ID: 962182974

View in Genome Browser
Species Human (GRCh38)
Location 3:133227491-133227513
Sequence TGGTTAGAAAGGCCTTCCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962182974_962182977 -4 Left 962182974 3:133227491-133227513 CCTAAGGAAGGCCTTTCTAACCA 0: 1
1: 0
2: 1
3: 13
4: 168
Right 962182977 3:133227510-133227532 ACCATGGTAGAGTGTCTGTGAGG 0: 1
1: 0
2: 0
3: 15
4: 123
962182974_962182979 0 Left 962182974 3:133227491-133227513 CCTAAGGAAGGCCTTTCTAACCA 0: 1
1: 0
2: 1
3: 13
4: 168
Right 962182979 3:133227514-133227536 TGGTAGAGTGTCTGTGAGGTAGG 0: 1
1: 0
2: 1
3: 11
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962182974 Original CRISPR TGGTTAGAAAGGCCTTCCTT AGG (reversed) Intronic
901115367 1:6839648-6839670 TCGTAGGAAAGGCCTTTCTTAGG + Intronic
902559982 1:17271221-17271243 TGGAGAGAGAGGCCTTCATTTGG + Intronic
904989489 1:34580165-34580187 TGCCTAGAAAGCCCTTCCTCTGG - Intergenic
906861615 1:49366825-49366847 GACTTAGAAAGGTCTTCCTTTGG + Intronic
907467621 1:54649703-54649725 AGGTTAAAAATGCCTCCCTTTGG + Intronic
910176568 1:84437175-84437197 TGGTGAGAAAGCACTTCCCTGGG - Intergenic
910640816 1:89459897-89459919 GGATTTGAAAGGTCTTCCTTTGG - Intergenic
911101976 1:94102463-94102485 TGCTCAGGAAGGCCTTCCTGAGG - Intronic
912082366 1:105952290-105952312 AAGTCAGAAATGCCTTCCTTGGG + Intergenic
915321941 1:155061145-155061167 TGCTCAGAATGGCCTTCCGTAGG + Intronic
917335259 1:173918950-173918972 TGGTAGGAAAGGCCTCCCTTAGG + Intergenic
919880252 1:201896246-201896268 TTGGTAGAAAGGGCTTCCTAAGG + Intergenic
924767305 1:247046025-247046047 TGCTTAGAAATGTCTTCCTCTGG - Intronic
1064120881 10:12617654-12617676 TGGTGAGCACGCCCTTCCTTCGG + Intronic
1066325078 10:34350805-34350827 TAGGTAGAAAGACTTTCCTTGGG - Intronic
1067265049 10:44734533-44734555 TGGTGAGAAAGACCTGCCTGAGG + Intergenic
1069319523 10:67151162-67151184 TGAGAAGAAAGGCCTTCCTTTGG + Intronic
1071791360 10:88957750-88957772 TGGGTAGAGAGGGCTTCCTAGGG - Intronic
1072142847 10:92605128-92605150 AGGATAGAAAGGACTTCCTGAGG + Intronic
1073469415 10:103713625-103713647 TGGTCAGGAAGGCCTCCCTGAGG - Intronic
1076869488 10:133186368-133186390 TGTCCAGAAAGGCCTTCCTGGGG - Exonic
1078125895 11:8563145-8563167 GGGTAAGTAGGGCCTTCCTTGGG + Intronic
1079105325 11:17568373-17568395 AGGTAGGAAAGGCCTTCCTAGGG - Intronic
1079976368 11:27096543-27096565 ACGTTAGACATGCCTTCCTTGGG + Intronic
1081027031 11:38028076-38028098 TGCTTAGAATGTCCTTCCCTAGG + Intergenic
1089672923 11:120068902-120068924 CGGTTAGAAAAGCCTGCCTGGGG - Intergenic
1089760104 11:120716960-120716982 TGGTTAGAGAGGGCGTGCTTAGG + Intronic
1090273772 11:125405539-125405561 TTCTTAGTAAGGCCTTCCTTTGG + Intronic
1096579117 12:52573181-52573203 TGGTGAGGAAGCCCTTCCTGAGG + Intronic
1097086685 12:56473978-56474000 TGGTCAGAAAAGTCTTTCTTTGG + Exonic
1097907226 12:64932459-64932481 TAGTTAGGAATGTCTTCCTTTGG + Intergenic
1098218416 12:68243581-68243603 TGGTTACAAAGTCCCTCCTTGGG - Intergenic
1099538256 12:83872060-83872082 TGGTGAGGAAAGCGTTCCTTTGG - Intergenic
1100177652 12:92049466-92049488 TGGTTACAGAGGCTTTCCTAAGG + Intronic
1100762922 12:97829769-97829791 TGGTTGGAAAGGCCTTGCTTGGG - Intergenic
1101423363 12:104567403-104567425 TGGGTAGAAAGGTGTTCCCTGGG + Intronic
1102804795 12:115770223-115770245 TGGTTTGAAATGCTTACCTTTGG + Intergenic
1103101036 12:118176094-118176116 CAGTTAGAAAAGGCTTCCTTAGG + Intronic
1105720061 13:23104239-23104261 TGGCTAGAAAAGACTTACTTTGG + Intergenic
1107242274 13:38250782-38250804 TTGATAAAAAGTCCTTCCTTTGG - Intergenic
1107446559 13:40474639-40474661 TAGTTAGAGATGCCTTCATTTGG - Intergenic
1107713848 13:43179246-43179268 TGTTTAGTAAGGCATTCTTTGGG - Intergenic
1108568935 13:51730359-51730381 TGGCTGTAACGGCCTTCCTTTGG + Intronic
1111742254 13:92218826-92218848 TAATTAGAAAGGCAATCCTTAGG + Intronic
1114721408 14:24886257-24886279 TGGTTAAAAACACCTTGCTTTGG + Intronic
1115389008 14:32832692-32832714 TTGTTAGAAAGTTCTTTCTTAGG + Exonic
1118319991 14:64747461-64747483 TGGTGAGCAAGGTCTTCATTTGG - Exonic
1120071503 14:80108505-80108527 AGGTTAGAATGGACTTACTTGGG - Intergenic
1120398318 14:83996104-83996126 GGGTGAGAATGGCCTTCATTTGG - Intergenic
1121208003 14:92185618-92185640 TTGTGAGAAAGGCCTTCATAAGG + Intergenic
1124921040 15:34026941-34026963 TTGTTAGAAACTTCTTCCTTTGG - Intronic
1126446121 15:48746848-48746870 TGGTTAGGAAAGCCTCCCTGAGG + Intronic
1128606780 15:69042531-69042553 TGGTTTGAATGTCCTTCCTCAGG - Intronic
1130993662 15:88892033-88892055 TAGTGAGAAAGGGCTTCCTAAGG + Intronic
1134049578 16:11128081-11128103 TGGTAAGAAATGACTTCTTTAGG + Intronic
1136511615 16:30741199-30741221 TGGTAATAAAGGGCTTACTTGGG + Exonic
1136517760 16:30778097-30778119 TGGTCAGAGAGGCCTCCCTGGGG + Intergenic
1137511254 16:49102705-49102727 TGGTTATAAAAACCTTCCTATGG + Intergenic
1138093487 16:54194679-54194701 GGGAGAGAAAGGCCTTCCTGGGG + Intergenic
1142320444 16:89379103-89379125 CAGTGAGAAAGGCCTTCCTGGGG - Intronic
1142546558 17:708039-708061 TGTTTAGAAGGGCCTTCTGTAGG + Intronic
1143710848 17:8734364-8734386 TGCTTACAAACGCCCTCCTTTGG + Intronic
1143812087 17:9480044-9480066 GGGTTAGAAAAGCCTTTCCTGGG - Intronic
1144157737 17:12523229-12523251 TGGTTAGAATGTCCTGCCTTGGG - Intergenic
1144201208 17:12944074-12944096 TGGGTAGAGAAGCCTTCCTTCGG + Exonic
1144260450 17:13514320-13514342 AGATTAGAAAGGCCTTTCTTAGG - Intronic
1150960466 17:69906603-69906625 TCCTTAGAAATGCCTTCATTAGG - Intergenic
1152999138 18:437131-437153 TGGTAAGAGAGGCCTTGGTTGGG - Intronic
1158288148 18:55907917-55907939 TTGGTAGAAAGGCATTCTTTTGG - Intergenic
1158457303 18:57619531-57619553 TGGTTAAAAGTTCCTTCCTTGGG - Intronic
1160247011 18:77166910-77166932 TGGTGAGCAGGGCCTTGCTTTGG - Intergenic
1160604162 18:80036678-80036700 TGGTATGAAAGTCCTTCCTTGGG + Exonic
1164827370 19:31293562-31293584 AGGTGAGAAAGGACTTCCTGGGG - Intronic
1165121685 19:33563063-33563085 TGGGAAGAAGGGCCTGCCTTGGG + Intergenic
1166714808 19:44960222-44960244 TGGTCAGAGAGGCCTCCCTGAGG - Intronic
1167580507 19:50338585-50338607 TGCTTAGAAAAGCTTTCCTCAGG - Intronic
925456265 2:4019071-4019093 TGCTTAGAAATGTCTTCCATCGG + Intergenic
928274851 2:29891214-29891236 GTATTAGAAAGGCCTTCCTTTGG + Intronic
928619331 2:33072573-33072595 TAGTTTCTAAGGCCTTCCTTGGG + Intronic
930238031 2:48906358-48906380 TTATTAGAAAGACCTCCCTTTGG + Intergenic
935275141 2:101469873-101469895 TGGAAAGAAAGGGCTGCCTTCGG + Intronic
935372575 2:102363255-102363277 TGAATAGCAAGGCATTCCTTAGG + Intronic
937240955 2:120462370-120462392 AGGGTAGAAAGGGCTGCCTTGGG - Intergenic
937874805 2:126815646-126815668 TGATTAGGAAGGGCTTACTTCGG + Intergenic
939695267 2:145315763-145315785 TCCTTAGAGAGGCCTTCCCTGGG - Intergenic
941701231 2:168606145-168606167 TGGTTCCCCAGGCCTTCCTTGGG - Intronic
941788799 2:169527907-169527929 GGGTTATAAAGGGTTTCCTTTGG - Intergenic
943012271 2:182464246-182464268 TGGTAAGAAAGACTTTACTTAGG + Intronic
945354495 2:208823261-208823283 TGGTTAGATGGGTCTTCTTTTGG + Intronic
947544344 2:231000646-231000668 GGGAAAGAAAGGCTTTCCTTCGG - Intronic
1172467651 20:35168228-35168250 TGATTAGAAAGGCCTCCATGTGG + Intergenic
1173653487 20:44682700-44682722 TGAGTAGAAAGACCTTCCTCAGG + Intergenic
1175188050 20:57192924-57192946 GGGATAGAAAGGCTTTCCTGCGG + Intronic
1177955732 21:27596272-27596294 TGCTTAGAATGTACTTCCTTTGG - Intergenic
1178308869 21:31512942-31512964 TGGTTAGAAAAGACTGTCTTTGG - Intronic
1179603365 21:42496099-42496121 TGGTGAGAAAGGGCTTCCCAGGG - Intronic
1180950935 22:19720251-19720273 TGCTGAGAAAGGCCTTGCCTAGG + Intronic
1182461104 22:30484712-30484734 TGTCTTGAAAGGCCTTCCCTAGG - Intergenic
1183260403 22:36791263-36791285 AGGGTAGACAGGGCTTCCTTAGG + Intergenic
1184714336 22:46272415-46272437 TGGTGAGTAACGCCTTCCCTGGG + Exonic
951263438 3:20539579-20539601 TGCTTGGCAGGGCCTTCCTTGGG + Intergenic
952206892 3:31189249-31189271 TGGCTAGAAAAGGCTTCCTGAGG - Intergenic
952989023 3:38814888-38814910 TGGCTAGAAAGCCCAACCTTTGG + Intergenic
953121221 3:40044484-40044506 TGAATAGAAAGGGCTTTCTTGGG + Intronic
953390194 3:42529560-42529582 TGGTTGGAAAGTCCTTCCTCAGG - Intronic
954689438 3:52387939-52387961 TGATTAGGGAGGTCTTCCTTGGG - Intronic
955706165 3:61730051-61730073 TGTTTAGATGGGTCTTCCTTAGG + Intronic
956293641 3:67688623-67688645 TGGTTTGAAAGCTCTGCCTTTGG + Intergenic
956881956 3:73519973-73519995 TGATGAGAATGGCGTTCCTTGGG + Intronic
957516361 3:81258162-81258184 TAGATAGAAAAGCCTACCTTGGG - Intergenic
957594511 3:82244890-82244912 TGATTTTAAAGGCCTTCATTTGG + Intergenic
958112162 3:89162602-89162624 TGTTTAGAAAGGAGTGCCTTTGG + Intronic
958437561 3:94115950-94115972 TGTTTTGAAACACCTTCCTTTGG + Intronic
958937417 3:100271975-100271997 TCGTTAGAAAAGCCTTCATGTGG - Intronic
962083543 3:132166152-132166174 TGGCCAGAGAGGCCTTCCTGAGG - Intronic
962182974 3:133227491-133227513 TGGTTAGAAAGGCCTTCCTTAGG - Intronic
963624479 3:147653790-147653812 TGGTTACAAATAGCTTCCTTAGG + Intergenic
970406895 4:15772713-15772735 GGGTTAGAAAAGGCTTCCTGAGG + Intergenic
970885351 4:20981920-20981942 TGGTCTGAAAAGTCTTCCTTGGG - Intronic
972158114 4:36190194-36190216 TGGTCAGAAAGGCTTTCTTCAGG - Intronic
972214424 4:36879302-36879324 TGGTTAGAAGGGCATTGCCTGGG + Intergenic
972599976 4:40563592-40563614 CAGTGGGAAAGGCCTTCCTTTGG - Intronic
975452292 4:74543210-74543232 TGGTAAGAAATTACTTCCTTAGG - Intergenic
988096887 5:26626419-26626441 AGTTTAGAAAAGCCTTCATTAGG + Intergenic
988488797 5:31689896-31689918 TGGCTTCAAAGTCCTTCCTTAGG + Intronic
988522709 5:31960662-31960684 TGGATAGCAAGGTTTTCCTTAGG - Intronic
988582380 5:32479385-32479407 TGGTGAGAATGGCTTTCCTGGGG + Intergenic
988841434 5:35087462-35087484 AGGTTGCAAAGGGCTTCCTTTGG + Intronic
991486932 5:67146907-67146929 TGGTTACAAAGGCCTTTATCTGG + Intronic
991487279 5:67150620-67150642 TGGTTAGGAAGCCCGTACTTTGG + Intronic
992051963 5:72949338-72949360 TGGTCAAAAAGGCCTCCCTGAGG - Intergenic
994742532 5:103638721-103638743 TGGCTAAAAAGGCCTGGCTTAGG + Intergenic
996670521 5:126112736-126112758 TGCTTAGAAATTTCTTCCTTTGG - Intergenic
997623102 5:135313191-135313213 TGGTTAGAAAGGTCTCTATTTGG + Intronic
997666625 5:135634656-135634678 TGTTTAGAAAGGCCTTCTGGAGG + Intergenic
998589060 5:143458045-143458067 TAGTTAGCAAGGCCTTCATATGG - Intergenic
1002767057 6:250786-250808 TGGTGAGAGTGGACTTCCTTAGG + Intergenic
1007995309 6:46301714-46301736 TGGTGAGAAAGACCTCTCTTGGG + Intronic
1008325428 6:50175088-50175110 TGGGTAGAACTTCCTTCCTTGGG - Intergenic
1008519485 6:52349682-52349704 TGGTTAGAAATAACTTCTTTGGG + Intergenic
1008892488 6:56511297-56511319 TGGATAGAAAAGCCTTCCCCAGG + Exonic
1008954661 6:57201341-57201363 GGGTCAGAAAATCCTTCCTTTGG - Intronic
1010044544 6:71425891-71425913 TGGTTAAAAGGGTTTTCCTTTGG + Intergenic
1011994201 6:93565052-93565074 TGCTTAGAAGGGCCTACATTTGG + Intergenic
1014552188 6:122801851-122801873 TGCATAGTAAGGCCTTCCCTGGG + Intronic
1015141164 6:129933652-129933674 TGGTAAGAAAGCCCCTCCTTTGG + Intergenic
1015671889 6:135700013-135700035 TGGTGGGAAAGGCCTTGATTTGG + Intergenic
1016708523 6:147142335-147142357 TGGTAGGAAAAGACTTCCTTTGG + Intergenic
1017745741 6:157445509-157445531 GGGTTAGAGAGGCCTCTCTTTGG + Intronic
1019608776 7:1924616-1924638 TGGTTTGGCAGGACTTCCTTCGG - Intronic
1019910839 7:4099800-4099822 TGGTGGGAAAGGCCATGCTTGGG + Intronic
1022196419 7:28071639-28071661 TGGATAGAAGGTCCGTCCTTGGG - Intronic
1024555492 7:50599850-50599872 TGGATTGAAAGGGCTGCCTTGGG - Intronic
1025482468 7:60999521-60999543 TGGATAAAATGGCCTACCTTGGG - Intergenic
1029111664 7:98215890-98215912 TGCTGAGAAAGGCCTCCCTGGGG - Exonic
1029931841 7:104379881-104379903 TGGTTAGAAAGACCATATTTGGG + Intronic
1030295228 7:107918575-107918597 TGGTAGGAAAGGCTTCCCTTAGG - Intronic
1030739524 7:113091560-113091582 TGGTAAGAAAGGCTCTCATTGGG + Intergenic
1032459306 7:132097967-132097989 AGGTTAACAACGCCTTCCTTGGG + Intergenic
1035097069 7:156364433-156364455 AGGTTAGAAATGCCTGTCTTGGG + Intergenic
1037387950 8:18363338-18363360 TGATTTCTAAGGCCTTCCTTGGG + Intergenic
1040608625 8:48960222-48960244 AGGTAAGAAAGGCCTTCTTGGGG + Intergenic
1041803320 8:61823201-61823223 TGGTTAGAAAAGGCTTGGTTTGG - Intergenic
1042066581 8:64883836-64883858 TGGTTTGAAGGACCTTCCTTAGG - Intergenic
1042183941 8:66118668-66118690 TGGTTAGAAAGTGCTTTATTTGG + Intergenic
1049469380 8:142768661-142768683 TGGTTACAAAGGCCTTCTCCAGG + Intronic
1055551124 9:77433086-77433108 TGGTTTCAATGGGCTTCCTTTGG - Intronic
1058690367 9:107515326-107515348 TGGTTAGAAAGCTCTACATTGGG - Intergenic
1060844161 9:126821780-126821802 AGGTTAGAAAAGCCGTCCTGGGG - Intronic
1187579536 X:20593342-20593364 TTTTTAGCAAGGCCTGCCTTGGG + Intergenic
1188063239 X:25626683-25626705 TGGATAGATAGGGCTTTCTTAGG - Intergenic
1188070452 X:25712072-25712094 TGGGTAGAAAGGCAATGCTTTGG - Intergenic
1190965407 X:55295621-55295643 TGGTGAGAGAGGGCATCCTTAGG + Intergenic
1196047557 X:111271986-111272008 TTGTTAAAAGGGTCTTCCTTAGG + Intergenic
1197063476 X:122211496-122211518 TGGTCAGAAAGGCCTCTCTGAGG + Intergenic
1197217743 X:123882270-123882292 TTGTTATAAAGCCCATCCTTGGG + Intronic
1198675857 X:139129426-139129448 TTGTTAGCATGGCCTTCTTTAGG + Intronic
1199413161 X:147548961-147548983 TGGTCAGGAAGGCCTTCCTGGGG - Intergenic
1199462897 X:148103147-148103169 AGGTTAGGAAAGGCTTCCTTGGG - Intergenic
1200825347 Y:7632737-7632759 AGGTAAGAAAGGCCTACCTATGG + Intergenic
1202234710 Y:22698350-22698372 AGGTAAGAAAGGCCTACCTATGG - Intergenic
1202308449 Y:23497818-23497840 AGGTAAGAAAGGCCTACCTATGG + Intergenic
1202562352 Y:26172768-26172790 AGGTAAGAAAGGCCTACCTATGG - Intergenic