ID: 962171862

View in Genome Browser
Species Human (GRCh38)
Location 3:133109612-133109634
Sequence AACCTTGGAAAACTAATGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 578
Summary {0: 1, 1: 2, 2: 13, 3: 92, 4: 470}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962171862 Original CRISPR AACCTTGGAAAACTAATGAA TGG (reversed) Intronic
900202173 1:1413615-1413637 AACTTTGGAAATTTACTGAATGG + Intergenic
902324134 1:15687540-15687562 AACCTTGTAAAATTGAGGAATGG - Intronic
903632049 1:24782068-24782090 AACCTTTGAAAACTACTGGAAGG + Intronic
904097655 1:27993939-27993961 AAACATGAAAAAATAATGAAAGG + Intronic
904170433 1:28588438-28588460 AACTTTGGAAATTTACTGAATGG + Intergenic
906390459 1:45411007-45411029 ACCTTTGTAAAACTAAGGAAAGG + Intronic
906499015 1:46326938-46326960 AACCTTGGAAATTTACTGAATGG + Intergenic
906695163 1:47818561-47818583 AACCTTGGAAGAGAAATCAAAGG - Intronic
906855632 1:49301521-49301543 GCCTTTGTAAAACTAATGAAAGG + Intronic
907819120 1:57949683-57949705 AATCTTGGAAAAATAATGTTGGG - Intronic
908243736 1:62210956-62210978 AACTTTGCAGAACTAAAGAAAGG + Exonic
909820091 1:80050988-80051010 AAGCTTGGAAAAGTAATTAGAGG + Intergenic
909992693 1:82242159-82242181 ACCTTTGTAAAACTAATGAAAGG + Intergenic
910159345 1:84256783-84256805 AACCCTAGAAAACTAATGCATGG + Intergenic
910188404 1:84570673-84570695 AAACTTGGAAATCTTATGATTGG - Exonic
910645447 1:89509249-89509271 GCCTTTGTAAAACTAATGAAAGG - Intergenic
911022080 1:93399189-93399211 ACCTTTGCAGAACTAATGAAAGG - Intergenic
911509743 1:98796910-98796932 AATCCTGGATAACAAATGAAGGG + Intergenic
911571511 1:99523056-99523078 TACCTTGAAACACTAATCAAAGG + Intergenic
912943341 1:114064504-114064526 AACATTGGAACACTACTGAAAGG + Intergenic
912988403 1:114458169-114458191 ACCTTTGTAAAGCTAATGAAAGG + Intronic
914098360 1:144563256-144563278 ACCCCTGTAAAACTAATGAAAGG - Intergenic
914300618 1:146374358-146374380 ACCCCTGTAAAACTAATGAAAGG + Intergenic
914518069 1:148391036-148391058 ACCCCTGTAAAACTAATGAAAGG - Intergenic
914800118 1:150955099-150955121 AACATTGAAAAACTAAACAAAGG + Intronic
914892613 1:151640317-151640339 AACCTTGGAAACCTGAGAAAAGG + Intronic
915861358 1:159448356-159448378 AACCTTCCAAAATTAATGACAGG + Intergenic
916288654 1:163138951-163138973 AAGCATGGAAAACTATTGAAAGG + Intronic
916766770 1:167868498-167868520 AACTTTGGAAATTTACTGAATGG - Intronic
916974659 1:170063073-170063095 ACCTTTGTAAGACTAATGAAAGG + Intronic
917116110 1:171605446-171605468 AACTTTGGAAATTTACTGAATGG - Intergenic
917899867 1:179531372-179531394 ACCCTTGTAAAACTAATGAAAGG - Intronic
918301753 1:183210480-183210502 GACCTAGAAAAATTAATGAATGG + Intronic
918603443 1:186392513-186392535 ATCCTTAGAAAACGAATGCAGGG + Intronic
920450488 1:206057508-206057530 AACTTTGGAAATTTACTGAATGG - Intronic
921355832 1:214283195-214283217 AACCTTAGAACATTAATGGATGG + Intronic
921369219 1:214404494-214404516 AATTTTGAAAAGCTAATGAAGGG + Intronic
921778672 1:219133759-219133781 GCCTTTGTAAAACTAATGAAAGG - Intergenic
922334149 1:224605478-224605500 GTCCTTGTAAAACTAATGAAAGG + Intronic
922627861 1:227068774-227068796 AACTTTGTAAAACAATTGAAAGG + Intronic
922732317 1:227956258-227956280 AACCTTGTAGAACCAATAAATGG - Intergenic
923089426 1:230728351-230728373 ATCTTTGTAAAACTAATGAAAGG - Intergenic
923388204 1:233486828-233486850 ACCTTTGTAAAACTAATGAGAGG + Intergenic
923467075 1:234258544-234258566 GCCTTTGTAAAACTAATGAAAGG - Intronic
923779403 1:237008837-237008859 GACTTTGTAACACTAATGAAAGG + Intergenic
923932076 1:238712645-238712667 CACCTTGGAAAATCAATGACAGG - Intergenic
924807867 1:247375611-247375633 GCCCTGGTAAAACTAATGAAAGG + Intergenic
1064316074 10:14257921-14257943 AGCCTTTGAAAACTAATACAAGG + Intronic
1064858424 10:19797547-19797569 ACCTTTGGAAGACTAATAAAAGG + Intergenic
1065207984 10:23375181-23375203 ATCTTTGTAAAACTAATGAAAGG - Intergenic
1067768008 10:49103466-49103488 AAACATGGAAAAATACTGAAAGG - Intronic
1068322002 10:55431698-55431720 AATTTTGGAAAACACATGAACGG - Intronic
1068570607 10:58624085-58624107 AACCATGGGAAGCTAAAGAAAGG - Intronic
1068771428 10:60825926-60825948 ACCTTTGTAAAACTAATGAAAGG + Intergenic
1069319993 10:67157993-67158015 AACCTTGGAAATTTACTGAAAGG - Intronic
1069325430 10:67226282-67226304 AACCTTGGAAAACATATTTAGGG + Intronic
1069806466 10:71128276-71128298 GTTCTTGTAAAACTAATGAAAGG + Intergenic
1070250729 10:74770823-74770845 GTTCTTGTAAAACTAATGAAAGG - Intergenic
1070510495 10:77156569-77156591 GTCCTTGTAAAACTAACGAAAGG + Intronic
1071217559 10:83425726-83425748 ACCTTTGTAAAACTAAAGAAAGG - Intergenic
1071780840 10:88842773-88842795 ATACTTGGAAAAATAATGACAGG + Intronic
1072385997 10:94928826-94928848 AAACTTTAAAAACAAATGAAGGG - Intergenic
1072688880 10:97556840-97556862 AACTTTGGAAATTTACTGAATGG + Intronic
1072962206 10:99939630-99939652 ACTTTTGTAAAACTAATGAAAGG + Intronic
1074903813 10:117842670-117842692 CACCATGGAAAATTAATTAATGG - Intergenic
1075243536 10:120799774-120799796 GACCTTGTAAAACTAATGAAAGG + Intergenic
1075628107 10:123978653-123978675 ACCTTTGCAAAACTAATGAAAGG - Intergenic
1075883485 10:125875867-125875889 GCCTTTGTAAAACTAATGAAAGG + Intronic
1075992183 10:126847697-126847719 ATCCTTGGAAAAATAAAAAATGG - Intergenic
1076123941 10:127960067-127960089 GACCTGGGAAAACAAGTGAATGG + Intronic
1077768386 11:5187366-5187388 ATCCTTGGAAAAGAAATTAAAGG + Intergenic
1078471782 11:11593408-11593430 AAACTGGGAAAACTGAGGAAAGG - Intronic
1078537857 11:12189536-12189558 AACCCTGCAAAACTATTAAAGGG - Intronic
1079645028 11:22852344-22852366 ACCTTTGTAAAACTAATGAAAGG + Intronic
1080296517 11:30736287-30736309 CACCTAGGAAAACTATTGCAGGG - Intergenic
1080949132 11:37008513-37008535 TTCTTTGTAAAACTAATGAAAGG - Intergenic
1082057582 11:47832325-47832347 ACCTTGGTAAAACTAATGAAAGG + Intronic
1082216831 11:49581518-49581540 TAGCTTGGAAAAATAATAAATGG + Intergenic
1082685678 11:56236343-56236365 ACCTTTGTAAAACTAATCAAAGG + Intergenic
1083114338 11:60444840-60444862 CACCTTGGAAAACTATTGGGTGG + Intronic
1083539175 11:63500211-63500233 ACCTTTGTAAAGCTAATGAAAGG + Intergenic
1084046340 11:66570111-66570133 ACCCTTGTAAAACTAATGAAAGG + Intergenic
1085168444 11:74425951-74425973 AACCATGGACAAAGAATGAAAGG + Intergenic
1086632716 11:89042646-89042668 TACCTTGGAAAAATAATAAATGG - Intronic
1087352417 11:97048918-97048940 AGGCTTGGAAGACTGATGAAGGG - Intergenic
1087807016 11:102566081-102566103 ATCTTTGTAAGACTAATGAAAGG + Intergenic
1088161135 11:106872244-106872266 AGTCTTGGAAAACTAATCTATGG + Intronic
1088162118 11:106884819-106884841 AAACTTTGACCACTAATGAAGGG - Intronic
1089956632 11:122577192-122577214 GTTCTTGTAAAACTAATGAAAGG - Intergenic
1090288361 11:125519824-125519846 GCCTTTGTAAAACTAATGAAAGG + Intergenic
1091903030 12:4160616-4160638 AACCCTAGAAAACTAATGTGGGG + Intergenic
1092034725 12:5322978-5323000 ATCCTTGGCAAACTAATGCAGGG - Intergenic
1092037725 12:5353382-5353404 AGCCCTGGAAAACTAATATACGG + Intergenic
1092270833 12:7021976-7021998 ACCTTTATAAAACTAATGAAAGG + Intronic
1092275580 12:7058526-7058548 GCCTTTGTAAAACTAATGAAAGG + Intronic
1092499612 12:9032548-9032570 ACCTCTGTAAAACTAATGAAAGG + Intergenic
1092510436 12:9149921-9149943 AATCTTTGAAAAGTAATTAAGGG - Intronic
1093117406 12:15228022-15228044 AATTTTGCAAATCTAATGAAAGG + Intronic
1093172730 12:15877106-15877128 AATCTTGGAAAACATATGTAGGG + Intronic
1093519813 12:20035552-20035574 AATCTTTGAAAACTAAAGATGGG - Intergenic
1093889317 12:24500632-24500654 AATGTTGGGAAAGTAATGAAAGG - Intergenic
1094019273 12:25897004-25897026 ATTTTTGTAAAACTAATGAAAGG + Intergenic
1094188297 12:27668774-27668796 AACCTCTGAAAAATGATGAAAGG - Intronic
1094429100 12:30347236-30347258 ATCCTTAGCAAACTAATGCAGGG + Intergenic
1094472831 12:30819216-30819238 AACCTTGGGAAACTAGAAAAAGG + Intergenic
1095754940 12:45754309-45754331 AAGAATGGAAAAGTAATGAAGGG - Intronic
1096356000 12:50941556-50941578 AACCTTGAGAATCTGATGAAAGG + Intergenic
1096911719 12:54990736-54990758 AACCTTGGAGAAACCATGAAGGG + Intergenic
1097066898 12:56327236-56327258 AACCTTGGGACCCTGATGAAAGG + Intronic
1098491252 12:71081793-71081815 AAGCTTTGAAAACTAAAGAAGGG - Intronic
1098579254 12:72079435-72079457 CAGCTTGGAAAATTAATGCAAGG - Intronic
1098639245 12:72819689-72819711 AACCTTGGAAATTTAGTGAATGG + Intergenic
1098921406 12:76305549-76305571 ACCCTTGTAAAATTAATGAAAGG + Intergenic
1099834780 12:87895608-87895630 ACCTTTGTAAAACTAATGAAAGG + Intergenic
1100426697 12:94494266-94494288 GCCCTTGTAAAACTAATGAAAGG + Intergenic
1100759668 12:97793137-97793159 ACCATTGTAAAACTAATGACAGG - Intergenic
1100906016 12:99300168-99300190 AAAATTGGAAATCTAATCAAGGG + Intronic
1101368951 12:104107223-104107245 AATCTAGGAAAAAAAATGAATGG - Intergenic
1101565228 12:105898632-105898654 ACCCTTTGGAAACTAATGCATGG + Intergenic
1104548677 12:129735709-129735731 AAACTGGCAAAACTAATGGATGG + Intronic
1105695905 13:22888461-22888483 AACCTTGGAAATTTACTGAATGG - Intergenic
1105757731 13:23484704-23484726 GACCTTGAAAAACAAAAGAAAGG + Intergenic
1106909792 13:34451404-34451426 ATCCTTGGATAAAGAATGAAAGG - Intergenic
1107828106 13:44349461-44349483 AAGCATGGAAAACTTATTAATGG - Intergenic
1108253295 13:48588056-48588078 ACTTTTGTAAAACTAATGAAAGG + Intergenic
1108296164 13:49019626-49019648 AACATTGAAAAATTAATGTAGGG - Intronic
1108361781 13:49674448-49674470 AACCTGGGAAAAGTAAACAAGGG + Intronic
1108784289 13:53875711-53875733 AATGTTGTAAAACTAATGAAAGG - Intergenic
1108787805 13:53927059-53927081 ATCCTTAGCAAACTAATGCAGGG - Intergenic
1109515292 13:63436088-63436110 AACCTTGTAAAACTAATGAAAGG - Intergenic
1109571456 13:64196454-64196476 AAACTTTGACAACAAATGAAAGG + Intergenic
1109732695 13:66436838-66436860 AAACTTGGCACACTACTGAATGG - Intronic
1109868408 13:68297765-68297787 AATCTTGGAAAACTTCTTAAAGG - Intergenic
1109941420 13:69371332-69371354 AACCTGGGACTACTAATGGAGGG + Intergenic
1110376149 13:74796134-74796156 ATCTTTGTAAGACTAATGAAAGG + Intergenic
1111029093 13:82572676-82572698 ACCTTTGTAAAACTAATAAAAGG + Intergenic
1111358306 13:87140263-87140285 AAACTATGAAAAATAATGAATGG - Intergenic
1111698707 13:91659421-91659443 AGCCTTGGAATACTAATGCCAGG + Intronic
1111808946 13:93073770-93073792 AACCTTAGAAAACTAACACAGGG - Intergenic
1112672838 13:101660601-101660623 GCCCTTGTAAAACTAATAAAAGG - Intronic
1112959682 13:105107987-105108009 AGCTTTGTAAAGCTAATGAAAGG - Intergenic
1113215757 13:108039249-108039271 ATCCTTTTAAAACTAATGAGAGG + Intergenic
1114242239 14:20878980-20879002 AACTCTGTAAAACTAGTGAAAGG - Intergenic
1114858037 14:26476404-26476426 AACCTTGGATGTCTAATCAAAGG - Intronic
1114953588 14:27789117-27789139 AACCTTGGAACAAGAATTAAAGG + Intergenic
1114959834 14:27871917-27871939 ATCCTTAGCAAACTAATGCAGGG - Intergenic
1114981917 14:28175999-28176021 AATTTTGGAAAGGTAATGAAAGG + Intergenic
1115290861 14:31770646-31770668 ACCTTTGTAAAACTAATGAAAGG - Intronic
1115617618 14:35111499-35111521 GCCTTTGTAAAACTAATGAAAGG + Intronic
1115811806 14:37118045-37118067 ACCTTTGCAAAACTAATGAAAGG + Intronic
1115820819 14:37210868-37210890 ACTTTTGTAAAACTAATGAAAGG - Intronic
1116327974 14:43557932-43557954 AACCTTATAAAACTAAGGGATGG - Intergenic
1116551186 14:46240854-46240876 GTCCTTGGAAAAATAATGATGGG + Intergenic
1116755003 14:48936728-48936750 AATCTTGGAGAACAAAAGAAAGG - Intergenic
1117151399 14:52892044-52892066 CAGATTGGAAAAGTAATGAAAGG + Intronic
1117345770 14:54830642-54830664 AAGGTTGAAAAACTAATGATGGG - Intergenic
1117445537 14:55800592-55800614 GTTCTTGTAAAACTAATGAAAGG + Intergenic
1117650007 14:57894022-57894044 AACTTTGGCAAATTAATGCAGGG - Intronic
1118048345 14:61997441-61997463 AATCATGGAAAATGAATGAAGGG - Intronic
1118208608 14:63746345-63746367 ACCTTTGTAAGACTAATGAAAGG - Intergenic
1118886170 14:69867906-69867928 ACCTTTGGAAAACTAATGAAAGG + Intronic
1118931014 14:70240478-70240500 AACCATGGAATATTAATCAAAGG + Intergenic
1118953893 14:70461826-70461848 AACCATGGAATATTAATCAAAGG - Intergenic
1119135194 14:72211856-72211878 AACCTTGGAAAATAAGGGAAGGG + Intronic
1119331117 14:73794573-73794595 AGCCATAGAAAACTAATGCAGGG + Intergenic
1120901308 14:89578071-89578093 AACCTTGAAAGACATATGAAAGG + Intronic
1121385811 14:93523713-93523735 AACCTTTGAAAACTTATTAATGG + Intronic
1121458490 14:94054888-94054910 AACCCTTGAAAACTAAGGAATGG - Intronic
1122950234 14:105040313-105040335 AACTTTGGAACAGGAATGAAGGG - Intergenic
1124795467 15:32774098-32774120 AACAATGGAAAACTATTTAAGGG - Exonic
1125959612 15:43818589-43818611 GACCTTAGAAAATTAATGAGGGG + Intronic
1126077760 15:44929845-44929867 AAAATTAGAAAAATAATGAAGGG + Intergenic
1126153546 15:45544356-45544378 ATCCTTAGCAAACTAATGCAGGG - Intergenic
1126752269 15:51888714-51888736 AACCTTGTGAAATTAATGAACGG + Intronic
1128407072 15:67353240-67353262 AAACTGGGAAAAAAAATGAAAGG + Intronic
1130657515 15:85802227-85802249 ACTCTTGTAAAACAAATGAAAGG - Intergenic
1130768357 15:86897532-86897554 AACATTGAAAAACCAATGTAGGG - Intronic
1131667221 15:94583330-94583352 AACATTGCATAGCTAATGAAAGG - Intergenic
1131939248 15:97542479-97542501 ATCCTCAGCAAACTAATGAAGGG - Intergenic
1133078759 16:3301653-3301675 AATTTAGGAAAACAAATGAAAGG - Exonic
1133639791 16:7705622-7705644 ATCAATGGAAAACTATTGAAGGG + Intronic
1133778973 16:8922030-8922052 CACTTTGGAAAAGTAGTGAATGG - Intronic
1133843450 16:9430904-9430926 ACCTTTGTAAAACTAATGAAAGG + Intergenic
1134569082 16:15276058-15276080 AACCTTAGAAAAATAAGGAAAGG - Intergenic
1134672192 16:16064158-16064180 AAACGTGGAAAACCAATGAATGG - Intronic
1134733353 16:16480290-16480312 AACCTTAGAAAAATAAGGAAAGG + Intergenic
1134934142 16:18231986-18232008 AACCTTAGAAAAATAAGGAAAGG - Intergenic
1135356368 16:21772416-21772438 ACCTTTGTAAAACTAAGGAAAGG - Intergenic
1135454860 16:22588560-22588582 ACCTTTGTAAAACTAAGGAAAGG - Intergenic
1136984531 16:35086300-35086322 AACACTGGAAAAAAAATGAAAGG - Intergenic
1137222772 16:46472295-46472317 AACCTTGGAAAAATTATGCCAGG - Intergenic
1137635819 16:49985549-49985571 AACAATAGAAAACTAATAAATGG - Intergenic
1138299783 16:55916350-55916372 ACCTTTGTAAAGCTAATGAAAGG - Intronic
1138731656 16:59201826-59201848 GCCCTTGTAAAACTAATGAAAGG - Intergenic
1138860490 16:60750099-60750121 AGCCTTGTAAAACTAATGAAAGG - Intergenic
1139366127 16:66434535-66434557 ACCCTTGGAAAACACATGGAGGG - Intronic
1140752407 16:78037432-78037454 AAACTTGGAAAGCCATTGAAAGG - Intronic
1142543521 17:680915-680937 ACCCTTGGAAATTTATTGAAAGG + Intronic
1145764984 17:27452494-27452516 AAGCTCGGAAAAGCAATGAAGGG + Intergenic
1145769292 17:27480826-27480848 AACATCGGAAAACTACTCAATGG - Intronic
1146146880 17:30426741-30426763 ACCTTTGTAAAACTAATGAAAGG - Intronic
1146359413 17:32161532-32161554 ACCTTTGTAAAACTAGTGAAAGG - Intronic
1146602608 17:34231643-34231665 ATCCTTGGCAAACTAACGCAGGG + Intergenic
1147779361 17:42929093-42929115 TAACTTGGAAAACAAATGATAGG + Intergenic
1147809987 17:43161595-43161617 AACTTTGGAAATTTACTGAATGG + Intergenic
1149624580 17:58071471-58071493 ATCCTTAGCAAACTAATGCAGGG + Intergenic
1149930515 17:60749864-60749886 AACATTTGAAAATTAATCAATGG + Intronic
1150825244 17:68468736-68468758 AACCTCAGAGAAATAATGAAAGG - Intergenic
1152044446 17:77926726-77926748 AACTTGGGAAAACTCCTGAAAGG + Intergenic
1153603205 18:6803380-6803402 AACGTTTGAAAAATAATCAATGG - Intronic
1153761096 18:8333523-8333545 AAACTTAGAAAACCACTGAAGGG + Intronic
1153826764 18:8882292-8882314 AACACTGGAAGGCTAATGAAAGG - Intergenic
1153832220 18:8933893-8933915 ACTTTTGTAAAACTAATGAAAGG - Intergenic
1153852881 18:9112782-9112804 AACTTTTAAAAACCAATGAAGGG - Intronic
1154006413 18:10532059-10532081 AATTTTGGAAAACTTATCAAGGG - Intronic
1154149912 18:11898438-11898460 CACCTTTGAAAACTAATGAAAGG + Intronic
1154205857 18:12336130-12336152 ACCCTTGTAAAACTAATGAAAGG + Intronic
1154366045 18:13710104-13710126 GCCTTTGTAAAACTAATGAAAGG + Intronic
1155643146 18:28044334-28044356 AACCTTGGAGAAACAATGTAAGG - Intronic
1156083415 18:33368752-33368774 GACCTTACAAAACTATTGAATGG - Intronic
1157961160 18:52154809-52154831 AACCACAGAAAACTAATAAAGGG - Intergenic
1157977181 18:52340498-52340520 AACCTTAGAAAACTAACTCAAGG - Exonic
1159279482 18:66267378-66267400 ATCTTTGTAAAACTAATGAAAGG + Intergenic
1159312767 18:66731710-66731732 ATACTTGGAAAACCAATGATAGG + Intergenic
1159570513 18:70106458-70106480 AACCTTGGAAGAATAAGAAAAGG + Intronic
1163934262 19:20427477-20427499 AACTTTGGAAATTTACTGAATGG + Intergenic
1165294820 19:34918157-34918179 ACCCTTGTAAAACTAATGAAAGG + Intergenic
1166400504 19:42475756-42475778 ACCTTTGTAAAGCTAATGAAAGG - Intergenic
1166562924 19:43745288-43745310 AACCTGGGAAAGCACATGAAAGG + Intronic
1167935209 19:52900200-52900222 AACTTTGGAAATTTACTGAATGG + Intergenic
1167952612 19:53039330-53039352 AACTTTCTAAGACTAATGAAAGG - Intergenic
925082956 2:1084230-1084252 TACCTTGGAAATAAAATGAAGGG + Intronic
925263767 2:2550122-2550144 AACCTTGAAAAATTGTTGAAAGG + Intergenic
926007456 2:9383642-9383664 GCCTTTGGAAGACTAATGAAAGG - Intronic
926453318 2:13034463-13034485 AACTATGGAAAACTAATCTAAGG + Intergenic
926701199 2:15804896-15804918 ACCCTTGGAATACTAAAGAGTGG + Intergenic
927286828 2:21365756-21365778 AATCTTGGATAACTCTTGAAAGG - Intergenic
929171950 2:38941170-38941192 GGCTTTGAAAAACTAATGAAAGG - Intronic
929223841 2:39492404-39492426 AAACTTGGAAAACAAATGAACGG - Intergenic
930102343 2:47613216-47613238 CTCCTTGGAAAAATAATGAATGG + Intergenic
930682410 2:54271206-54271228 ACCTTTGTAAAACTAATGAAAGG + Intronic
931508123 2:62955445-62955467 TACATTTGTAAACTAATGAAAGG - Intronic
931545856 2:63386244-63386266 AACAATGGTAAAATAATGAAAGG + Intronic
932527082 2:72481950-72481972 AAACTTGGAAAAGTAGTTAAAGG + Intronic
933390168 2:81657467-81657489 AACACTGGAAAGATAATGAAAGG - Intergenic
933578665 2:84100220-84100242 ACCCTTGGAAAACTAATGAAAGG - Intergenic
934109100 2:88725289-88725311 AGCCTTGGCAAACTGATGCATGG - Intronic
934483676 2:94679841-94679863 AACCTTGGAAGAAGAATAAAAGG - Intergenic
935047833 2:99497915-99497937 AACACTGGAAAGATAATGAAAGG + Intergenic
935175517 2:100645338-100645360 ACCTTTGTAAAACTAATGAAAGG - Intergenic
936740260 2:115497214-115497236 ACCCTTGTAATACTAATGAAAGG - Intronic
937525632 2:122765654-122765676 AAGCATGGAAAAATATTGAAAGG - Intergenic
937746284 2:125419682-125419704 CACCTTAGGAAACTAAAGAAGGG + Intergenic
938182865 2:129199352-129199374 AAACTTGGAAAAGTAATAAAGGG + Intergenic
938885151 2:135638856-135638878 AACCTTGAAAAGCTAATGCAGGG - Intronic
938936222 2:136129889-136129911 AACCTTAGAAATGTAAGGAAAGG - Intergenic
939833350 2:147098931-147098953 AGCCTAGGAAAAATAATGGATGG + Intergenic
940176060 2:150878708-150878730 ACCTTTGTAAAACTAATGGAAGG - Intergenic
940240307 2:151555586-151555608 AATCATGGAACACTAATTAACGG - Intronic
940615616 2:156045625-156045647 ATCCTTAGCAAACTAATGCAAGG - Intergenic
940954286 2:159711577-159711599 AAACTTGGAAGAATACTGAAAGG - Intergenic
941389127 2:164889979-164890001 AAACATGGAAAAGAAATGAATGG + Intergenic
942750988 2:179287212-179287234 ATCCTTAGCAAACTAATGCAGGG + Intergenic
942843926 2:180400136-180400158 AGTGTTGGAAAACTAATGCAGGG + Intergenic
943144142 2:184019859-184019881 AAGATTGGAAAAATTATGAAAGG - Intergenic
943816788 2:192267960-192267982 AAGCTTGGAAAATTAATATATGG + Intergenic
943833438 2:192489864-192489886 AACATGGTAAAACTAGTGAATGG + Intergenic
944145066 2:196498650-196498672 ACCTTTGTAAAACTAATGAAAGG + Intronic
945168994 2:206976280-206976302 ACCTTTGTAAAACTAATGGAAGG - Intergenic
945643258 2:212458170-212458192 AACATTGGAAAGCAAATGAGTGG + Intronic
946074608 2:217063675-217063697 AACCTGGGAAAAGGAATGAATGG + Intergenic
946707462 2:222472672-222472694 ACCTTTGTAAGACTAATGAAAGG - Intronic
946707696 2:222475019-222475041 ACCTTTGTAAGACTAATGAAAGG - Intronic
946869022 2:224069309-224069331 AGCCCTGGAAAACTAATACAGGG - Intergenic
1169100858 20:2947551-2947573 AAGCCTAGAAAACTCATGAAAGG - Intronic
1169431426 20:5539716-5539738 ACCTTTGTAAAACTAATGAAAGG + Intergenic
1169439113 20:5619411-5619433 GCCTTTGTAAAACTAATGAAAGG - Intergenic
1170368997 20:15627794-15627816 ACCTTTGTAAAGCTAATGAAAGG - Intronic
1171398532 20:24856739-24856761 ACCTTTGTAAAACTAATGAAAGG + Intergenic
1171402617 20:24887087-24887109 AAGCATGAAAAAATAATGAAAGG + Intergenic
1174013664 20:47470832-47470854 AGCTTTGTAAAACTAATGAAAGG - Intergenic
1174228736 20:49026410-49026432 AGGCTTGGAAAATTGATGAATGG - Intronic
1174914003 20:54636281-54636303 GCCCTTGTAAAATTAATGAAAGG + Intronic
1175513595 20:59552921-59552943 AACTTTGGAAATTTACTGAATGG + Intergenic
1176910641 21:14560945-14560967 GTCTTTGCAAAACTAATGAAAGG + Intronic
1178489929 21:33043135-33043157 AACCTTTAAAAAGCAATGAAAGG - Intergenic
1179241964 21:39600638-39600660 AACCTAGGAAACCCAATAAATGG - Intronic
1179599410 21:42466096-42466118 CACCTTGTAAGACTAATGAAAGG + Intergenic
1179669369 21:42935408-42935430 AACTTTGGAAATTTACTGAATGG - Intergenic
1184638143 22:45852191-45852213 AGCCCTGGCAAACTAATAAATGG + Intergenic
1184702737 22:46187632-46187654 AGCCATGGAAGACTATTGAAGGG - Intronic
949758236 3:7438611-7438633 AACCTGGGAGAACAAATGTAAGG + Intronic
950743768 3:15070520-15070542 TGCCTTGGAAGACTAAAGAAAGG + Exonic
951215817 3:20024109-20024131 AACAGTGGAAAGCTACTGAAAGG - Intergenic
951350173 3:21597421-21597443 AAACTTGTAAATATAATGAATGG + Intronic
951586705 3:24222284-24222306 TACCTTGGAAAGCAAAGGAAGGG - Intronic
951690411 3:25389640-25389662 ATACTTGTAAAATTAATGAATGG - Intronic
951909429 3:27733796-27733818 AAACAGGGAAAACTAATCAATGG - Intergenic
952287794 3:31984706-31984728 ACCTTTGTAAAACTAATGAAAGG - Intronic
952474986 3:33699325-33699347 AATATAGGAAAAATAATGAAAGG + Intronic
953554384 3:43931889-43931911 AACCCAGGAGAACTAGTGAATGG - Intergenic
953825173 3:46245817-46245839 ATCCTTAGCAAACTAATGCAGGG - Intronic
954439544 3:50514248-50514270 AACATTGGAGAACTAGTAAAAGG + Intergenic
954804633 3:53210092-53210114 ACCTTTGTAAAACTAATGAAAGG - Intergenic
955625551 3:60914741-60914763 AACCTTGTATTAATAATGAAGGG + Intronic
955862366 3:63345189-63345211 ACCTTTGTAAAACTAATGAAAGG - Intronic
956369060 3:68538326-68538348 GCCTTTGTAAAACTAATGAAAGG - Intronic
956445259 3:69320047-69320069 AACATGGGGAAACTAAGGAATGG + Intronic
956996303 3:74829975-74829997 AACTTTGGAAATTTACTGAATGG - Intergenic
957588010 3:82157851-82157873 ACCTTTGTAAGACTAATGAAAGG + Intergenic
957946503 3:87069872-87069894 AACAATGGAAAACTAATACAGGG + Intergenic
957999586 3:87734926-87734948 AACTTTGGAAATTTATTGAATGG + Intergenic
958046466 3:88289938-88289960 AGCCTAGGAAAACTAACTAATGG - Intergenic
958762549 3:98326691-98326713 ACCTTTGTAAAGCTAATGAAAGG + Intergenic
958944657 3:100349794-100349816 AGCCTTAGAAGACTAAGGAAAGG - Intronic
959152931 3:102629276-102629298 ACCTTTGTAAAACTAATGAAAGG + Intergenic
959355127 3:105317212-105317234 AGCCTTAGAAAACTAATACATGG - Intergenic
959543261 3:107565189-107565211 AAACTAGTAAAACTAATAAAAGG - Intronic
959777880 3:110190289-110190311 AACATTTGAAAATTAATTAATGG - Intergenic
961069730 3:123911413-123911435 AACATTGGAAAAATGATTAAGGG + Intronic
962096431 3:132297425-132297447 AACTTTGGAAATTTACTGAATGG + Intergenic
962171862 3:133109612-133109634 AACCTTGGAAAACTAATGAATGG - Intronic
962867802 3:139461999-139462021 AACCTGGGAAAAATCAGGAAAGG - Intronic
963085614 3:141433066-141433088 AAACTTGGAAAATTAAGGACAGG + Intronic
963298998 3:143578285-143578307 CACCTAGGAAAACTAGTGAACGG - Intronic
964011624 3:151898841-151898863 ACCTTTGTAAAACAAATGAAAGG + Intergenic
966200683 3:177357683-177357705 ACCCTTTGGAAACAAATGAAGGG + Intergenic
966566504 3:181388155-181388177 AATCCTGGAAATCTAATGTACGG - Intergenic
967644488 3:191905078-191905100 ATCATTGGAAATATAATGAATGG - Intergenic
968124182 3:196146246-196146268 GCCTTTGTAAAACTAATGAAAGG - Intergenic
968496218 4:918388-918410 AAGCTAGGAAAATTAATAAAAGG + Intronic
968544048 4:1186907-1186929 AACCCTGGAGAACTATTGATGGG + Intronic
970887581 4:21004348-21004370 TAACTTGGACAACTGATGAATGG + Intronic
970931391 4:21516417-21516439 ACCCACTGAAAACTAATGAAAGG + Intronic
971218478 4:24683540-24683562 ACCTTTGTAAAACTAATGAAAGG - Intergenic
971842972 4:31878384-31878406 AACCTTGCAAATATAATTAAGGG - Intergenic
972051004 4:34733302-34733324 AACCATGGAATGCTAATGACAGG - Intergenic
972275233 4:37551063-37551085 AACCTTGGAAATTTACTGAATGG - Intronic
973207776 4:47579691-47579713 AACCCTGGAGAACTATTGAGTGG + Intronic
973602719 4:52557934-52557956 AACCATGGAAAAGTATGGAAAGG + Intergenic
974466924 4:62269765-62269787 TACCTTGGAAAGCTATTGCAAGG - Intergenic
974949558 4:68571448-68571470 AACTTTGGAAATTTACTGAATGG + Intronic
974988238 4:69055938-69055960 AACTTTGGAAATTTACTGAATGG - Intronic
975264128 4:72342225-72342247 GCCTTTGTAAAACTAATGAAAGG + Intronic
975307094 4:72862654-72862676 AACCATAAAACACTAATGAAAGG + Intergenic
975581604 4:75911845-75911867 ACCTTTGTAAAACTAATGGAAGG - Intergenic
976978802 4:91197857-91197879 TAGCTTGTAAAATTAATGAATGG + Intronic
976990027 4:91354492-91354514 AACTTTGGAAATTTACTGAATGG + Intronic
977353883 4:95920973-95920995 AACATTAGAAACCTAATTAAAGG - Intergenic
978298887 4:107242643-107242665 AAACCTGGAAAACAAATGAATGG + Intronic
978488267 4:109281192-109281214 ATTCTTTGAAAACTATTGAATGG - Intronic
978516724 4:109576759-109576781 AACCTTGGACTACTATTGATGGG + Intronic
978696164 4:111583239-111583261 AACATTGGAAAATTATTGCAAGG - Intergenic
978713696 4:111816476-111816498 AACTTTGTAAAACTGATGAAAGG + Intergenic
978787202 4:112623120-112623142 ATCCTTAGCAAACTAATGCAGGG - Intronic
979475122 4:121147710-121147732 AAGCTATGAAAACAAATGAAAGG + Intronic
980819476 4:137994768-137994790 ATCTTTGTAAGACTAATGAAAGG - Intergenic
980829128 4:138108478-138108500 GCCTTTGTAAAACTAATGAAAGG + Intergenic
981675409 4:147338031-147338053 AACGGTGGAAAACCATTGAAAGG + Intergenic
982080502 4:151784970-151784992 ACCTTTGTAAGACTAATGAAAGG - Intergenic
982106085 4:152013281-152013303 ACCTTTGTAAGACTAATGAAAGG + Intergenic
982267379 4:153550970-153550992 AACCTGGAAAAATTAAGGAAGGG + Intronic
983003964 4:162459186-162459208 ATCCTTAGCAAACTAATGCAGGG - Intergenic
984351563 4:178601003-178601025 GCCTTTGTAAAACTAATGAAAGG - Intergenic
984491756 4:180442875-180442897 AAACTTGGAAACGTAAGGAAGGG + Intergenic
984722951 4:182993335-182993357 CACCTTTAAAAAGTAATGAAAGG + Intergenic
985753036 5:1693658-1693680 ACGTTTGTAAAACTAATGAAAGG + Intergenic
986010008 5:3705581-3705603 AACCTTAGAAGACTAATTATAGG - Intergenic
986116356 5:4779273-4779295 ATCCTCAGAAAACTAATGCAGGG + Intergenic
987191488 5:15483123-15483145 ACCTTTGCAAAACTAATGAAAGG - Intergenic
988217973 5:28301549-28301571 ACCTTTGTAAAACTAATGAAAGG + Intergenic
988680143 5:33476915-33476937 CACCTTTGTAAACTAATGAAAGG + Intergenic
988705873 5:33725524-33725546 AAGCTTGCCAAACTAAGGAAGGG + Intronic
988783726 5:34546775-34546797 GTTCTTGTAAAACTAATGAAAGG + Intergenic
988831038 5:34987558-34987580 ACCTTTGTAAACCTAATGAAAGG - Intergenic
988866256 5:35338563-35338585 AACTTTGTAAAACTAATTTATGG - Intergenic
989129407 5:38091671-38091693 AAACTTGGAAAACAGATGGAGGG - Intergenic
989437354 5:41430395-41430417 AACCCTGGAAAACTACAGACAGG - Intronic
989615750 5:43335420-43335442 AACACTGGAAAGATAATGAAAGG - Intergenic
990325563 5:54672040-54672062 GCCTTTGTAAAACTAATGAAAGG + Intergenic
990744409 5:58944044-58944066 GCCTTTGTAAAACTAATGAAAGG - Intergenic
991994006 5:72369595-72369617 AACCAGGGATAAATAATGAAAGG - Intergenic
992180987 5:74198173-74198195 AACCATGGGAAACTAGGGAATGG - Intergenic
992376714 5:76195037-76195059 AACCTTGGACAAATGAAGAAAGG - Exonic
992597864 5:78364167-78364189 ATGCTTGGAAAATGAATGAAAGG + Intronic
992989390 5:82268649-82268671 AACCTTGGAAATTTACTGAACGG + Intronic
993039017 5:82790951-82790973 ACCTTTGTAAAACTAGTGAAAGG + Intergenic
993313274 5:86365152-86365174 AACCTAGGAAGAGTAAAGAAAGG - Intergenic
993598353 5:89888256-89888278 AATCTTGTAAAAGTACTGAAGGG + Intergenic
994840857 5:104923449-104923471 ATCCTTGTAAAACTAATGAAAGG - Intergenic
995075474 5:107978358-107978380 GCCTTTGTAAAACTAATGAAAGG + Intronic
995100039 5:108289523-108289545 ATCCCTTGAAACCTAATGAACGG - Intronic
995158620 5:108946975-108946997 AACCTTGGAAGAATTATAAATGG - Intronic
995771328 5:115673937-115673959 AACCTAGAGAAACAAATGAAAGG - Intergenic
996476404 5:123927263-123927285 AACATTAGTAAACTAATGCAAGG - Intergenic
996578720 5:125006240-125006262 AAACTACCAAAACTAATGAAAGG + Intergenic
996861006 5:128065707-128065729 ACCTTTATAAAACTAATGAAAGG + Intergenic
997808142 5:136940155-136940177 AACCTTAGAACAGGAATGAAAGG - Intergenic
998984001 5:147734996-147735018 ATTCTTGCAAAACTACTGAAAGG - Intronic
999648548 5:153743248-153743270 AGCAATGGAAAACTAATGTATGG - Intronic
1000017859 5:157294179-157294201 GCCTTTGTAAAACTAATGAAAGG - Intronic
1000233607 5:159337504-159337526 GCCCTTGTAAAACTAATGAAAGG + Intergenic
1000604576 5:163314421-163314443 AACTTTGGAAATTTACTGAATGG + Intergenic
1000775354 5:165413208-165413230 AAGATAGGAAAACTGATGAATGG + Intergenic
1000843149 5:166246854-166246876 ACACTTGGAAAACTAATTAGTGG - Intergenic
1000847903 5:166304466-166304488 ACCTTTGTAAAACTAATCAAAGG - Intergenic
1000847991 5:166305155-166305177 ACCTTTGTAAAACTAATGAAAGG - Intergenic
1000918410 5:167109745-167109767 AACATTGAAAAACCAAAGAATGG - Intergenic
1001332477 5:170772142-170772164 TGCCTTGCAAAACTCATGAAGGG - Intronic
1002682643 5:180979843-180979865 AACATTAATAAACTAATGAAAGG - Intergenic
1003025106 6:2547898-2547920 GCCTTTGAAAAACTAATGAAAGG + Intergenic
1003320639 6:5047995-5048017 CACCATAGAAAACTATTGAAGGG - Intergenic
1004604391 6:17180156-17180178 GCCTTTGTAAAACTAATGAAAGG - Intergenic
1004604691 6:17183037-17183059 TACTTTGTAAGACTAATGAAAGG + Intergenic
1004704726 6:18113929-18113951 TTCCTTAGAAAACTAAAGAAAGG + Intergenic
1004796362 6:19090345-19090367 GAACTGGCAAAACTAATGAATGG + Intergenic
1004810570 6:19256452-19256474 AAGCTAGGAAAACTAGGGAAAGG + Intergenic
1004907039 6:20245671-20245693 ACCTTTGTAAAACTAATGAAAGG - Intergenic
1005375064 6:25173567-25173589 AACCTTGGATAAGTAATAATTGG - Intergenic
1005462300 6:26080642-26080664 AAAATTGGAAAAATAATGAATGG + Intergenic
1006031912 6:31182324-31182346 AACTTTGGAAATTTACTGAATGG + Intergenic
1007945838 6:45826129-45826151 AAGCTGGGAAATGTAATGAAAGG - Intergenic
1008476163 6:51938078-51938100 ACCTTTGTAAAACTAATGAAAGG + Intronic
1009707295 6:67268011-67268033 ATACTTGAAAAACTGATGAAAGG - Intergenic
1010101520 6:72113477-72113499 ACTTTTGGAAAAATAATGAAAGG + Intronic
1010251548 6:73712536-73712558 AACTTTGGAAAATCATTGAAGGG - Intronic
1010643220 6:78356022-78356044 AATCCTGAAAAACTAATGATAGG - Intergenic
1010729855 6:79379833-79379855 GTTCTTGTAAAACTAATGAAAGG + Intergenic
1011754674 6:90486596-90486618 ACCCTTGTAAAACTAATAAAAGG + Intergenic
1013507883 6:110817236-110817258 AAACTTGGAAAACTAGTGGGAGG + Intronic
1013558982 6:111285549-111285571 AACTTTGGAAATTTACTGAATGG + Intergenic
1013656139 6:112248592-112248614 AACCCTGGAACACTAGGGAATGG + Intronic
1013921252 6:115407178-115407200 ATCCTTAGCAAACTAATGCAGGG - Intergenic
1014401551 6:120996462-120996484 ACCTTTGTAAAGCTAATGAAAGG + Intergenic
1014450526 6:121576535-121576557 ACCTTTGTAAAGCTAATGAAAGG + Intergenic
1014594363 6:123314719-123314741 ATCCTTAGGAAACTAATGCAGGG + Intronic
1015614448 6:135060466-135060488 AACCTTGGAGAGGTAATGATAGG + Intronic
1015756476 6:136611772-136611794 ATCTTTGTAAAACTAATGAAAGG + Intronic
1016631807 6:146241590-146241612 AACCTTGGGAACCTAAGGGAGGG - Intronic
1017039628 6:150297237-150297259 GCCTTTGTAAAACTAATGAAAGG + Intergenic
1018500640 6:164407377-164407399 AAACATGGAAAACAAATTAAAGG + Intergenic
1018779674 6:167051317-167051339 GCCTTTGTAAAACTAATGAAAGG - Exonic
1020450957 7:8319996-8320018 ACCTTTGCAAGACTAATGAAAGG - Intergenic
1020451989 7:8330199-8330221 AAACATGGAAAACTAATCTATGG - Intergenic
1020764727 7:12305449-12305471 CTCCTTGTAAAACTAATGAAAGG + Intergenic
1020879669 7:13743881-13743903 AGCCTTGGAAAAATAATTGATGG - Intergenic
1020977390 7:15023862-15023884 AATATTGGAAAATTAAGGAATGG - Intergenic
1021479849 7:21104142-21104164 GCCTTTGTAAAACTAATGAAAGG - Intergenic
1021885164 7:25130679-25130701 ACCCTTGAAAAACTAATGAAAGG - Intergenic
1021981486 7:26059697-26059719 CACCTTGGAAAATGAGTGAATGG + Intergenic
1022407983 7:30110074-30110096 AATCTTGTAAATATAATGAAAGG - Intronic
1023119330 7:36893553-36893575 AAGATTGGAAAACAAATGTACGG + Intronic
1023523319 7:41071387-41071409 ACTTTTGTAAAACTAATGAAAGG + Intergenic
1023699785 7:42881831-42881853 TTCTTTGTAAAACTAATGAAAGG + Intergenic
1024833159 7:53485291-53485313 AGCCCTGGGAAACTTATGAAAGG - Intergenic
1025734556 7:64135529-64135551 ACCTTTGTAAAACTAATGAAAGG + Intronic
1026290480 7:69001547-69001569 GCCCTTGTAAAACTAATGAAAGG - Intergenic
1026967991 7:74452713-74452735 ACCTTTGTAAAACTAACGAAAGG - Intergenic
1027161344 7:75804720-75804742 GTTCTTGTAAAACTAATGAAAGG - Intergenic
1027745019 7:82062086-82062108 GCCCTTATAAAACTAATGAAAGG - Intronic
1027845032 7:83361712-83361734 AACCATGCAAAAGTCATGAATGG + Intergenic
1027871235 7:83710746-83710768 GTTCTTGTAAAACTAATGAAAGG - Intergenic
1028001926 7:85509532-85509554 ACCTTTGTAAAACTAATGAAAGG + Intergenic
1029338285 7:99920770-99920792 TAAATTGGACAACTAATGAATGG + Intergenic
1029486415 7:100845185-100845207 AACTTTGGAAATTTAGTGAATGG - Intronic
1031325709 7:120394570-120394592 TGCTTTGTAAAACTAATGAAAGG - Intronic
1031513975 7:122679867-122679889 ATCTTTGTAAAACTAATGAAAGG - Intronic
1032979329 7:137263895-137263917 AACTTTGGAAATCTACTGAATGG + Intronic
1033067308 7:138168330-138168352 ATTCTTGTAAAACTAATGAAAGG - Intergenic
1033074881 7:138239633-138239655 GACTTTGTAAGACTAATGAAAGG - Intergenic
1033077114 7:138259974-138259996 GTTCTTGTAAAACTAATGAAAGG + Intergenic
1033091347 7:138389008-138389030 GCCTTTGTAAAACTAATGAAAGG - Intergenic
1033495739 7:141893324-141893346 AACCTTGGAAAAGATCTGAATGG + Intergenic
1033825604 7:145186315-145186337 AGCCATGGACAAGTAATGAATGG - Intergenic
1033898210 7:146102140-146102162 AACCTTCGAAAACTGATACAGGG - Intergenic
1033979070 7:147141296-147141318 TACCTTGAAAAACTAATCAAGGG + Intronic
1033997252 7:147366184-147366206 AATTTTGGAAATCTAATGAATGG - Intronic
1034541480 7:151761236-151761258 ACCATTGCAAAACTAATGAGAGG + Intronic
1035988681 8:4463613-4463635 AACCTTGAAAACCTACTAAATGG + Intronic
1036712429 8:11089261-11089283 AACCTTAGAAACCTACTGCATGG + Intronic
1036998001 8:13681963-13681985 AATCTTGGAAAACCAGTAAAGGG + Intergenic
1037170574 8:15886901-15886923 AACCTTGGATCACTTCTGAAAGG - Intergenic
1037259219 8:16988248-16988270 AGAGTTGGAAAACGAATGAATGG + Intergenic
1037735594 8:21563372-21563394 ACCTTTGTAAAACGAATGAAAGG + Intergenic
1039184957 8:34906418-34906440 ACCTTTATAAAACTAATGAAAGG - Intergenic
1039303136 8:36231760-36231782 ACCCTTGTAAAACTAATGAAAGG - Intergenic
1039438808 8:37580427-37580449 AGCCCTGGAAAAGTAATGCAGGG + Intergenic
1039666058 8:39529574-39529596 AACTTTGGTAAAATATTGAATGG - Intergenic
1039770010 8:40676224-40676246 ATCCTTGGGAAAGTATTGAAGGG - Intronic
1040126705 8:43745938-43745960 AACCTGCTAAAACTAAAGAAAGG - Intergenic
1040137382 8:43870451-43870473 AACCTATGAAACCAAATGAAAGG - Intergenic
1040728090 8:50408174-50408196 GCCTTTGTAAAACTAATGAAAGG - Intronic
1041425609 8:57716995-57717017 ACCTTTGTAAAACTAATGAAAGG - Intergenic
1042088302 8:65132214-65132236 AACACTGGAAAGATAATGAAAGG - Intergenic
1042207257 8:66341931-66341953 TCCTTTGTAAAACTAATGAAAGG + Intergenic
1042395756 8:68290246-68290268 ATCTTTTTAAAACTAATGAAAGG - Intergenic
1043379946 8:79691838-79691860 GCCTTTGTAAAACTAATGAAAGG - Intergenic
1043759043 8:84042330-84042352 AAACTTGGTAAAATAATGATAGG + Intergenic
1043877915 8:85507418-85507440 ACCCTTGTAAAACTAAAGAAAGG - Intergenic
1044190234 8:89307731-89307753 AATTTTGGAAAAATAGTGAAAGG - Intergenic
1044573784 8:93747327-93747349 GCCCTTGTGAAACTAATGAAAGG - Intergenic
1044963156 8:97550832-97550854 TACCATGGGAAACTAAAGAAAGG + Intergenic
1045079684 8:98611950-98611972 AAACTAGGAAAACTAATTCAGGG + Intronic
1045646799 8:104307303-104307325 GCTCTTGTAAAACTAATGAAAGG + Intergenic
1045649334 8:104327846-104327868 GCCCTTGTAAAACTAATGAAAGG - Intergenic
1045764877 8:105655547-105655569 AACATTAGAAAACTGTTGAATGG + Intronic
1047806881 8:128370411-128370433 ACCTTGGTAAAACTAATGAAAGG + Intergenic
1048389035 8:133943044-133943066 ACCTTTGTAAAACTAATGAAAGG - Intergenic
1049449560 8:142653208-142653230 ACCCTCGTAATACTAATGAAAGG + Intergenic
1050163317 9:2740111-2740133 ACCTTTGTAAAACTAGTGAAAGG - Intronic
1050705168 9:8388446-8388468 AACCTTGAGAAATTAATGATGGG - Intronic
1050809115 9:9720868-9720890 ATCCTTAGCAAACTAATGCACGG + Intronic
1051153331 9:14110596-14110618 AATCTTTGTAAAGTAATGAAAGG + Intronic
1051440962 9:17082279-17082301 ATCCTTTTAAAACTAATGTATGG + Intergenic
1052300882 9:26951302-26951324 AACCCAGGCAAACTAAAGAAAGG + Intronic
1052313745 9:27095238-27095260 TACCTTGGAAAACCAAATAAAGG - Intergenic
1052681552 9:31699426-31699448 AACCTTGGTGAAAAAATGAATGG - Intergenic
1053477333 9:38392137-38392159 AAGCTTGGAAAACACAGGAAAGG - Intergenic
1053587386 9:39473965-39473987 AACCATGGAAAAGTAACAAAAGG - Intergenic
1053674108 9:40404549-40404571 AACCTTGGAACAAGAATTAAAGG + Intergenic
1053923911 9:43030917-43030939 AACCTTGGAACAAGAATTAAAGG + Intergenic
1054385213 9:64544618-64544640 AACCTTGGAACAAGAATTAAAGG + Intergenic
1054510516 9:65971741-65971763 AACCTTGGAACAAGAATTAAAGG - Intergenic
1054578915 9:66891271-66891293 AACCATGGAAAAGTAACAAAAGG + Intronic
1054764276 9:69030184-69030206 GCCTTTGTAAAACTAATGAAAGG - Intergenic
1054923836 9:70568487-70568509 AATTTTGAAAAACAAATGAATGG - Intronic
1054966945 9:71039694-71039716 AACATTGGAAATAAAATGAAGGG + Intronic
1055191211 9:73527190-73527212 TCCTTTGCAAAACTAATGAAAGG + Intergenic
1055520874 9:77080001-77080023 GCCTTTGTAAAACTAATGAAAGG - Intergenic
1056234248 9:84575814-84575836 AACATTTAAAAACTCATGAAAGG - Intergenic
1057273937 9:93666201-93666223 GACCTTAGAACACTCATGAAAGG - Intronic
1058376676 9:104329992-104330014 AAGATTGGATAACTAATAAATGG + Intergenic
1058982324 9:110181581-110181603 ACCTTTGTAAAACTAATGAAAGG - Intergenic
1059344490 9:113619140-113619162 ATCTTTGGAGAAATAATGAAAGG + Intergenic
1060645355 9:125274347-125274369 AACAATGGAAAAAAAATGAAGGG + Intronic
1185946571 X:4383841-4383863 GCCTTTGTAAAACTAATGAAAGG + Intergenic
1186024299 X:5291935-5291957 AATTTTGGTAAAATAATGAAAGG + Intergenic
1186079163 X:5911923-5911945 ACCTTTGTAAAAGTAATGAAAGG + Intronic
1186205381 X:7194524-7194546 ACCTTTGTAAAACTAATGAACGG - Intergenic
1186569022 X:10694955-10694977 GCCCTTGTAAAACTAATGAAAGG + Intronic
1186807359 X:13153536-13153558 ACCTTTGTAAAACTAATGAAGGG + Intergenic
1187675259 X:21710157-21710179 AAACATAGAGAACTAATGAATGG + Intronic
1187788639 X:22922566-22922588 ATCCTTAGCAAACTAATGACAGG - Intergenic
1187841271 X:23491505-23491527 ATTCTTGTAAAACTAATGAAAGG + Intergenic
1188026875 X:25219178-25219200 AGCCTTGCAAAACTATTAAAGGG + Intergenic
1188178584 X:27024803-27024825 TTCCTTGGAAAACAAATGAAAGG - Intergenic
1188375929 X:29427872-29427894 ACCTTTGTAAAGCTAATGAAAGG - Intronic
1189136547 X:38556507-38556529 AAACTTGTTGAACTAATGAATGG - Intronic
1189576225 X:42356491-42356513 AACTTTGTAAAATTAATCAAAGG - Intergenic
1189622109 X:42852714-42852736 AACCTTGCAGAAAGAATGAAAGG + Intergenic
1189960991 X:46324593-46324615 GTCTTTGTAAAACTAATGAAAGG - Intergenic
1190030924 X:46972119-46972141 AATCATTGAAAAATAATGAAAGG + Intronic
1190356983 X:49614862-49614884 AAACTTTTAAAACTAATCAATGG - Intergenic
1190895678 X:54615657-54615679 TACCTTCGAAAACAGATGAAGGG + Intergenic
1191586467 X:62832727-62832749 ATCTTTGGTCAACTAATGAATGG + Intergenic
1192804662 X:74498135-74498157 GCCTTTGTAAAACTAATGAAAGG + Intronic
1193486293 X:82088582-82088604 ACCATTGGAACAGTAATGAAAGG + Intergenic
1193769535 X:85572678-85572700 GAACTTGGAAAACATATGAAAGG + Intergenic
1193818926 X:86138311-86138333 AACCGGGGAAAACTAATGTGTGG + Intergenic
1193877968 X:86885291-86885313 AAGCTTGGAAAAATAGTGGAAGG + Intergenic
1194758226 X:97762991-97763013 GCCTTTGTAAAACTAATGAAAGG - Intergenic
1195046418 X:101058537-101058559 ACCCTTGTAAAACTAATGAAAGG + Intergenic
1195140995 X:101959633-101959655 CACCTTTGTAAAATAATGAAAGG - Intergenic
1195346892 X:103959963-103959985 ATCCTTAGCAAACTAATGCAGGG + Intronic
1195360550 X:104078878-104078900 ATCCTTAGCAAACTAATGCAGGG - Intergenic
1195655782 X:107330204-107330226 AACCTTAGCAAACTAAGGCAGGG + Intergenic
1196415633 X:115468022-115468044 AACCTTGGAAAACTTTTTAAAGG - Intergenic
1197116695 X:122842199-122842221 AAACTTAGAAAAATAATAAAGGG - Intergenic
1197244173 X:124151105-124151127 ACCTTTGTAAAACTAATGAAAGG - Intronic
1197245770 X:124164701-124164723 GCCTTTGTAAAACTAATGAAAGG - Intronic
1199797280 X:151212612-151212634 CATCTTGGAAAACTAGAGAAGGG + Intergenic
1199895399 X:152121555-152121577 AACCCTGGAAAATTATAGAAGGG - Intergenic
1200017310 X:153177107-153177129 AACCCTGGAAAATTATAGAAGGG + Intergenic
1200421556 Y:2975024-2975046 AACTTAAGAAAACTAATGAAAGG - Intronic
1201373251 Y:13288351-13288373 AACTTTGGAAATTTACTGAATGG - Intronic
1201697171 Y:16838857-16838879 AACTTTGGAAATGTATTGAATGG - Intergenic
1201733795 Y:17235422-17235444 GCCTTTGTAAAACTAATGAAAGG + Intergenic
1201888262 Y:18911376-18911398 ATCCTTAGCAAACTAATGCAGGG + Intergenic