ID: 962185810

View in Genome Browser
Species Human (GRCh38)
Location 3:133258368-133258390
Sequence ATGCCCTTCTTGTAGCTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 134}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962185810_962185814 10 Left 962185810 3:133258368-133258390 CCATCAAGCTACAAGAAGGGCAT 0: 1
1: 0
2: 1
3: 5
4: 134
Right 962185814 3:133258401-133258423 CAGGAAAGCATACCATGTGGTGG 0: 1
1: 0
2: 1
3: 16
4: 196
962185810_962185815 11 Left 962185810 3:133258368-133258390 CCATCAAGCTACAAGAAGGGCAT 0: 1
1: 0
2: 1
3: 5
4: 134
Right 962185815 3:133258402-133258424 AGGAAAGCATACCATGTGGTGGG 0: 1
1: 0
2: 1
3: 15
4: 196
962185810_962185818 25 Left 962185810 3:133258368-133258390 CCATCAAGCTACAAGAAGGGCAT 0: 1
1: 0
2: 1
3: 5
4: 134
Right 962185818 3:133258416-133258438 TGTGGTGGGCCCAGGCTGAAAGG 0: 1
1: 1
2: 0
3: 27
4: 265
962185810_962185813 7 Left 962185810 3:133258368-133258390 CCATCAAGCTACAAGAAGGGCAT 0: 1
1: 0
2: 1
3: 5
4: 134
Right 962185813 3:133258398-133258420 AGGCAGGAAAGCATACCATGTGG 0: 1
1: 0
2: 2
3: 17
4: 237
962185810_962185816 17 Left 962185810 3:133258368-133258390 CCATCAAGCTACAAGAAGGGCAT 0: 1
1: 0
2: 1
3: 5
4: 134
Right 962185816 3:133258408-133258430 GCATACCATGTGGTGGGCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 147
962185810_962185812 -9 Left 962185810 3:133258368-133258390 CCATCAAGCTACAAGAAGGGCAT 0: 1
1: 0
2: 1
3: 5
4: 134
Right 962185812 3:133258382-133258404 GAAGGGCATGTTGTGAAGGCAGG 0: 1
1: 0
2: 1
3: 13
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962185810 Original CRISPR ATGCCCTTCTTGTAGCTTGA TGG (reversed) Intronic
900748743 1:4379944-4379966 AGGCCTCTCTTGTAGCTTGAAGG + Intergenic
904450461 1:30607708-30607730 ATGCCCTCCATGTGGCCTGAAGG - Intergenic
904558166 1:31379101-31379123 CTGACCTTTTTGTACCTTGAGGG + Intergenic
904606505 1:31700836-31700858 ATGCCCTTCCTGGAGCTCCAAGG - Intronic
905294007 1:36942722-36942744 ATGCCTTGCCTGTAGCTGGAGGG + Intronic
907511267 1:54962469-54962491 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
909576125 1:77178295-77178317 ATGCCCTTCTAGAAGTATGAAGG - Intronic
911480423 1:98432270-98432292 ATGCTCTTCAGGTATCTTGAAGG + Intergenic
914319774 1:146548027-146548049 ATTCCCTTCTGGAGGCTTGAGGG + Intergenic
915392837 1:155560239-155560261 ATGCTCATCTTCTAACTTGAGGG + Intronic
915408935 1:155685818-155685840 ATGCTCATCTTCTAACTTGAGGG + Intronic
915516805 1:156418135-156418157 AAGCCTTTCATGTAGCTTGTTGG - Intronic
917689234 1:177450323-177450345 ATGCTTTTCTTTTAGGTTGAAGG - Intergenic
918435526 1:184507861-184507883 AAGCCCTTCTTTAATCTTGATGG + Intronic
919195394 1:194278520-194278542 AGGCCCTTCTTGAAGGTGGAGGG + Intergenic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
922728492 1:227937706-227937728 ATGCCCCTCTGGAGGCTTGAGGG - Intronic
923962374 1:239100607-239100629 TAGCTTTTCTTGTAGCTTGACGG - Intergenic
1070336214 10:75457067-75457089 ATGACCTTCTTGAATCTTTATGG + Intronic
1071426130 10:85554858-85554880 ATGTCTTTTTTGTGGCTTGATGG - Intergenic
1072779838 10:98241162-98241184 ATTCCCTTCTTTTAGAGTGACGG - Intronic
1073515012 10:104068530-104068552 TTGGCCTTCTAGAAGCTTGAGGG - Intronic
1075242059 10:120788057-120788079 ATGCACTTCTTGTAGCAGGCCGG - Intergenic
1075563049 10:123482315-123482337 AAGCACTTTTTGGAGCTTGAAGG - Intergenic
1078199500 11:9167441-9167463 ATGCTCTTCTTATAGCTCCAGGG + Intronic
1078573348 11:12478001-12478023 ATCACCTACTTGTAGCTAGAAGG + Intronic
1078776786 11:14401183-14401205 ATAGCCATCTTGCAGCTTGAGGG - Intergenic
1079049507 11:17141100-17141122 AAGCCCTAATTGTAGCTTCAAGG - Intronic
1081950923 11:47041811-47041833 ATGCCCTTTTGATAGCTGGATGG + Intronic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1083275841 11:61596519-61596541 ATGCCCTTCTTGTGCCGTGGGGG + Intergenic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1087672029 11:101118794-101118816 ATATCCTTCTTGTGGCTAGATGG - Intronic
1090934036 11:131325850-131325872 ATGCCCTTCCTCTACCTGGAGGG + Intergenic
1091325035 11:134679687-134679709 ATGTGCTTCTTGGAGCCTGAAGG - Intergenic
1092181848 12:6451669-6451691 TTGCCCGTCTTGTAGCATGTGGG - Exonic
1093356236 12:18171840-18171862 ATGCCATTCTAGAAGATTGAAGG - Intronic
1095096668 12:38152858-38152880 ATGGCCTTCTTGCCGCTTGGAGG - Intergenic
1096620084 12:52858923-52858945 ATGCCCTCCTTGTAGGTTTCGGG - Intergenic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1102350758 12:112190477-112190499 ATGCCATTATTGTAACTTTAGGG - Intronic
1103646462 12:122397235-122397257 TTGCCCTTCTGATGGCTTGATGG + Intronic
1104128542 12:125870899-125870921 ATGCTCTAGTTGTAACTTGATGG + Intergenic
1107557918 13:41534052-41534074 ATGCTCTTGTTGCAGCTTCAGGG + Intergenic
1110439743 13:75514565-75514587 CTTCCCATCTTGTAGCTTGGAGG + Intergenic
1110678069 13:78274547-78274569 AAGCCCATTTTCTAGCTTGATGG + Intergenic
1110920835 13:81082819-81082841 ATTCACTTATTGAAGCTTGATGG + Intergenic
1111081638 13:83318557-83318579 ATGTATTTCTTCTAGCTTGAAGG + Intergenic
1111594602 13:90395612-90395634 ATGCCCTTCTAGAAGACTGATGG - Intergenic
1111985900 13:95066799-95066821 ATTCCCTTGGTGTAGCTAGAAGG + Intronic
1115290191 14:31762374-31762396 ATACCTTACTTGTAGCTTCATGG + Intronic
1117024872 14:51608930-51608952 ATGCCCTCCTTGTAGCATGTAGG - Intronic
1121249863 14:92491489-92491511 ATGCCCTTCCTGAAGCCTAAAGG - Intronic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1125236917 15:37525277-37525299 ATGCCATTTTTGTTGCATGATGG + Intergenic
1126167360 15:45665072-45665094 AAGCTCTTCCTGTAGCTTGAAGG - Intronic
1132278367 15:100590470-100590492 ATGCCCTTCTAGAAGATTGAAGG - Intronic
1137704464 16:50524843-50524865 CTGCACTTCTTGTAGCTGAATGG - Intergenic
1139305437 16:65981853-65981875 ATGATCTCCTTCTAGCTTGAAGG - Intergenic
1140013754 16:71162050-71162072 ATTCCCTTCTGGAGGCTTGAGGG - Intronic
1141895246 16:86955111-86955133 CTGCCCATCTTGTCCCTTGACGG + Intergenic
1146679236 17:34795131-34795153 TTCCCCTTCTTCCAGCTTGAGGG - Intergenic
1147166575 17:38596589-38596611 ATGCCATTCTGGAAGGTTGATGG + Intronic
1150567873 17:66358423-66358445 TTGCCCTTCTAGTACCTAGAAGG + Intronic
1153711684 18:7806444-7806466 ATGCCCTTATTGTTCCTTGCAGG - Intronic
1156631960 18:38980730-38980752 ATGCCATTCTTCTAGCTTGATGG + Intergenic
1157013303 18:43678854-43678876 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
926177710 2:10611261-10611283 GTGGCCTTCTTGTAGCATGTTGG - Intronic
928382638 2:30832928-30832950 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
930974367 2:57437577-57437599 TTGCCTTTCTGGTAGCTTTAAGG - Intergenic
932759782 2:74431614-74431636 TTGCCCTTCCTCTAGCTTCATGG + Intronic
935432118 2:102987562-102987584 ATGGCATTGTTGTAGCTTCAAGG - Intergenic
935532771 2:104254794-104254816 ATGACCTTCTTGTACTTGGATGG - Intergenic
936442369 2:112565822-112565844 ATCCCCTTCCTGGAGGTTGAGGG + Intronic
938777308 2:134553352-134553374 GTGCCCTCCTTGTAACTGGAGGG - Intronic
940474579 2:154146626-154146648 ATGCCCTACTTTTAGGTAGATGG - Intronic
941173847 2:162172750-162172772 AACCCCTCCTTTTAGCTTGAGGG + Intronic
943969135 2:194380814-194380836 ATGCCCTTCTAGAAGAATGAAGG + Intergenic
1168744668 20:228073-228095 ATGCCCTTATGGTAGTTTGGGGG - Intronic
1170368991 20:15627771-15627793 CTGCCCTTCTCCTAGCCTGATGG + Intronic
1170890471 20:20371102-20371124 CTGCCCTTCTGGCAGCCTGAGGG + Intergenic
1172149802 20:32781741-32781763 GTGCCATTCTGGTAGCATGATGG + Intronic
1173416667 20:42862974-42862996 ATGCACTTCTACTATCTTGATGG + Intronic
1174961800 20:55166148-55166170 ATGCCCTTCTCTCATCTTGAAGG + Intergenic
1176372338 21:6069630-6069652 ATGCACTTCTTGTATCTCCAAGG + Intergenic
1176589260 21:8626633-8626655 ATGCCCCTCTTCTAGATAGAGGG - Intergenic
1176998836 21:15587237-15587259 GTGCCCTCCTTGTACCTGGAGGG + Intergenic
1179349869 21:40598259-40598281 CTGATCTTTTTGTAGCTTGATGG + Intronic
1179751180 21:43468909-43468931 ATGCACTTCTTGTATCTCCAAGG - Intergenic
1180272088 22:10603630-10603652 ATGCCCCTCTTCTAGATAGAGGG - Intergenic
1182659596 22:31915869-31915891 ATTCCCATCTTGTCGCTAGACGG - Intergenic
1184761490 22:46547254-46547276 ATGGCCTTCTGGCAGCTGGAGGG + Intergenic
949138047 3:595130-595152 ATGCCCCTCTTCTAGATAGAGGG + Intergenic
951221748 3:20075963-20075985 TTACCTTTCTTGTAGATTGATGG + Intronic
951603158 3:24399291-24399313 ATGCCCTTCAGGTAGACTGAGGG - Intronic
955655646 3:61242318-61242340 GTGCCCTGCTTTTAGCTAGATGG - Intronic
957680125 3:83423211-83423233 ATGACCTGCTTTTAGCTAGAGGG + Intergenic
962185810 3:133258368-133258390 ATGCCCTTCTTGTAGCTTGATGG - Intronic
962307532 3:134301583-134301605 ATGGCCTCCAAGTAGCTTGAGGG - Intergenic
962850572 3:139305731-139305753 ATGCCTTTCTTGCAGGGTGACGG + Intronic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
973967069 4:56173835-56173857 AAGCCCTTCTTGTACCCTGTTGG - Intronic
976910718 4:90302430-90302452 ATGCCCTTCCTGTAACTCCATGG - Intronic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
979709448 4:123761198-123761220 TTGCTCTTCTTTTAGCTTAAAGG - Intergenic
982900190 4:160989199-160989221 AAGACCTTGTTGAAGCTTGAAGG + Intergenic
986794291 5:11193665-11193687 AAGCTCTTCTTCTATCTTGATGG - Intronic
990020746 5:51124420-51124442 ATACCCTATTTCTAGCTTGAAGG + Intergenic
990082002 5:51928480-51928502 ATGCCCTTCTAGAAGATCGAAGG - Intergenic
990892927 5:60666779-60666801 TTGTGCTTCTTGTAGCGTGATGG - Intronic
991231895 5:64343407-64343429 ATTCCCTTCTTGTTCCTTCAGGG - Intronic
992379601 5:76224136-76224158 GAGCCCTTCTAGTAGCTAGAGGG - Intronic
995183784 5:109251735-109251757 ATGCCCATCTTATAGATGGAAGG + Intergenic
996233423 5:121095639-121095661 ATGCCCTGCTGGAAGCATGAGGG - Intergenic
1006290670 6:33133669-33133691 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1008881555 6:56385365-56385387 ATTCCTTTCTGGAAGCTTGAGGG + Intronic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1012985820 6:105875327-105875349 TGGCTCTTCTTGTTGCTTGAGGG - Intergenic
1014259796 6:119203481-119203503 ATGCCCTTATTGTGGCCTGTGGG - Intronic
1023486170 7:40689573-40689595 ATGCCCTTCATATAGTGTGAAGG - Intronic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1030095514 7:105895070-105895092 ATGTCCTTCATGGAGTTTGAAGG + Intronic
1030971771 7:116066099-116066121 ATGCCCTGCTTATAGCCTAATGG + Intronic
1032791157 7:135243329-135243351 ATGCCCATCTTCCAGGTTGAAGG - Exonic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1036155545 8:6338952-6338974 ATGCCCTACATGTGGCTTAAGGG - Intergenic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1048324834 8:133430793-133430815 ATGCCCCTCCTGTAGCCTGTGGG + Intergenic
1055138071 9:72845708-72845730 GATCCCTTCTTGTAGCTTGTAGG - Intergenic
1060470399 9:123943382-123943404 ATCCACTTCTTGTTGCTTGGGGG - Intergenic
1203619265 Un_KI270749v1:105219-105241 ATGCCCCTCTTCTAGATAGAGGG - Intergenic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1187039472 X:15578645-15578667 ATGCCCTTCTTGGTGCTTCTAGG - Intronic
1187794861 X:22992873-22992895 ATGCCCTTTTTGTAGAATGATGG - Intergenic
1189679730 X:43503371-43503393 AGGCTCTTCTTGTAGCCTCAAGG - Intergenic
1191671345 X:63751522-63751544 ATTCCCTTCTGGTTGCTAGATGG + Intronic
1193927323 X:87503665-87503687 ATGCTATTCTCTTAGCTTGAAGG + Intergenic
1193945579 X:87728950-87728972 ATGCCCATCTTGTATCTGAAAGG - Intergenic
1196088637 X:111714343-111714365 AAGCCCTTCTTTCTGCTTGAGGG + Intronic
1198394177 X:136206409-136206431 GTGCCCACCTTGTAGCTGGAGGG - Exonic