ID: 962170242 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:133094227-133094249 |
| Sequence | GTGTGTGTGGGGGGGGTGGG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 9566 | |||
| Summary | {0: 7, 1: 98, 2: 492, 3: 1848, 4: 7121} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 962170242_962170254 | -5 | Left | 962170242 | 3:133094227-133094249 | CCCCCCACCCCCCCCACACACAC | 0: 7 1: 98 2: 492 3: 1848 4: 7121 |
||
| Right | 962170254 | 3:133094245-133094267 | CACACGAGATGCTGCTGACCAGG | 0: 1 1: 0 2: 1 3: 9 4: 102 |
||||
| 962170242_962170256 | 18 | Left | 962170242 | 3:133094227-133094249 | CCCCCCACCCCCCCCACACACAC | 0: 7 1: 98 2: 492 3: 1848 4: 7121 |
||
| Right | 962170256 | 3:133094268-133094290 | TTGATAACCCTTGATACAAATGG | 0: 1 1: 0 2: 1 3: 5 4: 118 |
||||
| 962170242_962170257 | 22 | Left | 962170242 | 3:133094227-133094249 | CCCCCCACCCCCCCCACACACAC | 0: 7 1: 98 2: 492 3: 1848 4: 7121 |
||
| Right | 962170257 | 3:133094272-133094294 | TAACCCTTGATACAAATGGAAGG | 0: 1 1: 0 2: 0 3: 9 4: 96 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 962170242 | Original CRISPR | GTGTGTGTGGGGGGGGTGGG GGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||