Intronic
1020625493 7:10573682-10573704 CAGGCTCAGGATTGAGGCTGTGG - Intergenic
1021374862 7:19894035-19894057 CCTGCTGAGGAGTGGGGGGCTGG + Intergenic
1021992734 7:26152940-26152962 CAGGCTGTGCAGGGGGGCGGCGG + Exonic
1023010008 7:35917913-35917935 CAGGATGAGGGGTGAGGAGGAGG - Intergenic
1023424640 7:40022601-40022623 ATGGCTGAGGATTGGGGCTGGGG + Intronic
1023484082 7:40665701-40665723 CAGGTTGAGGAGTGGGGATTGGG + Intronic
1024080823 7:45853666-45853688 CAGGATGAGGGGTGAGGAGGAGG + Intergenic
1024964151 7:55006622-55006644 CAGGCTGAGGAGGAGGTCGCTGG + Intergenic
1025069717 7:55887712-55887734 GAGGCGGAGGCGGGGGGCGGAGG + Intronic
1025847941 7:65217290-65217312 CAGGATGGGGGGTGGGGAGGAGG - Intergenic
1025898183 7:65723154-65723176 CAGGATGGGGAGTGGGGAGGAGG - Intergenic
1027134944 7:75617502-75617524 CAGGCTGAGGCTGGGCGCGGTGG - Intronic
1027186044 7:75971501-75971523 CGGGGTGAGGGGTGGTGCGGGGG + Intronic
1027355097 7:77346942-77346964 AAGGCAGGGGGGTGGGGCGGGGG - Intronic
1029137836 7:98387198-98387220 CAGGCGGAGGAGAGGGGCTGCGG + Intronic
1029429115 7:100518066-100518088 CAGGCTGAGGTGGGAGGCTGAGG - Intergenic
1029489217 7:100861308-100861330 CGGGCTCAGGCGTGGGGCTGGGG + Intronic
1029540726 7:101180474-101180496 CCGGCTGGGGAGTGGGACTGAGG + Intergenic
1029606600 7:101602851-101602873 CAGGGTGAGGGGTGGGATGGGGG - Intergenic
1029711793 7:102303866-102303888 TAAGCGGTGGAGTGGGGCGGGGG - Intronic
1029998293 7:105031350-105031372 CCGTCTGAGGATTGGGGGGGTGG + Intronic
1031150848 7:118052536-118052558 CAGGCTGATGAGAGCTGCGGGGG - Intergenic
1031977383 7:128102667-128102689 CTGCCTGAGGAGAGGGGCTGGGG + Intergenic
1032505494 7:132431386-132431408 CTGGCTGAGGAGTGACGAGGAGG - Intronic
1033388115 7:140899201-140899223 TGGGCTGAGGGGTGGGGGGGTGG - Intronic
1034174671 7:149090999-149091021 CAAGCTGAGGAGCTGGCCGGAGG + Intergenic
1034219109 7:149430946-149430968 CTGGCTGAGGAGTAGGGTGGCGG - Intergenic
1034289035 7:149913383-149913405 CAGACTGAGGATAGGGGAGGCGG + Intergenic
1034500465 7:151447486-151447508 GAGGTTGGGGAGTGGGGCTGGGG - Intergenic
1034662036 7:152779466-152779488 CAGACTGAGGATAGGGGAGGCGG - Intronic
1034693928 7:153037517-153037539 GAGGCTGGGGGGTGGGGTGGGGG - Intergenic
1034699560 7:153084276-153084298 CTGGCTGTGGAGTGGTGGGGGGG - Intergenic
1034777910 7:153848264-153848286 CGGGGTGAGGACTGGGGTGGGGG - Intergenic
1034895601 7:154874637-154874659 AGGGCTGAGGAGTGGGGTGGGGG - Intronic
1034901038 7:154907924-154907946 CAGGCTGAGGAGTGCAGCCCAGG - Intergenic
1035057662 7:156046726-156046748 AAGGCTGAAGTGTGGGGCAGAGG + Intergenic
1035326001 7:158066467-158066489 CATACTGAGGAGTTGGGAGGTGG - Intronic
1035724054 8:1813783-1813805 GAGGTTGGGGAGTGGGGCAGGGG - Intergenic
1036543788 8:9746671-9746693 AGGGCTGAGGACTGGGGCTGGGG - Intronic
1037608741 8:20458892-20458914 GAGGCTGCGGAGTGGGGGAGTGG - Intergenic
1037674379 8:21041305-21041327 CAGGCAGCGGGGAGGGGCGGGGG + Intergenic
1037820732 8:22133521-22133543 CAGGGTGGGGGGTGGGGTGGGGG - Intergenic
1037961584 8:23102276-23102298 GAGGCTGAGGAGTAGGTAGGAGG - Intronic
1037969940 8:23164645-23164667 GAGGCTGAGGAGTAGGTAGGAGG + Intergenic
1038258217 8:25970517-25970539 GAGCCTGAAGAGTGGGGAGGGGG - Intronic
1038423795 8:27451679-27451701 CAGGGAGAGGAATGGGGTGGAGG - Intronic
1038494195 8:27990161-27990183 CCAGCTGAGGGGTGGGGAGGAGG - Intronic
1038761065 8:30384606-30384628 GAGGAGGAGGAGCGGGGCGGAGG - Exonic
1040698291 8:50029493-50029515 CAGGAAGAGAAGTGGGGAGGTGG - Intronic
1041315654 8:56559492-56559514 CAGGCTGAGGAGTCTGGCCCCGG + Intergenic
1041755957 8:61313378-61313400 GAGGCTGAGGAGGTGGGCTGAGG + Intronic
1043052804 8:75404352-75404374 CAGGGTGAGGGTGGGGGCGGAGG - Intergenic
1043226983 8:77745678-77745700 CAGCCTGAGGTTTGGGGAGGGGG - Intergenic
1043873758 8:85463590-85463612 CCGGCTGCGGAGTCTGGCGGCGG - Intergenic
1044747421 8:95384260-95384282 CAGATTGAGGAGTGGGATGGAGG + Intergenic
1045231990 8:100314678-100314700 CAGGCAGAGGAGAGGGGAGGGGG - Intronic
1046946094 8:119975685-119975707 CAGGATGAGGGGTGGAGTGGAGG + Intronic
1046948123 8:119993867-119993889 CAGGCTGAGGCCGGGTGCGGTGG + Intronic
1047331587 8:123893959-123893981 CATGCTGAGGAGGGGTGCTGTGG - Intronic
1047701376 8:127452639-127452661 AGAGATGAGGAGTGGGGCGGGGG + Intergenic
1048590340 8:135815501-135815523 CAGGCTGTGGGGTGGGGAGAGGG - Intergenic
1048607243 8:135982412-135982434 CTGGGTGAGGAGTGGGGCTCAGG - Intergenic
1048755473 8:137733263-137733285 CAGGCAGAGGACTGGGGGAGGGG + Intergenic
1048985655 8:139733434-139733456 CAGGCTAAGATGTGGGGTGGGGG + Intronic
1049209466 8:141378873-141378895 CAGGCTTCAGGGTGGGGCGGGGG - Intergenic
1049212687 8:141393999-141394021 CTGGCTGAGGACTTGGGCAGAGG + Intronic
1049273286 8:141707474-141707496 CACGCTGGGGTGTGGGGAGGGGG - Intergenic
1049391185 8:142372522-142372544 GAGGCTGCGGGGTGGAGCGGGGG + Intronic
1049391304 8:142373017-142373039 CAGGCTGAGGGGTAGGATGGAGG - Intronic
1049468721 8:142765463-142765485 CAGGGTGGGGGGTGGGGAGGAGG + Intronic
1049542827 8:143216088-143216110 CATGCGGAGGGGCGGGGCGGGGG + Intergenic
1049569566 8:143362830-143362852 CGGGCTGAGGACAGGGGCCGGGG - Intergenic
1049686533 8:143941419-143941441 CAGGGTCAGGAATGGGGCAGGGG + Intronic
1049692728 8:143969707-143969729 CAGGCCGGGGAGTGGGGAGTGGG + Intronic
1049748367 8:144272500-144272522 CAGCCTGTGGAGTGGAGCCGGGG - Intronic
1049814306 8:144591055-144591077 CAGGCTGAGGAGTGGACCAGGGG - Intronic
1050640207 9:7659468-7659490 CATGCTGAGGAGTGGGCAGTTGG + Intergenic
1051367014 9:16328479-16328501 CAGTCTGAGGACTAGGGCGCTGG - Intergenic
1052754004 9:32522739-32522761 CATGCTGAGGAATGGCGTGGTGG - Intronic
1053200536 9:36148918-36148940 CAGGCCGAGGAGTGGGGGTTGGG + Intronic
1053358201 9:37464975-37464997 CTGTCTGCGGGGTGGGGCGGGGG - Intronic
1053409659 9:37907377-37907399 GGGGCCGGGGAGTGGGGCGGGGG - Intronic
1053412905 9:37927170-37927192 CTGTCTGAGGCGTGGGGCAGGGG + Intronic
1053752375 9:41269410-41269432 CAGGTGGAGGAGTGGGTGGGAGG - Intergenic
1054257903 9:62833742-62833764 CAGGTGGAGGAGTGGGTGGGAGG - Intergenic
1054453303 9:65415141-65415163 AAGGCTGAGATGTGGGGCTGGGG + Intergenic
1055785396 9:79864813-79864835 TGGGCTGAGGGGTGGGGCTGGGG - Intergenic
1055828966 9:80358395-80358417 TGGGCTGAGGGGTGGGGCTGGGG + Intergenic
1056098497 9:83278245-83278267 CAGTCTGAGGGGTGGGCAGGAGG + Intronic
1057041718 9:91853102-91853124 CTGGCTGGGGACTGGGGCTGAGG + Intronic
1057165706 9:92923765-92923787 CAGCCTGGGGAGTGATGCGGTGG + Intergenic
1057252399 9:93514593-93514615 CAAGCTGAGGACTGGGCCTGGGG - Intronic
1057684859 9:97222382-97222404 CAGGTGGAGGAGTGGGCGGGAGG - Intergenic
1057884745 9:98821802-98821824 AAAGCAGAGGAGTGGGGAGGGGG - Intronic
1057998700 9:99844001-99844023 GAGGCTGGGGGGTGGGGGGGTGG - Intronic
1058236834 9:102500414-102500436 GAGGCCGAGGGGTGGGGGGGGGG + Intergenic
1059067610 9:111102181-111102203 CAGGATAAGGAGTGGGGCCTAGG + Intergenic
1059208306 9:112486923-112486945 CGGACCGAGGAGCGGGGCGGGGG - Intronic
1060150861 9:121287239-121287261 CAGGGGGAGGAGTGGGAGGGAGG + Intronic
1060234157 9:121850541-121850563 AAGGGGGAGGAGTGGGGAGGTGG + Intronic
1060280610 9:122213512-122213534 GAGGCCGAGGCGTGGGGTGGAGG - Intronic
1060700648 9:125747044-125747066 CAGGCTGGCGCGGGGGGCGGCGG + Intergenic
1060810269 9:126607977-126607999 CAGGCAGAGGGGTGGAGCTGGGG - Intergenic
1060931137 9:127490127-127490149 CCGCCTGTGGAGTGGGGCTGGGG + Intronic
1061238864 9:129357793-129357815 CAGGCTGGGGAGGAGGGTGGTGG - Intergenic
1061805870 9:133137585-133137607 CAGGCTGAGAAGAGAGGCAGAGG + Intronic
1062051097 9:134447484-134447506 CAGGCTGAGTGGGGTGGCGGTGG + Intergenic
1062097132 9:134709299-134709321 CTGGCTGAGGAGGGGTGGGGGGG + Intronic
1062112341 9:134788937-134788959 CAGGCGGATGAGTGGGTGGGTGG + Intronic
1062303005 9:135886360-135886382 CGCACTGAGGAGTGGGGCAGTGG + Intronic
1062408756 9:136410757-136410779 CAGGCTTCGGCCTGGGGCGGGGG + Intronic
1062473926 9:136718472-136718494 CAGGGTGTGGAGAGGGGCAGGGG - Intronic
1062634736 9:137484861-137484883 CAGCCTCAGGACTGGGGAGGCGG - Intronic
1062634748 9:137484894-137484916 CAGCCTCAGGACTGGGGAGGCGG - Intronic
1062681946 9:137786889-137786911 CAGGCTGGGGAGTGGCTCCGAGG + Intronic
1202800872 9_KI270719v1_random:174638-174660 CAGGTGGAGGAGTGGGTGGGAGG + Intergenic
1203697146 Un_GL000214v1:109268-109290 CAGGTGGAGGAGTGGGCGGGAGG - Intergenic
1203663133 Un_KI270754v1:1328-1350 CTTGCTGAGGACTGGGGAGGAGG + Intergenic
1185580394 X:1207499-1207521 GAGGCTGAGGGGGGGGGGGGTGG - Intronic
1186223698 X:7375524-7375546 GAGGCCAAGGAGTGGGGCTGAGG - Intergenic
1186426340 X:9466053-9466075 CAGGCCGGGGAGATGGGCGGAGG - Intronic
1186506590 X:10098310-10098332 CTGGCTGGGGAGGGGGGAGGGGG - Intronic
1189095509 X:38134540-38134562 CAGGCTGAGGAGTGGGCTGCTGG + Intronic
1189197056 X:39161803-39161825 CACGCTGAGGAGTGTGGCACTGG + Intergenic
1189202941 X:39213298-39213320 CTATGTGAGGAGTGGGGCGGGGG - Intergenic
1191878606 X:65822256-65822278 GAGGCGGCGGAGAGGGGCGGAGG - Intergenic
1192508933 X:71710613-71710635 CTGGCGGGGGAGGGGGGCGGGGG - Intergenic
1192509367 X:71712829-71712851 AAGGCTGTGGAGTGGGACGAAGG - Intergenic
1192511362 X:71722336-71722358 AAGGCTGTGGAGTGGGACGAAGG + Intergenic
1192511800 X:71724593-71724615 CTGGCGGGGGAGGGGGGCGGGGG + Intergenic
1192514897 X:71756912-71756934 CTGGCGGGGGAGGGGGGCGGGGG - Intergenic
1192515335 X:71759169-71759191 AAGGCTGTGGAGTGGGACGAAGG - Intergenic
1192517330 X:71768724-71768746 AAGGCTGTGGAGTGGGACGAAGG + Intergenic
1192517764 X:71770940-71770962 CTGGCGGGGGAGGGGGGCGGGGG + Intergenic
1193715899 X:84934588-84934610 CCTGCTGAGCAGTGGGGCTGGGG - Intergenic
1195255053 X:103082121-103082143 CAGAGAGAGGAGTGGGGCGAGGG + Intronic
1195300894 X:103528793-103528815 CAGGGTCAGGAATGGGGCTGGGG + Intergenic
1195888622 X:109668607-109668629 GATGCTGAGGAGTGGGGATGGGG - Intronic
1196717938 X:118827824-118827846 AAGGCTGGGGAATGGGGTGGAGG + Intergenic
1197335377 X:125204751-125204773 GAGGGTGAGGGGTGGGGTGGGGG + Intergenic
1197655365 X:129110910-129110932 GATGATGGGGAGTGGGGCGGGGG + Intergenic
1197711730 X:129676477-129676499 CAGGAGGAGGAGTGGGTCTGGGG - Intergenic
1197892342 X:131279563-131279585 TAGGCTGCGGAGTGGGGAGGGGG - Intronic
1199996179 X:153028193-153028215 GAGCCTGAGGAGAGGGGAGGAGG + Intergenic
1200063615 X:153494729-153494751 CAGGCGGGGGAGGGGGGGGGAGG + Intronic
1201143894 Y:11051678-11051700 GAGGCTGAGGTGGGAGGCGGAGG - Intergenic
1201153345 Y:11107331-11107353 CAGGTGGAGGAGTGGGCGGGAGG + Intergenic