ID: 962183264

View in Genome Browser
Species Human (GRCh38)
Location 3:133231023-133231045
Sequence ATGCATGTCAGTAATCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962183264_962183267 7 Left 962183264 3:133231023-133231045 CCACCCTGATTACTGACATGCAT 0: 1
1: 0
2: 1
3: 8
4: 126
Right 962183267 3:133231053-133231075 CAATAGCTCCTATATGTCACTGG 0: 1
1: 0
2: 0
3: 8
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962183264 Original CRISPR ATGCATGTCAGTAATCAGGG TGG (reversed) Intronic
900050793 1:594362-594384 CTGTATGTCAGGAATCAGGTGGG - Intergenic
907872457 1:58455331-58455353 ACACCTGTCAGTCATCAGGGAGG + Intronic
907954105 1:59212298-59212320 TTGCATTTCAGCCATCAGGGAGG + Intergenic
909961944 1:81856625-81856647 ATGAATGTCAGGAGTCAAGGTGG + Intronic
911557891 1:99367820-99367842 AGGTATGACAGTAATCATGGAGG + Intergenic
911966706 1:104380907-104380929 ATGTGTGTGAGTAATCAGGCAGG - Intergenic
912731188 1:112107007-112107029 TTGTATGTCAGGAAACAGGGAGG + Intergenic
916919872 1:169453573-169453595 ATCCATGTTTGTAGTCAGGGAGG - Intronic
919211714 1:194495460-194495482 ATGCATGTCAGAAACCTGGCAGG + Intergenic
1065601838 10:27376776-27376798 ATACATGTTAGAAATCAGTGAGG + Intergenic
1067322645 10:45236633-45236655 AAGTATGTCAGTTATTAGGGTGG - Intergenic
1067941340 10:50659554-50659576 TGACATCTCAGTAATCAGGGTGG + Intergenic
1068579191 10:58720005-58720027 ATTCATGTCAGTCATAAGAGAGG - Intronic
1068754015 10:60630587-60630609 TTGCAGGTCAGTGATCTGGGAGG + Intronic
1070862577 10:79684516-79684538 TGACATCTCAGTAATCAGGGTGG + Intergenic
1071520512 10:86329217-86329239 ATGCATGTCTGTGGTCAGCGGGG - Intronic
1072760715 10:98054405-98054427 AGGGATGTCAGCAATCAAGGAGG + Intergenic
1073700135 10:105917516-105917538 ATGAATTTCAGTATTCAGGAGGG - Intergenic
1077698244 11:4414680-4414702 ATGCATGTAAGTGGTCAGGGAGG + Intergenic
1081419487 11:42856770-42856792 ATGAATATCAGTAATAAAGGGGG + Intergenic
1081590135 11:44416945-44416967 ATGCATGTCAGTAGTCCAGCTGG + Intergenic
1085240489 11:75050051-75050073 ATCCATGTCAGTGAGCAGAGGGG - Intergenic
1086263894 11:84974802-84974824 ATGCATCACAGTTATCTGGGGGG - Intronic
1087652706 11:100887036-100887058 ATGCATGTCAGTACTCAGGATGG + Intronic
1090454727 11:126838775-126838797 ATGTATGGCAGTAATAAAGGGGG + Intronic
1091320103 11:134643340-134643362 ATGCATGTCACGAATGAGAGAGG + Intergenic
1093055983 12:14556127-14556149 ATTCAGGTCAGTCATCAGAGAGG + Intronic
1093772723 12:23036352-23036374 ATGAATGACAGTAATCAGGATGG + Intergenic
1098827269 12:75311983-75312005 ATGCATGACAGAAATAATGGTGG - Intronic
1099193721 12:79589704-79589726 ATTCATTTCAGAAATCAAGGAGG + Exonic
1101155233 12:101921342-101921364 ATGCATCCCAATAATCAGGGTGG - Exonic
1101607162 12:106256259-106256281 ATGCATGTCCGTCAACAGCGTGG - Intronic
1105404484 13:20121989-20122011 CTGAATGTCAGTAATCACTGGGG - Intergenic
1107030189 13:35842858-35842880 AGCCATTTCAGTAATCAGGATGG + Intronic
1110212137 13:72986298-72986320 ATGAATGTCAGAAAGCAGAGTGG + Intronic
1110238997 13:73246060-73246082 ATGCATTTCAGTTAACAGGTTGG - Intergenic
1114130646 14:19788028-19788050 ATGCATGTCATTACTCAGCAGGG + Intronic
1114973092 14:28058849-28058871 ATGCAAGTCAGTATTTATGGTGG - Intergenic
1115804442 14:37035110-37035132 ATGCGTGTCTGAAATCAGGTGGG - Intronic
1119247767 14:73127678-73127700 ATCCATGTCAGTGAGCAGCGGGG - Intergenic
1119932927 14:78565690-78565712 ATGAATGTCAGGAATTAGGCAGG + Intronic
1119989084 14:79174845-79174867 ATGCAGGTTATTAATCTGGGTGG + Intronic
1124855444 15:33383229-33383251 ATGCATGTGAGAAAGGAGGGAGG + Intronic
1129392631 15:75228154-75228176 ATGCATGTGAGGACTCAGTGAGG + Intergenic
1129675011 15:77627817-77627839 ATGGATATGAGCAATCAGGGAGG - Intronic
1130674587 15:85940503-85940525 ATGCATGTGAATGACCAGGGGGG - Intergenic
1137477024 16:48817938-48817960 AGCCTTGTGAGTAATCAGGGAGG + Intergenic
1141678903 16:85532579-85532601 ATGTAGGGCAGTAATCAGGAAGG - Intergenic
1146468733 17:33107826-33107848 AGGAATGTCAGGAAGCAGGGAGG - Intronic
1146655406 17:34632018-34632040 ATGCAAGTCAGTATCCAGGTGGG + Intronic
1147859262 17:43507975-43507997 CTGCATAACAGTAATCAGGCTGG - Exonic
1149552022 17:57547374-57547396 ATGCATGTTTGGAAGCAGGGTGG + Intronic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1155072840 18:22331256-22331278 GAGAATGTCAGTAATCAGGAGGG - Intergenic
1156967296 18:43109775-43109797 ATGCAAGTCATTGAGCAGGGAGG - Intronic
1160612741 18:80101221-80101243 TTGCATGTCTGTTTTCAGGGTGG + Intergenic
1163208761 19:15824413-15824435 GTGCATGTCACTAATTAGTGGGG - Intergenic
1168441749 19:56374197-56374219 ATTCGTGTCAGAATTCAGGGTGG - Intergenic
1168653552 19:58110356-58110378 ATGCATGTCTGGATTCAGAGGGG - Intronic
1168653564 19:58110411-58110433 ATGCATGTCTGGATTCAGAGGGG - Intronic
925805080 2:7640829-7640851 ATGCAAGTCTGTAATCAAGCAGG + Intergenic
927920217 2:26966597-26966619 ATTCATGTAAGGAAACAGGGCGG - Intergenic
931759173 2:65401378-65401400 ATGCATGTGAGTCACCTGGGGGG - Intronic
933778120 2:85784012-85784034 AGGCCAGTCAGTAGTCAGGGAGG + Intronic
934604135 2:95681520-95681542 CTCCATGCCAGTAATCAGGAAGG + Intergenic
935237084 2:101148542-101148564 ATGCATGTATGTAAGCAGGAGGG + Intronic
936348955 2:111698150-111698172 ATGCCTGTCAGTAATGTTGGAGG + Intergenic
936537526 2:113323754-113323776 CTCCATGCCAGTAATCAGGAAGG + Intergenic
937507143 2:122550326-122550348 AAGCAGGTCAGTAAGCTGGGAGG + Intergenic
939814333 2:146875274-146875296 ATGCATGGCTGTAATCAGACAGG + Intergenic
940613120 2:156015667-156015689 TTGCATCTCAGAAATCAGGGAGG - Intergenic
942766363 2:179461868-179461890 ATCCATGCCATTTATCAGGGAGG + Intronic
943669081 2:190641518-190641540 ATTCATCTCAGCAAACAGGGTGG + Intergenic
944524285 2:200602402-200602424 ATGGTTGTCAGTGATTAGGGGGG + Intronic
947893369 2:233645603-233645625 ATGCATGTCAGAAATCCGGCAGG + Intronic
1172789953 20:37496218-37496240 ATGCATCTCTTTAATTAGGGAGG + Intronic
1173507883 20:43602891-43602913 ATGCATGTGATGAATCAGTGGGG + Intronic
1174452383 20:50628384-50628406 ATGCGTGACAGCAGTCAGGGAGG - Intronic
1177550191 21:22611010-22611032 ATCTATGTCAGTAAGCAGAGGGG + Intergenic
1179094289 21:38298157-38298179 ATTTATGTCAGTCATCAGGCAGG + Intronic
1179773863 21:43646749-43646771 ATTCCAGTCAGTCATCAGGGAGG + Intronic
1182227804 22:28813236-28813258 ATGCCTGTTGGTAATTAGGGTGG - Intergenic
1183124764 22:35766146-35766168 ATGCAGTTCTGTAATGAGGGTGG - Intronic
1184061612 22:42085940-42085962 TTGCATGTCAGTAAACAGGAAGG - Exonic
1184909202 22:47514927-47514949 AAGCATCTCAGTAACCAGCGAGG - Intergenic
1184980333 22:48091000-48091022 ATTCATCTCAGTGAGCAGGGTGG - Intergenic
951425670 3:22542420-22542442 ATGCAAGCCAATTATCAGGGAGG - Intergenic
953271721 3:41452043-41452065 AGGAATTCCAGTAATCAGGGAGG - Intronic
953777598 3:45835021-45835043 AAGCATGCCAGAAATCAGGAAGG - Intronic
954369170 3:50161222-50161244 ATGCATGCAAGTAAGCAGGAGGG + Intronic
954494351 3:50940193-50940215 ATGCTTGTCAGTACTTTGGGAGG + Intronic
962183264 3:133231023-133231045 ATGCATGTCAGTAATCAGGGTGG - Intronic
967503285 3:190223900-190223922 ATGCATGTTAGTAATTTAGGGGG - Intergenic
970978848 4:22073850-22073872 ATGCATGTGCATATTCAGGGAGG - Intergenic
971488696 4:27188801-27188823 AGGCATTTCAGTAAACAGGTGGG + Intergenic
976868192 4:89756866-89756888 ATGCGTGTCAGTAATTTGAGAGG + Intronic
978920232 4:114174979-114175001 ATGAATGTCAGAAATCCAGGGGG + Intergenic
979145077 4:117236442-117236464 ATACATTTCAGTAATTAGGATGG - Intergenic
979841700 4:125450150-125450172 GTTCAAGTCAGAAATCAGGGAGG - Exonic
983829767 4:172311761-172311783 CAGCATATCAGTGATCAGGGTGG + Intronic
984624554 4:181991365-181991387 TTCCATGTCAGTGATCATGGTGG + Intergenic
989458755 5:41671647-41671669 AGGCATGTCAGGAAGCAGTGAGG + Intergenic
991978843 5:72210908-72210930 AAGCATGTGAGCACTCAGGGTGG + Intergenic
993061639 5:83045323-83045345 AAGCATGTAAGTAATGAGGTAGG + Intergenic
994286736 5:97978102-97978124 ATCCATGTCAGTTATTAGGTAGG + Intergenic
994379512 5:99054678-99054700 ATGCATGCCTGTAATCCGGGGGG + Intergenic
995999961 5:118348739-118348761 ATCCATGTCCATAGTCAGGGAGG - Intergenic
997426498 5:133806455-133806477 ATGCATGTCAGTAAACAAAAGGG + Intergenic
999277813 5:150343542-150343564 CTGGATTTCAGGAATCAGGGAGG - Intergenic
1000283852 5:159808829-159808851 ATTCTTATCAGAAATCAGGGTGG + Intergenic
1009355719 6:62740956-62740978 ATGCATGCCAGTATTAATGGTGG - Intergenic
1015762914 6:136684284-136684306 GTGCATGTTACTAATGAGGGAGG - Intronic
1016043773 6:139460107-139460129 ATCCATGTCAGTAATTTGTGTGG + Intergenic
1019130014 6:169866447-169866469 ATGAATGTCAGGATTCAGTGTGG - Intergenic
1020340937 7:7110354-7110376 ATGCATCTCAGTGAGCAGAGGGG - Intergenic
1021892006 7:25195155-25195177 ATTCATGTCAGTGAGCAGAGGGG - Intergenic
1022501079 7:30882771-30882793 ATGGATGTCAGGGATGAGGGTGG + Intronic
1024822057 7:53343377-53343399 ATTTATCTCAGTAATCAGAGGGG - Intergenic
1027501076 7:78951739-78951761 ATTCATGACATTAATCAGGTAGG + Intronic
1028035392 7:85975350-85975372 TAGCATGTCAGTAATCTGTGGGG + Intergenic
1031142806 7:117963405-117963427 ATGCATGTCAGTCCTGGGGGAGG - Intergenic
1031672090 7:124562029-124562051 ATGAATGTTAGTAAACAGAGTGG - Intergenic
1042276457 8:67009698-67009720 ATGCAATTGAATAATCAGGGTGG - Intronic
1045338568 8:101231498-101231520 ATGCATGTCAGCAAACTAGGAGG + Intergenic
1048762217 8:137807439-137807461 AGGCATGTGAGAAATCAGGTTGG + Intergenic
1057080737 9:92172717-92172739 TGACATCTCAGTAATCAGGGTGG + Intergenic
1060761269 9:126251387-126251409 ATGCCTCTCAGTAATCTGGGAGG - Intergenic
1186432449 X:9516509-9516531 ATCCATCTCACTATTCAGGGTGG + Intronic
1187880386 X:23841702-23841724 ATGCATGTGAGGAGGCAGGGTGG - Intronic
1188001438 X:24986215-24986237 AGCCATGACATTAATCAGGGTGG + Intronic
1189972478 X:46432531-46432553 ATGATTCTCAGTAATCTGGGTGG + Intergenic
1193440175 X:81530888-81530910 ATGCATGTAAAAAATCAGGCCGG - Intergenic
1194380043 X:93180144-93180166 ATGCAAGTCAGAAACCAGGTTGG + Intergenic
1195805422 X:108760096-108760118 ATACAAGACAGTAATCAGGAAGG + Intergenic
1198782680 X:140254878-140254900 ATCCATGCCAGGCATCAGGGTGG + Intergenic
1199533146 X:148871999-148872021 ATGCAGGACAGTAAGCAGAGTGG + Intronic