ID: 962169451

View in Genome Browser
Species Human (GRCh38)
Location 3:133085350-133085372
Sequence AATAAGCACCATAGTGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962169451_962169454 1 Left 962169451 3:133085350-133085372 CCTTGCCCACTATGGTGCTTATT 0: 1
1: 0
2: 1
3: 11
4: 132
Right 962169454 3:133085374-133085396 ACTTTATTTTACTTTTATAATGG 0: 1
1: 4
2: 11
3: 138
4: 1287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962169451 Original CRISPR AATAAGCACCATAGTGGGCA AGG (reversed) Intronic
900958507 1:5904186-5904208 AATAAGGTCCATACTGGTCATGG - Intronic
903296936 1:22349981-22350003 AATAAGCAGCAAACTGGACACGG - Intergenic
903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG + Intronic
905871447 1:41406704-41406726 AATCAGCTCTAGAGTGGGCAGGG - Intergenic
907354806 1:53863366-53863388 AATAAGCAGCATACTGGCCCTGG + Intronic
909589739 1:77333686-77333708 AATAAGCAAAATAATGGGCATGG - Intronic
910436551 1:87211461-87211483 AATAACCACACAAGTGGGCATGG - Intergenic
911186860 1:94912926-94912948 CATAATCAGCACAGTGGGCATGG - Intronic
913513545 1:119583650-119583672 GATAAGCCACATAGTGGGTATGG + Intergenic
913517169 1:119614569-119614591 GATAAGCCACATAGTGGGTATGG + Intergenic
916516804 1:165526116-165526138 ACTAACCACCACAGTGGGAAGGG + Intergenic
916964833 1:169927550-169927572 AATAAACACCATGGAGGGCAAGG + Intronic
1062906587 10:1183675-1183697 AAACAGCATCACAGTGGGCAGGG + Intronic
1069840812 10:71338152-71338174 AAAGAGCCCCAGAGTGGGCATGG - Intronic
1072985628 10:100137313-100137335 AAGAAACACCAAACTGGGCAAGG - Intergenic
1074930968 10:118125641-118125663 AAAAAGCAACAGAGTTGGCAAGG - Intergenic
1077698551 11:4418295-4418317 GAGACGCACCATAGTGGGGAAGG - Intergenic
1080169705 11:29285180-29285202 AATATGCAGCATAGTGAGTACGG + Intergenic
1085367338 11:75962106-75962128 TCTAAGCACAATAGTGGGTATGG + Intronic
1090261925 11:125327493-125327515 AATAAGCAGCACAGCAGGCAGGG - Intronic
1091966096 12:4743139-4743161 GAAAAGTACCATAGTGGGCATGG - Intronic
1097430245 12:59496853-59496875 AATAAGTAAAATAGTGGCCAGGG - Intergenic
1097855092 12:64453206-64453228 AGTAATCACAATAGTGGTCAGGG - Intronic
1100320099 12:93482879-93482901 AAAAAGAACCAGATTGGGCAAGG - Intronic
1102424486 12:112831079-112831101 AATATGCACATAAGTGGGCATGG + Intronic
1103759551 12:123238478-123238500 AATAAGAAACATGCTGGGCATGG + Intronic
1103981599 12:124740341-124740363 AATCAGAACCATAGCAGGCAGGG + Intergenic
1104652553 12:130546583-130546605 AATAAGCAGTAGACTGGGCACGG - Intronic
1114405890 14:22455791-22455813 AATCAGGATCATAGTGGGCAAGG - Intergenic
1117233763 14:53749963-53749985 CAAAAGCAGCACAGTGGGCAAGG + Intergenic
1119711469 14:76825509-76825531 AATAGGCACCACTGTGGGGAAGG - Intronic
1119826960 14:77664927-77664949 AATAAACACCAGGCTGGGCATGG + Intergenic
1122565308 14:102650210-102650232 AAAAAGAATCATAGTGGCCATGG + Intronic
1130579132 15:85118928-85118950 AATAAGAACCAGAGGGAGCACGG - Intronic
1130659295 15:85817576-85817598 GATAAGAACCATAATGGGCCAGG - Intergenic
1131330215 15:91491074-91491096 AACAAGCACCAGAGTTGGAAAGG - Intergenic
1131905756 15:97140356-97140378 AATGAGCACCATAATGAGCACGG - Intergenic
1134093814 16:11405710-11405732 AGGAAGCCCCATAATGGGCAGGG - Intronic
1139380278 16:66526196-66526218 AATAAAGACCAAGGTGGGCAAGG + Intronic
1141684468 16:85562363-85562385 AATGAGAACCAAATTGGGCAGGG - Intergenic
1148501726 17:48096795-48096817 AAAAACCACCACAGTGGGCCAGG + Intronic
1148516278 17:48220976-48220998 AAAAATCACCAGGGTGGGCACGG + Intronic
1150152546 17:62822286-62822308 TATAGCCACAATAGTGGGCAGGG - Intergenic
1151397527 17:73833778-73833800 AATAGGCACCACTGTGTGCATGG - Intergenic
1154015610 18:10614108-10614130 AATAAGGACAATAGCGGGAAGGG + Intergenic
1154189902 18:12221528-12221550 AATAAGGACAATAGTGGGAAGGG - Intergenic
1155960872 18:31993719-31993741 AATCAGGACCAGACTGGGCATGG + Intergenic
1157031812 18:43919170-43919192 AATAAGCACCATATTTGATATGG - Intergenic
1157237483 18:45978280-45978302 AGGAAGCACCAGAGTGGCCAAGG - Intergenic
1158083430 18:53621566-53621588 AATAAGCACATTATTGGGAATGG - Intergenic
1158492638 18:57924041-57924063 AATAAACACCATAATTGACAAGG - Intergenic
1158650078 18:59276249-59276271 AGTCAGTACCATTGTGGGCACGG + Intronic
1158935852 18:62364018-62364040 AGGAAGCATCTTAGTGGGCAGGG + Intronic
1162862028 19:13513361-13513383 AAAAATCACCATAGTCGGCCGGG + Intronic
1164207038 19:23067714-23067736 AATAAACACCCTAGTCGGCAGGG + Intergenic
1164255071 19:23520860-23520882 CACAACCACCTTAGTGGGCAGGG + Intergenic
1166658016 19:44626495-44626517 AGTGATCACCAGAGTGGGCAGGG + Intronic
1202646464 1_KI270706v1_random:146460-146482 AATATGCACAATAGAGGACATGG + Intergenic
925800660 2:7597013-7597035 AACAAGCACAATAGAGGGGACGG + Intergenic
926805950 2:16711198-16711220 AATATGCCCCATAGAGAGCACGG + Intergenic
927316774 2:21692069-21692091 AAAAAAAAACATAGTGGGCAGGG + Intergenic
930601253 2:53445547-53445569 ACTAAGCAGCAGTGTGGGCAGGG + Intergenic
933251408 2:80033270-80033292 AAATACCACCATACTGGGCATGG + Intronic
934509607 2:94926898-94926920 AACATGCACAATAGAGGGCATGG + Intergenic
935256246 2:101312660-101312682 AAGAAGCACTGTAGAGGGCAAGG + Intergenic
939563734 2:143762255-143762277 CATTAGCATGATAGTGGGCAAGG - Intronic
939739364 2:145886842-145886864 AAGAGCCATCATAGTGGGCAAGG - Intergenic
942570775 2:177311926-177311948 AATAAGCCACAGAGTGGGCTGGG + Intronic
943899809 2:193419022-193419044 AATAAAAACCATAGTGGGCTGGG - Intergenic
944131046 2:196347764-196347786 GACAAGCACCATGGTTGGCAAGG - Intronic
944180222 2:196883277-196883299 GAGAAGCACCAATGTGGGCAAGG + Intronic
944752279 2:202722371-202722393 AATAAGCAGCATAGTATGCGTGG - Intronic
944996425 2:205299998-205300020 AGTAAGGAACATACTGGGCATGG - Intronic
946089702 2:217209990-217210012 AATAAGAACCTTGGTGGGCCAGG + Intergenic
946958947 2:224962369-224962391 AATAAGCACTGTAGTCAGCATGG + Intronic
1169569369 20:6889658-6889680 AATAATCACTATATTGGGCTGGG + Intergenic
1174021840 20:47536464-47536486 AATAAGCTCCTTTTTGGGCAGGG - Intronic
1174692128 20:52516415-52516437 AATAAGGATTAGAGTGGGCATGG - Intergenic
1175523087 20:59615360-59615382 ATTAAGCACTACAGTGTGCATGG + Intronic
1176605406 21:8826297-8826319 AATATGCACAATAGAGGACATGG - Intergenic
1180347700 22:11717902-11717924 AATATGCACAATAGAGGACATGG - Intergenic
1181015891 22:20068582-20068604 AAAAAGCACCACAGTCGGCCGGG - Intergenic
949990892 3:9578210-9578232 AAAAAGAACCATAGTTGGCCCGG - Intergenic
950281987 3:11716006-11716028 AAAAAGCACAAAAATGGGCAGGG + Intronic
951178513 3:19630881-19630903 AAGAAGCACCTTGGGGGGCAAGG - Intergenic
951786315 3:26423156-26423178 AATAATCAACATAGTTGACATGG - Intergenic
957024054 3:75159509-75159531 AATAAGAATCATAATGGGCCAGG - Intergenic
958270668 3:91495484-91495506 ATTAAGCACCTTTGTGGCCAAGG + Intergenic
960018638 3:112922462-112922484 AAAATGCACCATAGAGGACATGG - Intronic
960847296 3:122016346-122016368 AATAAGCACCACGGGGGCCAGGG + Intronic
962169451 3:133085350-133085372 AATAAGCACCATAGTGGGCAAGG - Intronic
964992864 3:162835692-162835714 AATAAGCACTCTAGTGGCCCAGG + Intergenic
972767290 4:42162989-42163011 AATAAGTACCACGCTGGGCATGG - Intergenic
976131531 4:81889843-81889865 AAAGAGCACCATGCTGGGCAAGG + Intronic
976709384 4:88052932-88052954 AATAAGGAAAATAGTGAGCAAGG - Intronic
977014024 4:91670089-91670111 TATAAGTACCATATTGAGCATGG + Intergenic
977148760 4:93481639-93481661 AATAACCACCAGAGTTGGCATGG - Intronic
979206525 4:118045152-118045174 AATGAGCACAATATTGGGTAAGG - Intronic
983714125 4:170755981-170756003 AATAATCACCAGACTGGCCAAGG - Intergenic
988698094 5:33644365-33644387 AAGAAGCACCCAAGTGGGAAGGG + Intronic
989762993 5:45042586-45042608 AACAAGGACCACAGGGGGCACGG + Intergenic
989990385 5:50756840-50756862 AATAAGAACAATGGTGGCCAGGG - Intronic
995058242 5:107786349-107786371 AATAAGCACTGTGGTGGCCATGG - Intergenic
995515230 5:112947923-112947945 CATAAGCAATACAGTGGGCAGGG + Intergenic
999611699 5:153376694-153376716 AACTAGAACAATAGTGGGCATGG - Intergenic
1004036839 6:11932525-11932547 AATAAGCATGAAAGTGGTCATGG + Intergenic
1004538152 6:16523020-16523042 AATAAGCATCATGGTGGGCATGG - Intronic
1005425479 6:25698823-25698845 AATAAACACCAGAGTAGGCCTGG - Intronic
1008741846 6:54617911-54617933 AATCAGAACCATATTTGGCATGG + Intergenic
1009063833 6:58432029-58432051 AATAAGCACCATTCTGTGAAAGG + Intergenic
1012188100 6:96247017-96247039 AATAAGCAGAATGGTGGACATGG + Intergenic
1012955516 6:105565466-105565488 AAAAAGCACTATACTGGGCCAGG - Intergenic
1014506049 6:122257993-122258015 AATAAGGACCATAGAGGTAAAGG + Intergenic
1021793068 7:24225761-24225783 CATAATCAACATAGTGAGCATGG + Intergenic
1022999255 7:35790761-35790783 ATTAAGCACTATAGGGGGCCGGG + Intergenic
1023106920 7:36771653-36771675 AACAAGCACCAGTGTGGCCAAGG - Intergenic
1027816007 7:82972738-82972760 CAAAAGCTTCATAGTGGGCAGGG - Intronic
1027985214 7:85278687-85278709 AATAATCACTAGGGTGGGCAGGG - Intergenic
1031198968 7:118653638-118653660 AATAAGCACCACAGTAGAAATGG - Intergenic
1036465315 8:8992043-8992065 AAGAAACACCATTCTGGGCATGG + Intergenic
1037922654 8:22818469-22818491 AAAGAGCACCATTGTGGCCAGGG + Intronic
1038649944 8:29393479-29393501 AGCAATCATCATAGTGGGCAAGG + Intergenic
1040620362 8:49085331-49085353 AAAATATACCATAGTGGGCATGG + Intergenic
1043122392 8:76343832-76343854 AATAAGCATTAGAGTGTGCAAGG + Intergenic
1044615810 8:94139601-94139623 AGGAAGAACCATAGTGGGCAGGG + Intronic
1046529091 8:115420627-115420649 ATTAAGCACCAAATTGTGCAAGG - Intronic
1047422302 8:124717199-124717221 AAACAGCACCAGACTGGGCATGG + Intronic
1049662300 8:143824885-143824907 TTTAAGCAGCATGGTGGGCAGGG + Intronic
1051098366 9:13492647-13492669 AATGAACACCATAGGGGTCAAGG + Intergenic
1052586599 9:30437062-30437084 AACAAACACCATTGTGGACATGG + Intergenic
1052782041 9:32791369-32791391 AATGAGCAGAATTGTGGGCATGG + Intergenic
1052863167 9:33449165-33449187 TAAAAGCAGCATAGAGGGCAAGG - Intergenic
1055514984 9:77024493-77024515 AATAAGCACCAAACTCGGCCCGG - Intergenic
1056079248 9:83073390-83073412 AATAAGCACCATGGAGGGGTGGG - Intergenic
1186258129 X:7744963-7744985 AACTAGCAGCACAGTGGGCATGG + Intergenic
1190825917 X:54017857-54017879 AATAAGGCCTTTAGTGGGCAGGG - Intronic
1191674038 X:63776385-63776407 AATAAGCAAATGAGTGGGCATGG + Intronic
1192165592 X:68825872-68825894 AGTAAGTACCACAGTGGGCCAGG + Intergenic
1194143185 X:90230694-90230716 ATTAAGCACTTTAGTGGGTATGG - Intergenic
1194767141 X:97854832-97854854 AATAAGCTCCTTTGAGGGCAGGG + Intergenic
1198110769 X:133501006-133501028 AATAAGCACTGAAGTGGGCTAGG - Intergenic
1198796164 X:140397561-140397583 AAAAAGCACTATATTGGCCACGG + Intergenic
1199532480 X:148866029-148866051 AATTAGCACCCTTGTTGGCAGGG + Intronic
1200488938 Y:3800016-3800038 ATTAAGCACTTTAGTGGGTATGG - Intergenic
1202080155 Y:21075832-21075854 CACAATCACCATAGTGGGCATGG - Intergenic