ID: 962181052

View in Genome Browser
Species Human (GRCh38)
Location 3:133206874-133206896
Sequence CACTTAAGTCTGCTGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 2, 1: 2, 2: 11, 3: 22, 4: 129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962181050_962181052 0 Left 962181050 3:133206851-133206873 CCTTCAGAGCTGGCATGTAGGAA 0: 1
1: 0
2: 6
3: 21
4: 168
Right 962181052 3:133206874-133206896 CACTTAAGTCTGCTGAAGCTGGG 0: 2
1: 2
2: 11
3: 22
4: 129
962181047_962181052 9 Left 962181047 3:133206842-133206864 CCACTGCTCCCTTCAGAGCTGGC 0: 1
1: 121
2: 859
3: 3323
4: 2999
Right 962181052 3:133206874-133206896 CACTTAAGTCTGCTGAAGCTGGG 0: 2
1: 2
2: 11
3: 22
4: 129
962181049_962181052 1 Left 962181049 3:133206850-133206872 CCCTTCAGAGCTGGCATGTAGGA 0: 1
1: 0
2: 3
3: 18
4: 170
Right 962181052 3:133206874-133206896 CACTTAAGTCTGCTGAAGCTGGG 0: 2
1: 2
2: 11
3: 22
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962181052 Original CRISPR CACTTAAGTCTGCTGAAGCT GGG Intronic
900099387 1:954904-954926 CACTAAAATCTGCTGAAGCATGG + Intronic
901230549 1:7639655-7639677 CACTTCAGCCTCCTGAGGCTGGG - Intronic
902558932 1:17264893-17264915 CACTTCAGCCTCCTGAGGCTGGG - Intronic
903468089 1:23566468-23566490 CTCCTAAGCCTGCTGATGCTTGG - Intergenic
908693733 1:66812707-66812729 CACTTAAGGCTGCAGAAGCAGGG + Intergenic
910664438 1:89709286-89709308 CACTGAAGTTTTCTGAACCTTGG + Intronic
911222895 1:95269020-95269042 AACTTAAATCTTCTTAAGCTAGG + Intergenic
911669546 1:100592457-100592479 CGTTTAAGTCTGCTAAAGCTGGG - Intergenic
912076674 1:105884259-105884281 TGTTTAAGTCTGCTGAAGCTGGG + Intergenic
912276371 1:108262435-108262457 AGATTAAGTCTGCTGAACCTCGG - Intergenic
912291857 1:108431923-108431945 AGATTAAGTCTGCTGAACCTCGG + Intronic
912650452 1:111434023-111434045 CACTTAACTATGAGGAAGCTGGG + Intergenic
916935747 1:169626545-169626567 CACTCCAGCCTGCTGAAGATTGG + Intronic
916946321 1:169731843-169731865 CACTTGAGTCCACTGAAGCCAGG + Exonic
917335540 1:173921034-173921056 CTCTTTAGTCTTCTGCAGCTTGG + Intergenic
919375862 1:196794167-196794189 CACTTTAGGATGCTGAAGCCAGG + Intronic
919385563 1:196919052-196919074 CACTTTAGGATGCTGAAGCCAGG + Intronic
919599045 1:199600035-199600057 CGTTTAGGTCTGCTCAAGCTGGG - Intergenic
922912396 1:229228592-229228614 CCCCTCAGTCTCCTGAAGCTGGG - Intergenic
924818217 1:247461697-247461719 TACATAAGTCTTCTGAGGCTCGG + Intergenic
1063412801 10:5849673-5849695 CGCTTCAGTCTCCTGAAGCTGGG + Intergenic
1067809350 10:49415286-49415308 CCCTTTAGTCTCCTGCAGCTGGG - Intergenic
1068637246 10:59361233-59361255 CACTTAAGTCTGCTCAAAACTGG + Intronic
1069139876 10:64810006-64810028 CATTTAAGTCTGCTGGAGCTGGG + Intergenic
1069927526 10:71861207-71861229 CACCTAAGCCTCCTGTAGCTGGG - Intergenic
1070377926 10:75852199-75852221 CACTGAATTCTAGTGAAGCTTGG - Intronic
1072365305 10:94703307-94703329 CGTTTAAGTCTGCTGAAGCTGGG + Intronic
1073402029 10:103265678-103265700 CACTCAAATCTGCTAATGCTTGG - Intergenic
1074790475 10:116881575-116881597 CACTTGAGGCTGCTGCGGCTAGG + Exonic
1075894753 10:125985239-125985261 CACTGAATTCTGGTGAGGCTTGG + Intronic
1080033552 11:27687981-27688003 CATTTAAGTCTGCTGAAGCTGGG + Intronic
1083330049 11:61893253-61893275 CACTCAGGGCTGCTGAAGGTGGG - Intergenic
1085509654 11:77081836-77081858 CACTCAGGTCTGCTGCAGCAGGG - Intronic
1085850111 11:80109894-80109916 AGATTAAGTCTGCTGAAGCTGGG - Intergenic
1086213716 11:84351774-84351796 AACCTAAATCTGCTGAAGCAAGG - Intronic
1092581626 12:9849160-9849182 CGTTTAAGTCTGCTGAAGCTTGG + Intergenic
1093402347 12:18761488-18761510 CATTTAAGTCTGCTGAAGCTGGG - Intergenic
1099778143 12:87160963-87160985 CAATCTAGTATGCTGAAGCTGGG - Intergenic
1100351182 12:93784506-93784528 CACTTCATTCTGCTGGTGCTTGG - Intronic
1100612150 12:96200298-96200320 CTCTTAAGACTGATGAAGCTAGG + Intronic
1100768682 12:97897879-97897901 AGTTTAAGTCTGCTGAAGCTGGG + Intergenic
1105325154 13:19364174-19364196 CACCTCAGTCTCCTGAGGCTGGG - Intergenic
1105862285 13:24426171-24426193 CACTGCAGTCTGCTGATCCTGGG - Intronic
1109967495 13:69720477-69720499 CACTCAATTCTGCTGAAACAGGG + Intronic
1115788190 14:36849812-36849834 CACTTAAGTTTTCAGAATCTAGG + Intronic
1117932151 14:60854889-60854911 CAATTCAATCTGATGAAGCTGGG + Intronic
1120809589 14:88790682-88790704 CAGTTAAGGCTGCTCCAGCTAGG + Intronic
1122563533 14:102634420-102634442 TACTCAAATCTGCCGAAGCTTGG - Intronic
1122677598 14:103429304-103429326 CACTTAACTTTGCTGGACCTTGG + Intronic
1127757802 15:62110305-62110327 CACTTAAGTGTGATGTACCTTGG - Intergenic
1129524385 15:76204590-76204612 CACTCTACCCTGCTGAAGCTGGG - Exonic
1129938158 15:79468081-79468103 CACTTAAGTTGTCTGCAGCTGGG - Intronic
1131406422 15:92168629-92168651 CACCTAAGACTGCTGTAGCATGG + Intronic
1132503650 16:296341-296363 GACCTAAGTCTGAGGAAGCTGGG + Intronic
1137846644 16:51696281-51696303 CACCTAAGTCTCTCGAAGCTGGG + Intergenic
1138126504 16:54443176-54443198 CCCTTAAATCTGGTGAAGCTAGG + Intergenic
1138844026 16:60543217-60543239 CACAGAAATCTGCTGAGGCTTGG - Intergenic
1146841377 17:36157734-36157756 CACTTAACTCTGCTGTTGCAGGG + Intergenic
1153626966 18:7030785-7030807 CACTTATGTCTTTTGTAGCTAGG - Intronic
1153944491 18:10007216-10007238 TACCTATGTCTGCTAAAGCTGGG + Intergenic
1156814742 18:41296266-41296288 CACGTAAGTCTGTTGATGCCTGG + Intergenic
1157067247 18:44366519-44366541 CATTTAAGTCTCCTGAAGCTGGG + Intergenic
1159076692 18:63688595-63688617 AGATTAAGTCTGCTGAACCTGGG - Intronic
1161160524 19:2759250-2759272 CACTTACAGCTGCTGAATCTGGG + Exonic
1161668691 19:5592134-5592156 CTCTTAATTCTGCTGGAGTTTGG - Intronic
1162789180 19:13054243-13054265 CACCAAAGTCAGCTGGAGCTGGG - Intronic
928018853 2:27684895-27684917 CACAGAAGTCTGCTGGAGGTGGG - Intronic
928437405 2:31263790-31263812 CACCTAACTCTCCAGAAGCTGGG - Intronic
928588061 2:32782618-32782640 CATTTCAGAATGCTGAAGCTTGG + Exonic
933166583 2:79083330-79083352 AGGTTAAGTCTGCTGAAGCTTGG + Intergenic
935708308 2:105875443-105875465 CAGTTCAGTCTGCAGCAGCTTGG - Intronic
937405026 2:121619855-121619877 CACTGAGAACTGCTGAAGCTTGG + Intronic
940114113 2:150189143-150189165 CACTCAAGTCTGTTGAAACATGG + Intergenic
943135917 2:183912864-183912886 TACTTAAGTGTGATGAAGCATGG - Intergenic
946913044 2:224485677-224485699 CATTTAATTCTGCTGAAGCTGGG - Intronic
947660005 2:231859531-231859553 GAATTGAGTGTGCTGAAGCTGGG + Intergenic
1170556504 20:17519079-17519101 CTCTTAAGACTGCTGAGGATGGG + Intronic
1172957351 20:38770684-38770706 CACTTAAATCCCCTGAAGCCAGG + Intronic
1180654942 22:17412561-17412583 CACTTACCTCTGGTGAAGGTAGG - Intronic
1181619505 22:24079554-24079576 CATTTAAGTCTACTGTACCTAGG - Intronic
1181870057 22:25891019-25891041 CACTTAGGTCTCCTAAGGCTTGG + Intronic
1181993527 22:26856961-26856983 CACTTAACCTTTCTGAAGCTGGG - Intergenic
1184199253 22:42954507-42954529 CACTTGAGCCTTCTGAAGCTTGG + Intronic
949898448 3:8790076-8790098 CACTTCAGTCTCCCGTAGCTGGG - Intronic
950797072 3:15518935-15518957 CTCTTAATTCTTCTGAAGATAGG - Intronic
955620611 3:60859461-60859483 CACGTAACTCCACTGAAGCTTGG - Intronic
956118450 3:65941903-65941925 CACCTCAGCCTCCTGAAGCTGGG + Intronic
958515110 3:95104371-95104393 CGAGTGAGTCTGCTGAAGCTGGG - Intergenic
959953053 3:112202915-112202937 CAATGAACTCTGCAGAAGCTAGG - Intronic
962181052 3:133206874-133206896 CACTTAAGTCTGCTGAAGCTGGG + Intronic
963360494 3:144266591-144266613 CAATTAACTCTGCTGAAGAGAGG + Intergenic
964689865 3:159438276-159438298 CACTTAAGACTACAGAAGCCTGG + Intronic
965379160 3:167966943-167966965 CACTTCAGTCTGCAGAGGTTCGG - Intergenic
966181021 3:177188730-177188752 CACATAAATCTCCTGAATCTGGG + Intronic
966339388 3:178908365-178908387 CACTGAAGTCTGCGTAAGCAAGG - Intergenic
966459934 3:180165592-180165614 CACTCAAGGCTGCTGAACCAAGG + Intergenic
967682413 3:192379784-192379806 GACTTAAGTCTCCTGAATCCTGG - Intronic
969132461 4:5001937-5001959 AGATTAAGTCCGCTGAAGCTGGG + Intergenic
971746405 4:30586826-30586848 AAATTAAGTCTGCTGAACCTGGG + Intergenic
972605817 4:40612575-40612597 CTCTGAAGTCTGCAGAAACTAGG + Intronic
976145622 4:82040297-82040319 CACTTGAATCTGCTCAGGCTTGG + Intronic
976583914 4:86773201-86773223 CACTTAATTCTTCTGAGTCTTGG + Intronic
979512276 4:121567856-121567878 CACTTAAGTCTGCTGAAGCTGGG - Intergenic
982794932 4:159632894-159632916 AACTCAACTCTGCTGAAGCGAGG - Intergenic
984526002 4:180860307-180860329 TGTTTAAGTCTGCTGAATCTGGG + Intergenic
986314737 5:6579067-6579089 CACCTAAGTGGGCTGAAGCGGGG + Intergenic
990800239 5:59593929-59593951 TCTTTAAATCTGCTGAAGCTTGG + Intronic
991536192 5:67671661-67671683 ACATTAAGTCTGCTGGAGCTTGG + Intergenic
991929006 5:71733286-71733308 CACTTTGCTCTGCCGAAGCTAGG - Intergenic
992465823 5:77002982-77003004 CACTGAATTCTGCTGAAGGTAGG - Intergenic
992798414 5:80273844-80273866 CACCTCAGTCTCCTGTAGCTGGG + Intergenic
993441535 5:87962618-87962640 CAATTAAATCTGCTGAAGGATGG + Intergenic
995662592 5:114501525-114501547 CTGTTACCTCTGCTGAAGCTGGG + Intergenic
995741774 5:115363534-115363556 CACTGCAGTCTGCTGAGGCAAGG - Intergenic
996403724 5:123087925-123087947 CACTCAAGTTTTCTGAACCTGGG - Intergenic
998032270 5:138880845-138880867 CACTTAAGGTTGATGAAGCTTGG + Intronic
999843246 5:155451268-155451290 CACATAAGGCTGCAAAAGCTGGG - Intergenic
1001305628 5:170570477-170570499 CACTTGAGAAGGCTGAAGCTGGG + Intronic
1005059953 6:21766681-21766703 CACTTAAGTCTACTGCAGCTTGG + Intergenic
1009455315 6:63849255-63849277 CCTTTAAGTATGCTGAAGCTGGG - Intronic
1011332701 6:86227937-86227959 TATTTAAGTCTGCTGAAGCTGGG + Intergenic
1011957703 6:93043883-93043905 CACTCAAGTCTGCTGATACTTGG + Intergenic
1012778056 6:103522463-103522485 TGTTTAAGTCTGCTGAAGCTGGG - Intergenic
1014791507 6:125677840-125677862 CACTTAAGTATTCTGAGCCTTGG + Intergenic
1018632424 6:165832728-165832750 CACTTAATTCTGGTTAAGGTGGG + Intronic
1018658066 6:166059164-166059186 CATTTCAGACTGCTGAAGCTTGG - Intergenic
1018920009 6:168165912-168165934 AACTAAAGTCTGCTGAAGATTGG + Intergenic
1021448543 7:20759247-20759269 CATTTAAATCTGCTGAAGTATGG - Intronic
1021556795 7:21927883-21927905 CGTTTAAGTCTGCTTAAGCTGGG - Intronic
1022143227 7:27511755-27511777 TACTTAACACTTCTGAAGCTTGG - Intergenic
1024331289 7:48158268-48158290 CACTTAAGTCTAATGCTGCTTGG - Intergenic
1028140087 7:87263822-87263844 CACTTAGGTGAGCTGAAGCAGGG - Intergenic
1028991309 7:97051480-97051502 CGTTTAAGTTTGCTGAAGGTGGG - Intergenic
1030149428 7:106388022-106388044 CAGTTAGGTCTGCTGAAGGCAGG + Intergenic
1031414021 7:121474100-121474122 CTCTTAAGACTCCAGAAGCTAGG + Intergenic
1032742263 7:134750519-134750541 TTTTTAAGTCTGCAGAAGCTAGG - Intronic
1032906937 7:136379115-136379137 CACTTAAGTCTGCTTCATATGGG + Intergenic
1033213990 7:139481037-139481059 CATATAAGGCTCCTGAAGCTGGG - Intronic
1037270842 8:17128727-17128749 CACTTACTTCTGCTGTAGTTTGG - Intergenic
1039909527 8:41813556-41813578 AACTTTAGTCTTCTGAAACTTGG + Intronic
1043541407 8:81267401-81267423 TACTTAAGTTTCCTGAAGCAAGG - Intergenic
1046059951 8:109126871-109126893 TACTTTAGTTTGCTGAAGATGGG - Intergenic
1046275904 8:111959315-111959337 CACTTCAGCCTCCTGTAGCTGGG + Intergenic
1047300455 8:123609448-123609470 CTCTTAAGATTGCAGAAGCTGGG - Intergenic
1050035908 9:1435928-1435950 CACTTAACTTTTCTGAACCTGGG + Intergenic
1050201294 9:3148588-3148610 TGTTTAAGTCTGCTGAAGCTGGG + Intergenic
1050298017 9:4226714-4226736 TACTTAATTCTCCTGAATCTTGG + Intronic
1050300453 9:4253185-4253207 CGTTTAAGTCTGCTGAAGCTGGG + Intronic
1051521387 9:17992556-17992578 CACTTGAGTCATCTGAGGCTAGG + Intergenic
1051872779 9:21758040-21758062 CACATAAGTGTGCTGAGGTTAGG - Intergenic
1051975048 9:22939034-22939056 CACTTCAGTCTGCTGGCTCTGGG + Intergenic
1055648065 9:78379426-78379448 AACTCAACTCTGCTGAAGCAGGG + Intergenic
1056592255 9:87973334-87973356 CACTTAAGTCCTCAGGAGCTGGG + Intronic
1058072820 9:100619183-100619205 CGTTTAAGTCTGCTGAAGCTGGG + Intergenic
1060038965 9:120283424-120283446 CACTTAAGTCAACTCAAGATGGG + Intergenic
1060345919 9:122815639-122815661 CACTTAACTCTGCTAAGTCTTGG + Intronic
1187201001 X:17133677-17133699 TGCTTAAGTCTGCTGATCCTTGG - Intronic
1188189132 X:27152584-27152606 CACAGAAGTCTGCTGAACCCAGG - Intergenic
1188195678 X:27229820-27229842 CACTTGAGCCTGGTGAATCTTGG + Intergenic
1191168482 X:57417802-57417824 CTTTTAAGTCTGCTGAAGCTGGG + Intronic
1191766679 X:64705657-64705679 AAATTAAGTCTGCTGAACCTGGG + Intergenic
1194797192 X:98226326-98226348 CACTGAGGTCTACTTAAGCTAGG - Intergenic
1197043667 X:121970444-121970466 ACCTTAGGTCTGCTGAAGCATGG - Intergenic
1199277542 X:145964097-145964119 CACTTTAGTCTGCAGTAGCAAGG - Intergenic
1199469770 X:148181613-148181635 CTTTTAAGTCTGCTGAAGCTGGG + Intergenic
1201541536 Y:15110384-15110406 CATTTAAGTCTGCAGTAACTTGG + Intergenic