ID: 962183685

View in Genome Browser
Species Human (GRCh38)
Location 3:133235560-133235582
Sequence CACATCCCATTTTACATCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 254}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962183685_962183687 -5 Left 962183685 3:133235560-133235582 CCCTAGATGTAAAATGGGATGTG 0: 1
1: 0
2: 1
3: 24
4: 254
Right 962183687 3:133235578-133235600 ATGTGATCACTCACTACCTGAGG 0: 1
1: 0
2: 1
3: 12
4: 148
962183685_962183688 -2 Left 962183685 3:133235560-133235582 CCCTAGATGTAAAATGGGATGTG 0: 1
1: 0
2: 1
3: 24
4: 254
Right 962183688 3:133235581-133235603 TGATCACTCACTACCTGAGGTGG 0: 1
1: 0
2: 0
3: 4
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962183685 Original CRISPR CACATCCCATTTTACATCTA GGG (reversed) Intronic
900961118 1:5921007-5921029 TCCATCCCATTTTACAGCTGAGG + Intronic
902417724 1:16251306-16251328 CAGATCCCAATTCAGATCTATGG + Exonic
903377140 1:22873979-22874001 CACATCCCATTTTACAGGTAAGG + Intronic
904871087 1:33618758-33618780 CACATCCCATTTCACAGATGAGG + Intronic
905918489 1:41702482-41702504 CAGTTCCCATTTTACATACAGGG - Intronic
906613830 1:47221729-47221751 CACTGCCCATTTTATAGCTAAGG + Intronic
907251144 1:53140745-53140767 CACATCCCATTTTACAGACAAGG + Intronic
907842582 1:58171646-58171668 CACATCCCAACTTACATGGATGG + Intronic
910264856 1:85327709-85327731 CCCATCCCATTTTACTGCTGAGG - Intronic
911054709 1:93699973-93699995 CCCACCCCATTTTACAGGTAAGG + Intronic
913461454 1:119090368-119090390 TTCCTCCCATTTTACAGCTAAGG - Intronic
913521852 1:119652057-119652079 CTCAGCCAATTTTACATTTAAGG - Intergenic
915437389 1:155918851-155918873 CTGTGCCCATTTTACATCTAAGG + Intronic
915829279 1:159110934-159110956 CACATTCCATTTACCATCTAGGG + Intronic
917086356 1:171308856-171308878 CACATCCCAACTTACATGGATGG + Intergenic
918327569 1:183425063-183425085 CACAACCCATATTCCTTCTATGG + Intergenic
918584056 1:186165290-186165312 AACATCCCATTTGACAGCTAAGG + Intronic
919558934 1:199094540-199094562 CACATCCCAACTTACATTGACGG + Intergenic
921383339 1:214546832-214546854 CATATCAAATTTTACATGTAAGG + Intronic
924584657 1:245351308-245351330 CACTTCCCAGTTTGCAACTAGGG - Intronic
1064600022 10:16984272-16984294 TACATCCCATGTTAGATCTATGG - Exonic
1064679463 10:17795376-17795398 ACTATCCCATTTTACAACTATGG - Intronic
1065671797 10:28127526-28127548 CAAATCACATTTTACATGGATGG + Intronic
1067264237 10:44723395-44723417 CACATTTCATTTTACATCTTAGG + Intergenic
1068647502 10:59484486-59484508 CTCATTACATTTTACATCTGTGG + Intergenic
1069330695 10:67289262-67289284 CTCTTCTCTTTTTACATCTAAGG - Intronic
1070063352 10:73008077-73008099 CTCATCCCATGTTTCATCTGTGG - Exonic
1070751657 10:78967618-78967640 GGCATCCCATTTTACAACTGAGG + Intergenic
1071793473 10:88980973-88980995 CAAATCCCACTTTTCATATAAGG - Intronic
1073591862 10:104765429-104765451 TACCTCCCATTTTACAGATAAGG - Intronic
1073938909 10:108670737-108670759 TACAACCCATTTTAATTCTAGGG + Intergenic
1074312655 10:112335857-112335879 CAGATCCCATTTTACAAATAAGG + Intergenic
1074497327 10:113991529-113991551 AACATCCTATTTTACCTCTCTGG - Intergenic
1074611444 10:115025860-115025882 AACAACCCATTTTACAGATAGGG + Intergenic
1074720782 10:116263409-116263431 ATCATCCCATTTTACACCCATGG + Intronic
1075866537 10:125726495-125726517 CATGTCACAATTTACATCTATGG - Intronic
1077463693 11:2723381-2723403 CACATCCCACTTTACAGATGGGG - Intronic
1077977840 11:7266733-7266755 GACATCACATTTTACAACAAAGG - Intronic
1079720905 11:23812818-23812840 CATTTCCCATTTAGCATCTAGGG + Intergenic
1079730974 11:23937574-23937596 CACATCCCAACTTACATGGACGG - Intergenic
1080414605 11:32057670-32057692 CATATCCCTTTTTACAGATAAGG + Intronic
1080829553 11:35878644-35878666 CACTTCCCTTTTTACAGCTGAGG + Intergenic
1081114344 11:39180643-39180665 AACGTCCCATAATACATCTATGG - Intergenic
1081149645 11:39611319-39611341 CACATACATTTTTACATTTAAGG - Intergenic
1081439881 11:43068314-43068336 CAAAACCCATTTTAAATGTAAGG - Intergenic
1083916444 11:65747426-65747448 CACAACCCAATATACATCAATGG - Intergenic
1084211254 11:67624025-67624047 CACATCCCAACTTACATGGATGG + Intergenic
1084724129 11:70929292-70929314 CACGTCCCATTTTACAGATGAGG - Intronic
1085764673 11:79272512-79272534 CACATCTCGTATTATATCTATGG + Intronic
1086447890 11:86887338-86887360 CATTTCCCATTTCACATCTTGGG - Intronic
1086615464 11:88812818-88812840 AACATCCAATTTTGCATGTAGGG + Intronic
1088069778 11:105767978-105768000 CACATAACATTATACAGCTATGG + Intronic
1088313099 11:108480787-108480809 CAACTCCCACTTTACATATATGG + Intronic
1088443992 11:109902970-109902992 CAAATCCCATTTTACATGGATGG + Intergenic
1088715556 11:112546142-112546164 CACAGCTGATTTTACATCTTGGG + Intergenic
1089508111 11:118978643-118978665 AACATCACATTCTACTTCTACGG - Intronic
1089619964 11:119716458-119716480 CTCATCCCATTGTACAGCTAGGG + Intronic
1090520919 11:127478174-127478196 CTCATCCCAGGTTACATCAATGG + Intergenic
1091112232 11:132980441-132980463 CACTTCCTATTTTAGTTCTAGGG - Intronic
1091693768 12:2614299-2614321 CACATTCCAGGGTACATCTATGG + Intronic
1092202130 12:6592147-6592169 CACATCCCACTTTGGAACTAAGG + Intronic
1098604775 12:72376911-72376933 CCAATCCCATTTTACAGATAAGG - Intronic
1098907692 12:76178799-76178821 CACACCCCATGTTACCTATAGGG + Intergenic
1099344845 12:81486201-81486223 ATGATCCCATTTTACATGTAGGG + Intronic
1100210041 12:92390604-92390626 CACATCCCAGCTTACATGGACGG + Intergenic
1100972853 12:100089998-100090020 CAAGTCCCATTTTACATGGATGG - Intronic
1102550218 12:113686027-113686049 CACTTGCCATTTTACACATAGGG - Intergenic
1102614484 12:114141429-114141451 CAGATCCAAAGTTACATCTATGG - Intergenic
1103129498 12:118454843-118454865 CATATCCCATTTTAGAAATAAGG - Intergenic
1103236074 12:119373686-119373708 CCCATCTCATTTTACAGATAAGG - Intronic
1106813150 13:33379686-33379708 CACATCCTCTTTTACAGATAAGG + Intergenic
1108418555 13:50225807-50225829 GTCATCCCATTTTACAGATATGG - Intronic
1110567566 13:76971611-76971633 CACATCCATGTTTACAGCTAGGG + Intergenic
1111568035 13:90042296-90042318 CAAATCACATCTTACATGTATGG - Intergenic
1112519377 13:100082277-100082299 CACATCCCATCTTACGTGGACGG + Intergenic
1112590369 13:100758243-100758265 CACAACCCATTTTACAGGTGAGG - Intergenic
1115151369 14:30289816-30289838 AATATCCCATTTTAAAGCTATGG + Intergenic
1115152999 14:30306832-30306854 CACTTGCCATGTTACTTCTAAGG - Intergenic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1118490156 14:66251011-66251033 GACATCCCATTTTACAGATAAGG - Intergenic
1118519133 14:66561519-66561541 CAGATTTCATTTTACATATAAGG + Intronic
1120862657 14:89268782-89268804 CACCTCCCATTTGGAATCTATGG + Intronic
1122368488 14:101213582-101213604 AACATCTCTTTTTACAGCTATGG - Intergenic
1124066422 15:26348020-26348042 CACATCACATCTTACATGGATGG - Intergenic
1125963329 15:43851449-43851471 TAAATCCCATTTCACAGCTAAGG - Intronic
1126328048 15:47503488-47503510 CCAGTCCCATTTTACAGCTATGG - Intronic
1126581052 15:50242877-50242899 GACATCCCAGTTTACCACTAGGG - Exonic
1127725729 15:61747730-61747752 AAGATCCCATTTTACAGATAAGG - Intergenic
1129656152 15:77526936-77526958 CACATGCCATTTTACAGCGGAGG - Intergenic
1129753142 15:78079985-78080007 CACAGCCCCTTTTACATACATGG - Intronic
1130042626 15:80417943-80417965 CACCCCCCATTTTACATATAAGG - Intronic
1135626603 16:24000514-24000536 AACATCCTATTTTACATATAAGG - Intronic
1135881171 16:26259146-26259168 CACATCCCATTTTCAAGGTATGG - Intergenic
1136745028 16:32579019-32579041 CAGATTCCATTTTTCATCTGGGG - Intergenic
1138489746 16:57369853-57369875 TGCATCCCATTTTACATATAGGG + Intergenic
1138494417 16:57398926-57398948 CACATCCCAACTTACATGGACGG - Intergenic
1140336950 16:74116565-74116587 GACATCCCATATTTCCTCTATGG - Intergenic
1203024568 16_KI270728v1_random:496203-496225 CAGATTCCATTTTTCATCTGGGG + Intergenic
1203047153 16_KI270728v1_random:838228-838250 CAGATTCCATTTTTCATCTGGGG - Intergenic
1145304629 17:21666575-21666597 AAAATCCCATTTTACAAATAGGG - Intergenic
1147505970 17:41017932-41017954 CACATCCCACTTTTCATGGAAGG + Intronic
1147576181 17:41600333-41600355 CTCATCCCATTTTACAGGTGAGG - Intergenic
1147720994 17:42539229-42539251 GAGATCCCATTTTACAAGTAAGG - Intronic
1147955233 17:44129800-44129822 CACTTCCCATTTTACAGATGAGG + Intergenic
1148045385 17:44740767-44740789 CTTATCCTATTTTATATCTAAGG - Intronic
1148506088 17:48128126-48128148 CACTTCCCAGTTTACACCTGCGG + Intergenic
1148804768 17:50258655-50258677 CCCATCCCATTTTACAGGTGAGG + Intergenic
1148955586 17:51351071-51351093 CATAACCCATTTTACCTTTATGG + Intergenic
1149209938 17:54290494-54290516 CACATCCCAACTTACATGGATGG + Intergenic
1150337233 17:64339336-64339358 CAAATCCCATTTTACAGTTGAGG - Intronic
1151342882 17:73482953-73482975 CTCTTCCCATTTTACAGCCAGGG + Intronic
1151568268 17:74912358-74912380 CACATCCCAACTTACATGGACGG + Intergenic
1153819163 18:8818153-8818175 CACAACCCATCTTACAGATAAGG + Intronic
1153916790 18:9752770-9752792 CACAAACCCTTTTACAACTAGGG + Intronic
1154412780 18:14150341-14150363 CTCATCCCATTTTACAGACAGGG + Intergenic
1155773169 18:29725659-29725681 CAAGTCCCATTTTACATGGATGG + Intergenic
1157052040 18:44177630-44177652 CACATCTACTTTTATATCTAGGG - Intergenic
1158672344 18:59487937-59487959 CACATCCCAATGTCCATCAATGG + Intronic
1158960265 18:62582351-62582373 CAATTCTCATTTTACATCTAGGG - Intronic
1159170997 18:64766600-64766622 CTCATCCCATCTTACATTTTAGG - Intergenic
1160020433 18:75176461-75176483 CACATCTCATTTTACAGATGAGG - Intergenic
1163817905 19:19478225-19478247 CACCTCCCCTTTTCCATCTGTGG + Intronic
1166724353 19:45017084-45017106 CAAATCCCATTTTTCCCCTAGGG + Intronic
1167427958 19:49439257-49439279 CTCTTCCCATTGTACAACTAAGG + Intronic
1167637636 19:50664458-50664480 CCCATCCCATGTTACAACAATGG + Intronic
1168633111 19:57972618-57972640 CACATCCCATCTTAGATATTTGG - Intronic
1168671450 19:58244093-58244115 CTGGACCCATTTTACATCTATGG - Intronic
926794559 2:16608117-16608139 CACATCGCATTATTCATTTATGG + Intronic
926997765 2:18756709-18756731 CACATCTCATTTCACAGCAAGGG - Intergenic
930031998 2:47064038-47064060 AACATCCCTTATTGCATCTAGGG - Intronic
930667999 2:54118515-54118537 CAAATCCCATTTGTCAACTAAGG - Intronic
932516435 2:72354910-72354932 CCCACACCATTTTAGATCTAAGG + Intronic
935138660 2:100331823-100331845 AACCTCTCATTTTGCATCTAAGG + Intergenic
935931305 2:108129197-108129219 CATATCCCATTTTTCAGGTAAGG + Intergenic
937016196 2:118608261-118608283 CACATAACATTTTACATGGAAGG + Intergenic
938228655 2:129639050-129639072 TACTTCCCATTTTACATATAAGG - Intergenic
938228904 2:129640876-129640898 TACTTCCCATTTTACATGTAAGG + Intergenic
939530105 2:143348696-143348718 CTCATTCCATCTTACACCTAAGG + Intronic
939694803 2:145311335-145311357 CAAATCACATCTTACATGTATGG + Intergenic
939709095 2:145492994-145493016 CACATCCCTTTTTTCATTTGTGG - Intergenic
940810415 2:158236639-158236661 AACACCTCATTTTACAACTAAGG + Intronic
941796362 2:169603434-169603456 CACATTCAATTTTACATATGAGG - Intronic
942877633 2:180820631-180820653 ATTATCCCATTTCACATCTATGG - Intergenic
943133990 2:183889436-183889458 CACATCCCAACTTACATGGACGG + Intergenic
945485193 2:210387378-210387400 CAGATCCCACTTTGCACCTATGG - Intergenic
1169648137 20:7836827-7836849 GACATTCCATTTTGCAGCTAAGG - Intergenic
1170177706 20:13490809-13490831 CATTCCCCATTTTACAGCTATGG - Intronic
1170731451 20:18979281-18979303 CACATCTCATTTGCCATCTAAGG + Intergenic
1171377197 20:24701492-24701514 CACATCCCAGCTTACACCCAGGG - Intergenic
1171522141 20:25784014-25784036 AAAATCCCATTTTACAAATAGGG - Intronic
1171529891 20:25845959-25845981 AAAATCCCATTTTACAAATAGGG - Intronic
1171554686 20:26071869-26071891 AAAATCCCATTTTACAAATAGGG + Intergenic
1173882542 20:46427313-46427335 CATATCTCATTTTAAATCAAAGG + Intronic
1173994824 20:47329832-47329854 CCCATCCCAATTTGCCTCTAGGG + Intronic
1174425376 20:50428482-50428504 CACATTCCATTTCACAGATAGGG - Intergenic
1174718438 20:52785094-52785116 ACCATCCCATTTTACAGATATGG - Intergenic
1175250932 20:57609902-57609924 GCCATCCCACTTTACAGCTAAGG + Intronic
1176251657 20:64124748-64124770 CACATCTCATCATACATCTCAGG - Intergenic
1176655944 21:9589006-9589028 AAAATCCCATTTTACAAATAGGG - Intergenic
1176860226 21:14007914-14007936 CTCATCCCATTTTACAGACAGGG - Intergenic
1177288061 21:19076912-19076934 CACGTCCCATCTTACATGGATGG - Intergenic
1177677251 21:24316609-24316631 CACCTCACATTTTCCATCTTGGG - Intergenic
1178961609 21:37071812-37071834 AACATTCCATTTTACAGATAAGG - Intronic
1179809553 21:43861715-43861737 GACACCCCATTTTACCTTTAAGG - Intergenic
1183304862 22:37077192-37077214 CTCATCCCATTTTACAGATGAGG + Intronic
949304037 3:2619438-2619460 AACATTCCATTATCCATCTATGG + Intronic
949437453 3:4045002-4045024 CACAGCCCATTTTATAGGTAAGG - Intronic
950533523 3:13566715-13566737 CACACCCCATGTGACATCTCAGG + Intronic
953676929 3:45009959-45009981 CTCATCCCATGTTACAGTTAGGG + Intronic
953741838 3:45545121-45545143 CCCATCCCATTTTACAGATAGGG - Intronic
956527852 3:70184822-70184844 CACACCACATTTTACCTCTCAGG + Intergenic
957766195 3:84628110-84628132 CAAATCCCTGTTTACATCAATGG - Intergenic
960360671 3:116706908-116706930 CTCATCCCATTTTACAGGTGAGG + Intronic
960929420 3:122829765-122829787 AACATCACATTTCACTTCTAGGG + Intronic
962071983 3:132043287-132043309 CAGCTCCCATTTGACATCAATGG + Intronic
962183685 3:133235560-133235582 CACATCCCATTTTACATCTAGGG - Intronic
965344197 3:167527231-167527253 CAATTCCCATTTTACAGATAAGG - Intronic
966991594 3:185236938-185236960 CAATTCCCATTTTACAGGTAAGG + Intronic
967600456 3:191381351-191381373 CACAAACCATGTTACATCAAAGG - Intronic
970120005 4:12743257-12743279 CACAGCACAATTTACATGTAGGG - Intergenic
970349257 4:15184839-15184861 AACCTACCATTTTACATCTACGG + Intergenic
970366046 4:15359370-15359392 CACCTCCAATTTTACCCCTAGGG - Intronic
972687883 4:41368798-41368820 CACTGTCCATTTTACATCTGAGG + Intronic
973847625 4:54929048-54929070 CACTTTCCATTTTCCATCAATGG - Intergenic
975553880 4:75640525-75640547 CCCATCCCATTTCACAAATAAGG + Intergenic
975734934 4:77371919-77371941 CACATCCCAGTTTACAGATAAGG - Intronic
976191997 4:82496351-82496373 CACAGCACATTTTACATCTCTGG + Intronic
978516181 4:109570732-109570754 CTCATCCCACTATACATATACGG - Intronic
978902313 4:113966886-113966908 CACATCCTCTTTCTCATCTATGG + Intronic
978914817 4:114111509-114111531 CAGATACTATTATACATCTATGG - Intergenic
985044363 4:185925329-185925351 CACATCCTATTCTGCCTCTAGGG - Intronic
986221955 5:5776125-5776147 CAAGTCCCATTTTACATGGATGG - Intergenic
988403742 5:30796933-30796955 CCCATCCCATCATACTTCTAAGG - Intergenic
988452944 5:31361583-31361605 CAATTCCCATTGTACAGCTATGG + Intergenic
991288439 5:65007149-65007171 CTAATGGCATTTTACATCTAAGG + Intronic
992034250 5:72756350-72756372 CACAGCTCATTTTACAGATATGG + Intergenic
992678598 5:79130320-79130342 CACATCAGTTTTTACATCAAAGG + Intronic
993185394 5:84612144-84612166 CACGTGGCATTTTACATTTAAGG - Intergenic
994205639 5:97032578-97032600 CCCTTCCCATTTTACCTGTATGG + Exonic
995167969 5:109069222-109069244 CACATTCCTTTCTACATTTATGG - Intronic
995706646 5:114994389-114994411 CACATCCCAAATTACATGGACGG + Intergenic
997226768 5:132214897-132214919 CACATCTTACTTTACAGCTAGGG - Intronic
1000085442 5:157884025-157884047 CACATCCCAACTTACATGGATGG + Intergenic
1000639296 5:163682569-163682591 CAAGTCCCATTTTACATGGAAGG - Intergenic
1000809791 5:165846799-165846821 AATATCCCATTTTACAGGTAAGG + Intergenic
1001270932 5:170311171-170311193 CATATCCCATTTGACATATCAGG + Intergenic
1001408024 5:171489478-171489500 CAGATGTCATTTTACCTCTACGG - Intergenic
1001439600 5:171731668-171731690 CACATCCTAGCTTACATTTAAGG - Intergenic
1003443367 6:6163669-6163691 CTCATCCTTTTTTACAGCTATGG + Intronic
1004919757 6:20365532-20365554 ATCATCCCGTTTTACATATAAGG + Intergenic
1007030250 6:38620407-38620429 CACGTCCCAATTTACATGGACGG + Intronic
1010571850 6:77482882-77482904 CACATTCCATTTTATATATTTGG + Intergenic
1011196673 6:84787590-84787612 CACATCTAATTTTAATTCTAAGG + Intergenic
1013147503 6:107408912-107408934 CATATCTCATTTTGGATCTAAGG + Intronic
1013175406 6:107672432-107672454 CACTTGCCAATTTACATCCATGG + Intergenic
1014053858 6:116990008-116990030 ATCATCCCATTTTACATACAAGG + Intergenic
1014407146 6:121065653-121065675 CAAACCCCATCTTACATGTATGG - Intergenic
1015617788 6:135096588-135096610 CTCTTCCCATTTTACAGATAAGG + Intronic
1019478153 7:1254006-1254028 CACCTCCCATGTTGCATCTGTGG + Intergenic
1020736548 7:11956341-11956363 AACATCCGTTTTTACATCTTTGG - Intergenic
1021445859 7:20732735-20732757 CACATCATATTTTATATCAATGG - Intronic
1022010193 7:26302148-26302170 CCCTTCCCATTTTCCATCTCAGG + Intronic
1024081605 7:45860818-45860840 CACATCACATGTTCCATCCATGG - Intergenic
1025282636 7:57639189-57639211 AAAATCCCATTTTACAAATAGGG - Intergenic
1028139142 7:87253747-87253769 CAAATCACATTTTACATGGATGG + Intergenic
1028477888 7:91271031-91271053 AAGATCCCATTTTAAATGTAAGG - Exonic
1036596141 8:10214169-10214191 CACATCTCTTTTGACAGCTAAGG + Intronic
1039095204 8:33876796-33876818 CACATCCCATGTTCCATGGATGG - Intergenic
1040750402 8:50698776-50698798 CACATCCCAAGGTAGATCTAGGG + Intronic
1040971257 8:53139573-53139595 CACGTCCCAATTTACATGGATGG - Intergenic
1042789560 8:72588555-72588577 CTCATCCCATTTTACAGGTGAGG + Intronic
1043711064 8:83419659-83419681 CACAACCCATGATACTTCTAAGG - Intergenic
1044456425 8:92396882-92396904 CACATCCCAACTTACATGGATGG - Intergenic
1044776092 8:95689536-95689558 CACATCACTCTTTACATGTATGG - Intergenic
1045060379 8:98405772-98405794 CACATCACATCTTACATGGATGG + Intronic
1046618236 8:116500633-116500655 CAAATCACATTTTACATGGATGG + Intergenic
1046826543 8:118698334-118698356 CACATACCACTGTACATATAAGG + Intergenic
1047565349 8:126038587-126038609 CACATCCCATTTTACTCTGAAGG - Intergenic
1048064790 8:130956841-130956863 CACATCCCATCTTACATGAATGG - Intronic
1048077170 8:131084269-131084291 CCTATCCCACTTTAAATCTATGG - Intergenic
1050264178 9:3872509-3872531 CAACTCCCATTTTACATGGATGG + Intronic
1050879541 9:10681597-10681619 CACATCCCATTTAACCACAAGGG + Intergenic
1050938482 9:11427800-11427822 ATCATCCCATTTTACAACTGAGG - Intergenic
1052657389 9:31380208-31380230 CACATCCCTTTTTTCATGTTAGG - Intergenic
1055203313 9:73694712-73694734 CACATCTCATTGTATCTCTATGG + Intergenic
1055584115 9:77738822-77738844 AACATAAGATTTTACATCTAGGG - Intronic
1056509853 9:87293816-87293838 CACCTACCCTTTTACATCCAAGG - Intergenic
1057180735 9:93028716-93028738 CCCATCCCATTTTACAGGTGAGG + Intronic
1057896816 9:98915776-98915798 CTCTTCCCATTTTACAGATAAGG - Intergenic
1058099010 9:100897683-100897705 AAAGTCCCATTTTACATCCAAGG + Intergenic
1058123781 9:101168365-101168387 AACATCCCATATCATATCTATGG - Intronic
1058242049 9:102576401-102576423 CACACCTCATTTTACACCAAAGG - Intergenic
1058574213 9:106382611-106382633 CTTATCCCATTTTACAAATAAGG + Intergenic
1059412989 9:114145306-114145328 CAAATCCCAGTTTCCATCTCTGG - Intergenic
1060785624 9:126449854-126449876 CACTTCCCATTTTACAAATAAGG + Intronic
1060971459 9:127740536-127740558 CACAACCCATTTTACAGATTAGG + Intronic
1061234782 9:129336044-129336066 AACACCCCATTTTACAGGTAAGG + Intergenic
1061369341 9:130189263-130189285 CTATTCCCATTTTACAGCTAAGG + Intronic
1062434972 9:136542984-136543006 CAGTGCCCATTTTACATCTGAGG + Intronic
1203633661 Un_KI270750v1:92467-92489 AAAATCCCATTTTACAAATAGGG - Intergenic
1187164689 X:16794063-16794085 TACATCCCAGTTTACAGATAAGG + Intronic
1188595290 X:31893074-31893096 CACATGACTTTTGACATCTATGG - Intronic
1190061832 X:47216628-47216650 CTCATTCCATTTTACTTCTGCGG + Intergenic
1195529922 X:105942426-105942448 GACATCCCACTTTACACCCATGG - Intronic
1196177024 X:112649930-112649952 CACATCCCTTTTTTCATGTGTGG + Intronic
1196539745 X:116893798-116893820 CACATCACTTTTTCCATCTTTGG + Intergenic
1197269205 X:124407833-124407855 GACACCCAATTTAACATCTAAGG - Intronic
1197356568 X:125443171-125443193 ATCATCCCATTTTCCATATAAGG - Intergenic
1197509053 X:127348116-127348138 CACCTCCCATATTGCATCTTTGG + Intergenic
1197721735 X:129749897-129749919 CCCATCCCATTTTACAGATAAGG - Intronic
1198064406 X:133082150-133082172 CACATCACCTTTCACATCAAAGG + Intronic
1199319046 X:146416894-146416916 TTAATCCCATTTTACAGCTAAGG + Intergenic
1199592708 X:149482713-149482735 CACATCACATTTGCCATCCATGG + Exonic
1200628850 Y:5555653-5555675 CACATCACATCTTACATGGATGG - Intronic
1201311867 Y:12604715-12604737 CACATCCCAAATTACATGGATGG - Intergenic
1201402951 Y:13622566-13622588 CACGTCTCATTTTACATTGATGG + Intergenic
1201515787 Y:14817723-14817745 CACATCCCAACTTACATGGACGG - Intronic
1201555937 Y:15264716-15264738 CACATCCCAACTTACATGGACGG + Intergenic
1201944101 Y:19492903-19492925 TACATTCCTTTTTACCTCTATGG + Intergenic
1202588477 Y:26456943-26456965 CACATTCCCTGTTACATGTAAGG - Intergenic