ID: 962184510

View in Genome Browser
Species Human (GRCh38)
Location 3:133243874-133243896
Sequence ACTCTTGGTCTCAGGGTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 219}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962184510_962184520 25 Left 962184510 3:133243874-133243896 CCTAGAACCCTGAGACCAAGAGT 0: 1
1: 0
2: 1
3: 14
4: 219
Right 962184520 3:133243922-133243944 TTTCCCAGGAATAACTGATAGGG 0: 1
1: 0
2: 1
3: 16
4: 196
962184510_962184515 -2 Left 962184510 3:133243874-133243896 CCTAGAACCCTGAGACCAAGAGT 0: 1
1: 0
2: 1
3: 14
4: 219
Right 962184515 3:133243895-133243917 GTCCTGTGGAGTGACTTATTAGG 0: 1
1: 0
2: 0
3: 7
4: 83
962184510_962184521 26 Left 962184510 3:133243874-133243896 CCTAGAACCCTGAGACCAAGAGT 0: 1
1: 0
2: 1
3: 14
4: 219
Right 962184521 3:133243923-133243945 TTCCCAGGAATAACTGATAGGGG 0: 1
1: 0
2: 0
3: 12
4: 166
962184510_962184519 24 Left 962184510 3:133243874-133243896 CCTAGAACCCTGAGACCAAGAGT 0: 1
1: 0
2: 1
3: 14
4: 219
Right 962184519 3:133243921-133243943 GTTTCCCAGGAATAACTGATAGG 0: 1
1: 0
2: 1
3: 19
4: 114
962184510_962184517 2 Left 962184510 3:133243874-133243896 CCTAGAACCCTGAGACCAAGAGT 0: 1
1: 0
2: 1
3: 14
4: 219
Right 962184517 3:133243899-133243921 TGTGGAGTGACTTATTAGGAAGG 0: 1
1: 0
2: 0
3: 8
4: 124
962184510_962184518 11 Left 962184510 3:133243874-133243896 CCTAGAACCCTGAGACCAAGAGT 0: 1
1: 0
2: 1
3: 14
4: 219
Right 962184518 3:133243908-133243930 ACTTATTAGGAAGGTTTCCCAGG 0: 1
1: 0
2: 1
3: 17
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962184510 Original CRISPR ACTCTTGGTCTCAGGGTTCT AGG (reversed) Intronic