ID: 962176164

View in Genome Browser
Species Human (GRCh38)
Location 3:133157843-133157865
Sequence ACCGGGGGAGCTCATTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 83}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962176164_962176171 20 Left 962176164 3:133157843-133157865 CCAGGGGAATGAGCTCCCCCGGT 0: 1
1: 0
2: 0
3: 6
4: 83
Right 962176171 3:133157886-133157908 GTGTGACTCTGTTGAAAGGCTGG 0: 1
1: 0
2: 3
3: 72
4: 2050
962176164_962176170 16 Left 962176164 3:133157843-133157865 CCAGGGGAATGAGCTCCCCCGGT 0: 1
1: 0
2: 0
3: 6
4: 83
Right 962176170 3:133157882-133157904 CTGAGTGTGACTCTGTTGAAAGG 0: 1
1: 0
2: 2
3: 26
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962176164 Original CRISPR ACCGGGGGAGCTCATTCCCC TGG (reversed) Intronic
904308977 1:29613212-29613234 ACCTGGGGAGCTGATGCCACAGG + Intergenic
905170709 1:36108133-36108155 ACCCAGGGAGTCCATTCCCCAGG + Intronic
910003425 1:82364804-82364826 ACCGGGCAAACTGATTCCCCTGG - Intergenic
910759263 1:90718745-90718767 AACGGGGGAGCTAATGCCCGAGG + Intergenic
913119374 1:115725827-115725849 ACAGGGTCAGCTCATTCCCAGGG + Intronic
1067285797 10:44906860-44906882 GCTGGGGGAGCTTATTCGCCTGG + Intergenic
1070741382 10:78905488-78905510 AGTGGGGCAGCTCATTCACCAGG - Intergenic
1077540588 11:3144809-3144831 GCCAGGGCAGCTCATTCCCCAGG + Intronic
1084666076 11:70577056-70577078 ACTGGGGGAGCTCATCCCCAGGG - Intronic
1088844128 11:113650601-113650623 TCCGAGGTAGCTCATTCACCTGG - Intergenic
1089326461 11:117660755-117660777 ACTAGGGGAGCTCATTCACATGG + Intronic
1091875331 12:3929032-3929054 AGCCGGTGAGCTCATTTCCCGGG + Intergenic
1094644231 12:32305858-32305880 ACTGGGAGAGCTCCTTCCGCAGG - Exonic
1100932982 12:99632065-99632087 GCCTGGGGTGCTCATTGCCCAGG + Intronic
1103903567 12:124315835-124315857 ACAGAGGGAGCTCAAGCCCCAGG - Exonic
1119229691 14:72970353-72970375 ACCAGGGAGGCTCACTCCCCAGG + Exonic
1121843020 14:97150435-97150457 ACCAGGTGACCTCATTCCCTTGG + Intergenic
1122549035 14:102540050-102540072 GGCGGTGCAGCTCATTCCCCCGG + Intergenic
1124496102 15:30188245-30188267 AGAGGGGGAGCTCCTTGCCCAGG - Intergenic
1124747472 15:32350402-32350424 AGAGGGGGAGCTCCTTGCCCAGG + Intergenic
1125535912 15:40441169-40441191 CCCGGGGGCGCTCAATTCCCGGG - Intronic
1129968579 15:79758012-79758034 ACCTGGGAGGCTCACTCCCCAGG + Intergenic
1130104945 15:80922055-80922077 ACCTGGGGAGTACATTCCCACGG - Exonic
1142509405 17:385008-385030 ACCGGGGGAGATCGCGCCCCGGG - Intronic
1143729705 17:8874207-8874229 AATGGGGGAGCCCTTTCCCCAGG + Intergenic
1146941574 17:36847304-36847326 GCCTGGGGAGCTCCTTGCCCTGG + Intergenic
1147363514 17:39945687-39945709 ACCCGGGGAGCTTATTCCAAAGG + Intergenic
1147363945 17:39948096-39948118 ACCCGGGGAGCTTATTCCAAAGG + Intergenic
1158478979 18:57803723-57803745 ACCGAGGGAGCTCAGGTCCCGGG - Intergenic
1158672419 18:59488626-59488648 ACCTGGGGAGTACATTCCCAAGG - Intronic
1160011152 18:75107913-75107935 GCTGGGGGAGCTCATTGTCCTGG - Intergenic
1161951685 19:7471157-7471179 GCCCTGGGAGCTCATTTCCCGGG - Exonic
1162346134 19:10119206-10119228 AGCTGGGGAGCTCCTGCCCCTGG - Intronic
1164829007 19:31306149-31306171 ACCGTGTGCGCTCATTCCCGGGG + Intronic
1165819537 19:38665822-38665844 AGCCGGGGGGCTCTTTCCCCGGG + Intronic
1165822030 19:38682811-38682833 CCAGGGGGAGATCATTCCCAGGG - Intronic
1166270747 19:41711977-41711999 ACAGCGGAAGCTCATTCTCCTGG - Intronic
1166438420 19:42789319-42789341 ACAGTGGAAGCTCATTCTCCTGG + Intronic
1166473444 19:43100053-43100075 ACAGTGGAAGCTCATTCTCCTGG + Intronic
1167898702 19:52601944-52601966 CCCGGGGGAGCTCATTTTCCAGG - Intronic
1167995162 19:53395784-53395806 CCCGGGGGAGCGCATTTTCCAGG - Intronic
1167999422 19:53432599-53432621 CCCGGGGGAGCGCATTTTCCAGG - Intronic
930069070 2:47351034-47351056 ACAGGGGAATTTCATTCCCCTGG - Intronic
932430797 2:71672621-71672643 CCTGGGGGGGTTCATTCCCCAGG + Intronic
935091439 2:99898684-99898706 ACTGAGGAAGCCCATTCCCCAGG + Intronic
938293009 2:130160258-130160280 ACAGGGGCACCTCATTCCGCAGG - Intronic
938463548 2:131512707-131512729 ACGGGGGCACCTCATTCCGCAGG + Intergenic
945032914 2:205682167-205682189 CCCGGGGGCGCTTCTTCCCCAGG + Intronic
947017715 2:225639855-225639877 ACCTTGAGAGCTCAGTCCCCAGG - Intronic
948793727 2:240391822-240391844 CCCGGGGGTGCTCATTCCTGGGG - Intergenic
948910066 2:240998481-240998503 GCGCGGGGAGCTCAGTCCCCTGG - Intergenic
1176140504 20:63542752-63542774 CCCGTGGGAGCTCATTGCTCTGG + Intronic
1179061156 21:37980980-37981002 ACTGGGGGTGATCATTCCTCTGG - Intronic
1179457443 21:41508690-41508712 TCCGGGGGAGCACTTTCCACCGG - Intronic
1181055948 22:20260578-20260600 ACCTGGGGAACTCACTCACCCGG - Intronic
1181333206 22:22110806-22110828 ACCCGGGCAGCTCCTTCCACAGG - Intergenic
1182416477 22:30224515-30224537 ACCGGGTGTGCTCATGTCCCTGG - Intergenic
1182577525 22:31283073-31283095 ACTGGGGGGGCTCAGGCCCCAGG + Exonic
1182719089 22:32383382-32383404 GCCTGGGGAGCTCATCCCCAGGG - Intergenic
1183719369 22:39553405-39553427 CCCGGTGGAGCACATTCCTCTGG - Intergenic
1184130872 22:42515704-42515726 ACTGAGGGAGCTCCTTCCCCAGG - Intronic
1184141048 22:42577534-42577556 ACTGAGGGAGCTCCTTCCCCAGG - Intergenic
949373146 3:3357027-3357049 ACAGAGAGAGCTCATTTCCCTGG + Intergenic
950046043 3:9949204-9949226 ACCTGGGGAGCTGACTTCCCAGG + Exonic
950408055 3:12816792-12816814 GCCGGGTGATCTCATTCCGCAGG - Exonic
956545348 3:70395150-70395172 ACCAGGGCGTCTCATTCCCCAGG - Intergenic
962176164 3:133157843-133157865 ACCGGGGGAGCTCATTCCCCTGG - Intronic
969228226 4:5812701-5812723 ACCGGGCGAGATCATTCTTCAGG + Exonic
969533010 4:7740004-7740026 ACCGGGAGAGCCCACTCCTCAGG + Intronic
970077292 4:12238230-12238252 ACCAGTAGAGCTCATTGCCCAGG - Intergenic
973949319 4:55995187-55995209 ACCCGGGAAGGTTATTCCCCTGG + Intronic
981108119 4:140904428-140904450 ACCAAGGGAGATCATTCTCCTGG + Intronic
995258269 5:110072523-110072545 ACCTGGGAAGCTCAATCCCAGGG + Intergenic
1005465314 6:26107229-26107251 ACCAGGGGTCCTCATTTCCCCGG - Intergenic
1007369502 6:41417122-41417144 ACCGAGGGAGCTCGTTCTTCTGG + Intergenic
1014266928 6:119289558-119289580 ACCAGGGGATCACATTACCCTGG + Intronic
1015578738 6:134701309-134701331 GCTGGGGGAACTCATTGCCCTGG - Intergenic
1019298563 7:291335-291357 CCCGGGGGTGCTCCTTCCCCGGG - Intergenic
1019939585 7:4278733-4278755 ACCTGGCCAGCCCATTCCCCTGG + Intergenic
1021920407 7:25479392-25479414 ACCAGCGGAGCACATTCCCTAGG - Intergenic
1022664829 7:32400856-32400878 ACAGTGGGAGCTCATTCAGCAGG - Intergenic
1023742668 7:43294469-43294491 ACAGTGGCAGCTGATTCCCCAGG - Intronic
1031961725 7:127996062-127996084 CCCCGGGGAGCTCATTCTGCAGG + Intronic
1034681764 7:152934213-152934235 CCTAGGGGAGCTCACTCCCCAGG + Intergenic
1039893833 8:41702144-41702166 ACCCGGGCTGCTCTTTCCCCAGG - Exonic
1055697257 9:78899500-78899522 ACAAGTGGAGCTCATTCCCATGG - Intergenic
1057259323 9:93575580-93575602 ACCGTGGGGGCTCAGTTCCCTGG + Intergenic
1060154121 9:121307446-121307468 ACCAGGGGACTTCATTCACCTGG - Intronic
1062235985 9:135507812-135507834 GCCCGGGCAGCCCATTCCCCAGG - Intergenic
1198271089 X:135056452-135056474 ACCAGGGGACCCCAATCCCCAGG - Intergenic