ID: 962170242

View in Genome Browser
Species Human (GRCh38)
Location 3:133094227-133094249
Sequence GTGTGTGTGGGGGGGGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9566
Summary {0: 7, 1: 98, 2: 492, 3: 1848, 4: 7121}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962170242_962170254 -5 Left 962170242 3:133094227-133094249 CCCCCCACCCCCCCCACACACAC 0: 7
1: 98
2: 492
3: 1848
4: 7121
Right 962170254 3:133094245-133094267 CACACGAGATGCTGCTGACCAGG 0: 1
1: 0
2: 1
3: 9
4: 102
962170242_962170256 18 Left 962170242 3:133094227-133094249 CCCCCCACCCCCCCCACACACAC 0: 7
1: 98
2: 492
3: 1848
4: 7121
Right 962170256 3:133094268-133094290 TTGATAACCCTTGATACAAATGG 0: 1
1: 0
2: 1
3: 5
4: 118
962170242_962170257 22 Left 962170242 3:133094227-133094249 CCCCCCACCCCCCCCACACACAC 0: 7
1: 98
2: 492
3: 1848
4: 7121
Right 962170257 3:133094272-133094294 TAACCCTTGATACAAATGGAAGG 0: 1
1: 0
2: 0
3: 9
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962170242 Original CRISPR GTGTGTGTGGGGGGGGTGGG GGG (reversed) Intronic
Too many off-targets to display for this crispr