ID: 962186949

View in Genome Browser
Species Human (GRCh38)
Location 3:133270258-133270280
Sequence CTCAGCTTGCATTCTAGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 0, 3: 48, 4: 292}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962186949 Original CRISPR CTCAGCTTGCATTCTAGTGG TGG (reversed) Intronic
900240893 1:1616709-1616731 CTGAGCATGCATGCGAGTGGAGG + Intronic
901574113 1:10186164-10186186 CCGGGCTTACATTCTAGTGGGGG - Intergenic
901615728 1:10538083-10538105 CAGAGCTTAAATTCTAGTGGAGG + Intronic
901674460 1:10874870-10874892 ATCAGTGTGCATTCTGGTGGCGG - Intergenic
901975849 1:12943207-12943229 CTCAGCCTGGAGTGTAGTGGTGG + Intronic
902801572 1:18833251-18833273 AGCAGCTCACATTCTAGTGGAGG - Intergenic
903003515 1:20283231-20283253 TTGAGCTTGCATTGTAGTAGAGG + Intergenic
903040909 1:20529591-20529613 GTGAGCTTACATTCTATTGGAGG - Intergenic
903922664 1:26811829-26811851 CTGAGATTGCATCCTAGTTGTGG - Intergenic
904099941 1:28016873-28016895 TGCAGCTTACATTCTAGTAGGGG + Intronic
905252868 1:36660806-36660828 ATGAGCTTACATTCTAGTGGAGG + Intergenic
907014950 1:51003615-51003637 CACACCTTGACTTCTAGTGGAGG + Intergenic
907464837 1:54628056-54628078 CTCAGCTTGCATTTGGGAGGTGG + Intronic
907784709 1:57600179-57600201 CTGAGCTTGCATCCTGTTGGGGG - Intronic
907823441 1:57992726-57992748 CTCTGCTTGAATCCTTGTGGTGG + Intronic
909680719 1:78288334-78288356 ATAAGCTTTCATTCTAGTGTGGG - Intergenic
909936844 1:81561245-81561267 TTGAGCTTAAATTCTAGTGGGGG - Intronic
910200788 1:84696347-84696369 CTGAGTTTATATTCTAGTGGAGG - Intergenic
910215918 1:84844051-84844073 ATAAGCTTACATTCTAGTGCAGG - Intronic
910234568 1:85022538-85022560 TAAAGCTTACATTCTAGTGGAGG + Intronic
910871960 1:91842179-91842201 CGGAGCTTACATTTTAGTGGGGG + Intronic
911285878 1:95991617-95991639 TAGAGCTGGCATTCTAGTGGAGG + Intergenic
911617915 1:100035551-100035573 CAGAGCTTACATTCTAGTGGGGG - Intergenic
912173751 1:107132978-107133000 CTCAGCTCTCAGGCTAGTGGGGG + Intergenic
912677011 1:111691898-111691920 TGGAGCTTGCATTATAGTGGAGG + Intronic
912943403 1:114065204-114065226 CTCAGCTTACAGTCTATTGTGGG - Intergenic
913249613 1:116901937-116901959 CTCTACTTTCATTCTAGTAGAGG + Intergenic
913296358 1:117324440-117324462 TTAAGCTTACATTCTAGTAGAGG - Intergenic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
915604227 1:156940623-156940645 TTGAGCTTACATTCTAGGGGAGG + Intronic
915877123 1:159622864-159622886 TGCAGCTTTCATTCTTGTGGAGG - Intergenic
916721133 1:167485453-167485475 CCCATCTTGGATTGTAGTGGGGG + Intronic
918106616 1:181420894-181420916 CTCTGCTTACAATCTAGTGGGGG - Intronic
918479260 1:184960570-184960592 TACAGCTTACATTCTAGTGGTGG + Intronic
918992269 1:191712452-191712474 ATGAGCTTGAATTCTAGTAGAGG + Intergenic
919540445 1:198838954-198838976 AGGAGCTTACATTCTAGTGGGGG + Intergenic
919901121 1:202045066-202045088 ATTAGCCTCCATTCTAGTGGGGG - Intergenic
920971067 1:210744145-210744167 CTGAGCCTGCATTCCGGTGGAGG - Intronic
921121395 1:212140548-212140570 CTCATGTTACATTCTAGTGGAGG - Intergenic
922653631 1:227362256-227362278 TTGAGTCTGCATTCTAGTGGAGG + Intergenic
923009337 1:230075666-230075688 TGGAGCTTTCATTCTAGTGGGGG + Intronic
923575025 1:235150745-235150767 CACAGCTTACAGTCTGGTGGAGG + Intronic
923613468 1:235516417-235516439 CGGAGCTTCCATTCTAGTGGGGG + Intergenic
923683964 1:236141737-236141759 CCCAGCTTGCATCCCAGAGGAGG + Intergenic
923806210 1:237260892-237260914 CTCAGTTTGCATGCTAGTACAGG - Intronic
923806512 1:237263845-237263867 CAGAACTTGCATTCTAGTGGGGG + Intronic
924569626 1:245226427-245226449 CTCAGTCTGTATTCTTGTGGAGG + Intronic
924682883 1:246256080-246256102 CTCAGCTTGCAGCCTATTGTGGG - Intronic
1063768225 10:9167665-9167687 TTCAGCTTCCATTCTAGTAGAGG + Intergenic
1066030885 10:31422673-31422695 CTCAGCTTTCATTTTAGAGTTGG + Intronic
1067009781 10:42700255-42700277 GGGAGCTTACATTCTAGTGGGGG + Intergenic
1067150596 10:43729456-43729478 CTCAGGTTCTATTCTAGTGGTGG + Intergenic
1067191180 10:44069440-44069462 CTCAGCTTTCAAACCAGTGGAGG - Intergenic
1067313939 10:45143045-45143067 AGGAGCTTACATTCTAGTGGGGG - Intergenic
1069055718 10:63842763-63842785 TTCAGCTTATATTCTAGTGAAGG + Intergenic
1069404681 10:68086433-68086455 TTCAGCTAGCAGTCTAGTGGGGG - Intergenic
1070043531 10:72806595-72806617 TGGACCTTGCATTCTAGTGGTGG + Intronic
1070769716 10:79075110-79075132 CTCAGCTGGCTGTCTAGGGGTGG - Intronic
1071767580 10:88685935-88685957 CAGAGCTTACATTTTAGTGGTGG + Intergenic
1071854459 10:89609401-89609423 ATGAGCTTGTATTCTAGTGGGGG - Intronic
1072060717 10:91808098-91808120 TGGAGCTTGCATTCTAGTGAAGG + Intronic
1074350919 10:112736317-112736339 CATAGCTTACAATCTAGTGGTGG - Intronic
1078396734 11:10988118-10988140 CAGAGCTTACATTCTAGAGGAGG - Intergenic
1078607156 11:12786736-12786758 TGGAGCTTACATTCTAGTGGGGG + Intronic
1078829502 11:14966058-14966080 ATGGGCTTACATTCTAGTGGGGG - Intronic
1079057354 11:17217859-17217881 TTGAGCTTACATTCTAGTGTGGG - Intronic
1079251473 11:18791030-18791052 CTAAGCTTGTATTCTAGGGGAGG + Intronic
1079924420 11:26476206-26476228 CAAAGCTTGTAGTCTAGTGGAGG + Intronic
1080040031 11:27749941-27749963 TGAAGCTTTCATTCTAGTGGTGG - Intergenic
1080089094 11:28323323-28323345 CTGAGTCTGTATTCTAGTGGAGG + Intronic
1080154291 11:29090240-29090262 CTCAGCCTGCATACTAGAGTGGG + Intergenic
1080932851 11:36830811-36830833 TTGAGCTTACATTCTAGTGGAGG + Intergenic
1080997747 11:37624750-37624772 TTGAGCTTGCATTGTAGTGAAGG - Intergenic
1081232245 11:40599601-40599623 TCCAGCATTCATTCTAGTGGAGG - Intronic
1081322585 11:41709219-41709241 CGGAGCTTGTATTCTAGTAGGGG + Intergenic
1081736021 11:45404861-45404883 CTCAGTTTATATTCTAGTAGGGG - Intergenic
1084861957 11:72024829-72024851 CTCAGCCTTCAGCCTAGTGGGGG - Intronic
1084862057 11:72025468-72025490 CTCAGCCTTCAACCTAGTGGGGG + Intronic
1085082679 11:73647283-73647305 CCCAGCTTCCAGTCTAGTGAGGG - Intronic
1085614939 11:77990177-77990199 CTCAGCCTGGAGTATAGTGGTGG - Intronic
1086208013 11:84283718-84283740 CTGAGCTTACAGTTTAGTGGAGG - Intronic
1088674597 11:112180425-112180447 ATCAAATTACATTCTAGTGGGGG - Intronic
1088879983 11:113965499-113965521 TAGAGCTTACATTCTAGTGGAGG + Intergenic
1089501102 11:118931699-118931721 CACAGCCTGCAGCCTAGTGGGGG + Intronic
1089758408 11:120704578-120704600 CAGAGCTTACATTCTAGTAGAGG - Intronic
1091423921 12:369425-369447 TGGAGCTTACATTCTAGTGGAGG + Intronic
1093057559 12:14569889-14569911 CAGAGCTTGCATTCCAGTAGTGG + Intergenic
1095214439 12:39531143-39531165 TTGAGCTTACATTCTAGTGGGGG + Intergenic
1095304327 12:40621979-40622001 TGCAGCTTGCATTGTAGTGAGGG - Intergenic
1095956646 12:47810394-47810416 CTCAGCCTGCCTCCTAGTAGTGG + Intronic
1096992226 12:55814217-55814239 ATCAGCTTGTATTCTCTTGGCGG - Intronic
1098225096 12:68313068-68313090 TTGAACTTACATTCTAGTGGAGG - Intronic
1098227940 12:68344083-68344105 TGGAGCTTGCATTCTACTGGAGG + Intergenic
1099170295 12:79355898-79355920 TGCAGCTTGCATTCTAATGTAGG + Intronic
1100933496 12:99637722-99637744 CTCAGCTTGCAGCCTATTGTGGG + Intronic
1101359267 12:104010733-104010755 ATGAGCTTACAGTCTAGTGGAGG - Intronic
1101461503 12:104900914-104900936 CTGAGCTTACATTTCAGTGGAGG - Intronic
1101556690 12:105816712-105816734 CCCAGCTTGCATTATTCTGGCGG + Intergenic
1101683084 12:106987881-106987903 TGGAGCTTACATTCTAGTGGAGG + Intergenic
1101863231 12:108499806-108499828 CACAGCTTACTTTCTGGTGGAGG - Intergenic
1103506668 12:121445664-121445686 CAGAGCTTACATTTTAGTGGAGG + Intronic
1104278546 12:127352885-127352907 CAAAGCTGACATTCTAGTGGAGG - Intergenic
1104371143 12:128224967-128224989 ATGAGCTTGCATTCCAGTAGGGG + Intergenic
1105588935 13:21773156-21773178 GAGAGCTTACATTCTAGTGGAGG - Intergenic
1106801305 13:33259128-33259150 AGGAGCTTCCATTCTAGTGGGGG - Intronic
1106808180 13:33332800-33332822 CTGAGCTTCTATTCAAGTGGTGG - Intronic
1107911733 13:45111949-45111971 CTCAGGTTGGATTTTGGTGGAGG - Intergenic
1108591886 13:51919845-51919867 CTTTGCTTGCATTTGAGTGGGGG - Intergenic
1109482717 13:62977526-62977548 CTCAGCTTGCTTTCTCTTGGTGG - Intergenic
1110430034 13:75413000-75413022 CACAGCTTACCTTCCAGTGGGGG + Intronic
1111381586 13:87460649-87460671 CTCAGCTTGCCTTCTAGCAATGG + Intergenic
1112552283 13:100432748-100432770 CACTGCTTGCACCCTAGTGGAGG - Intronic
1112569160 13:100578328-100578350 CTCAGGTTGCGGTGTAGTGGTGG - Intronic
1114310892 14:21466085-21466107 TGCAGCTTACAGTCTAGTGGGGG - Intronic
1116550845 14:46235782-46235804 TTGAGCTTGCATTCTAGTCAAGG + Intergenic
1117748836 14:58899774-58899796 CTCAGCTTACATTTTGGTGATGG + Intergenic
1117828686 14:59728885-59728907 CTCTGCTTATACTCTAGTGGAGG + Intronic
1118056196 14:62081997-62082019 GAGAGCTTGCAGTCTAGTGGTGG + Intronic
1118275861 14:64385911-64385933 CTCAGCTCATATTCTGGTGGAGG - Intergenic
1118506969 14:66423980-66424002 CAAAGCTTACATTCTAGTCGGGG - Intergenic
1119029348 14:71179549-71179571 CACAGCTTGGATTCTAGGGCAGG + Intergenic
1119215030 14:72862856-72862878 TGGAGCTTGCATTCTAGTGGGGG - Intronic
1119474786 14:74920797-74920819 GGGAGTTTGCATTCTAGTGGGGG - Intronic
1120156409 14:81098155-81098177 CTGAGCGTACATTCTGGTGGGGG + Intronic
1121183695 14:91948250-91948272 CTTTGCATTCATTCTAGTGGAGG + Intergenic
1121220420 14:92280781-92280803 CGGAGCTTACATTCTAGTGGGGG + Intergenic
1122074739 14:99228799-99228821 TGCAGCTTGCAGTCTGGTGGTGG - Intronic
1124080740 15:26492649-26492671 TGGAGCTTGCATTCTAGTGTGGG - Intergenic
1126846789 15:52767394-52767416 CTCAGCTACCATTCTAGTTCAGG - Intronic
1128159523 15:65414368-65414390 CCAAGTTTGCATTCTAGTTGGGG + Intronic
1132387364 15:101409897-101409919 CTCAGCCTGCATTCTGGGAGGGG + Intronic
1133119517 16:3597479-3597501 CTCTGCTTGCGTTCAGGTGGAGG + Exonic
1133609613 16:7421061-7421083 CTCATCTTGCAGTCTTGTGGCGG + Intronic
1135331640 16:21565065-21565087 CAAAGCTTACATTCTGGTGGAGG - Intergenic
1137303157 16:47173308-47173330 TAGAGATTGCATTCTAGTGGGGG - Intronic
1137464087 16:48692206-48692228 CAGAGCTTGTATTCTAGTGGGGG - Intergenic
1137678092 16:50314182-50314204 CTCAGCCAGGATTTTAGTGGTGG + Intronic
1137771717 16:51021155-51021177 TGGAGTTTGCATTCTAGTGGGGG + Intergenic
1140217309 16:73018892-73018914 CTCTGCTTGCACCCTAGTGTTGG + Intronic
1143280045 17:5747076-5747098 CGGAGCTTGGATTCTAGTAGCGG - Intergenic
1143299308 17:5897986-5898008 ATGAGCTTACATTCTATTGGAGG + Intronic
1143660384 17:8320982-8321004 CTCAGCCTGCATTAGGGTGGGGG - Exonic
1144133604 17:12271398-12271420 TGGGGCTTGCATTCTAGTGGAGG - Intergenic
1144742248 17:17590541-17590563 CTGAGCTTTCATTCTAGGGAGGG - Intronic
1145813278 17:27777718-27777740 TGGAGCTTACATTCTAGTGGGGG + Intronic
1146133733 17:30300003-30300025 TGGTGCTTGCATTCTAGTGGGGG + Intergenic
1146208634 17:30924757-30924779 CAGAGCTTACATTCTAGTGTGGG + Intronic
1146895644 17:36539754-36539776 CAGAGCTTGCAATCTAGTGGAGG + Intronic
1147221490 17:38934558-38934580 GTCAGCTTGCTTTTTATTGGTGG + Intergenic
1148965319 17:51430008-51430030 CAGAGCTTGCATTCTGGTAGGGG + Intergenic
1150777670 17:68094654-68094676 CTCAGCTTTCAATCAAGTTGGGG + Intergenic
1151121349 17:71796676-71796698 CAGAGCTGACATTCTAGTGGTGG - Intergenic
1151550511 17:74820018-74820040 CTCAGCTTGCCTTTTACTGCTGG + Intronic
1152545807 17:80999617-80999639 CTCAGCTTCCCTGCTGGTGGGGG + Exonic
1154122848 18:11665511-11665533 CTCAGCTTGCATTCTTGTCAGGG - Intergenic
1156174107 18:34521898-34521920 TGCAGCTTACATTGTAGTGGGGG - Intronic
1157699943 18:49755933-49755955 CTGAGCTTACATTCAAATGGAGG - Intergenic
1157751091 18:50179156-50179178 CTCTGCCTACATTCTGGTGGTGG - Intronic
1158842822 18:61406498-61406520 TACAGCTTGCATTGTAGTGGAGG + Intronic
1159244205 18:65783814-65783836 CACAGTTTACATTCTAGTGAGGG + Intronic
1161858116 19:6777370-6777392 AGGAGCCTGCATTCTAGTGGGGG + Intronic
1162850939 19:13430714-13430736 TGGAGCTGGCATTCTAGTGGGGG + Intronic
1165069022 19:33244835-33244857 TTCAGCTTGCAGCCTAGTGTGGG - Intergenic
1168487645 19:56778155-56778177 TAGAGCTTGCATTCTAATGGGGG - Intronic
924977998 2:195498-195520 CTCTGTTTGAATTCTGGTGGAGG - Intergenic
925290360 2:2743988-2744010 CTGAGCTTGCATTCTGGTAGGGG - Intergenic
928367365 2:30713144-30713166 CTCACCCAGCATTTTAGTGGTGG + Intergenic
931167008 2:59759021-59759043 CTCAGCCTACATTCTAGTGCTGG - Intergenic
931519997 2:63085519-63085541 CTCAGCTTGAATGTTATTGGAGG + Intergenic
931653740 2:64491278-64491300 CAGAACTTACATTCTAGTGGTGG + Intergenic
933206836 2:79515996-79516018 CTCAGCTTACAGTCTAGTTGAGG + Intronic
933855027 2:86404509-86404531 CTCAGCTTGCACTCATGGGGTGG + Intergenic
935319111 2:101868094-101868116 CTCAGCTTGTATTCGAGCTGCGG + Intronic
936502996 2:113081279-113081301 TGGATCTTGCATTCTAGTGGAGG - Intergenic
936889719 2:117354984-117355006 CTCAGATGACATTCTAGTGGAGG + Intergenic
937140962 2:119599791-119599813 CACAGTTTACATTCTAGTGGGGG - Intronic
937229156 2:120387252-120387274 TCCAGTTTGCACTCTAGTGGGGG + Intergenic
937975647 2:127580839-127580861 CACAGCTTCCATTTTGGTGGGGG + Intronic
938846179 2:135211496-135211518 CTCAGGTTGCAGTGCAGTGGCGG - Intronic
939326881 2:140702991-140703013 TTGAGCTTACAGTCTAGTGGGGG - Intronic
940144627 2:150533326-150533348 CCCAGCTTCCATTCCAGTAGAGG + Intronic
940461852 2:153974546-153974568 TGGAGCTTGCATGCTAGTGGAGG + Intronic
945154228 2:206821298-206821320 CAGATCTTGCATTCTACTGGAGG + Intergenic
946202396 2:218078124-218078146 TGGAGCTTGCATTCTAGTGGAGG + Intronic
946952431 2:224892021-224892043 GGAAGCTTGCATTCTAGGGGAGG + Intronic
947422351 2:229952504-229952526 CTCAGCTTTCAATCAAGTTGGGG + Intronic
947679383 2:232016356-232016378 TTCAGCTTGCAGCCCAGTGGTGG + Intronic
1170785860 20:19466955-19466977 CTGAGCTTGCATTCTAGTTAGGG + Intronic
1170843142 20:19940173-19940195 CAGAGCTTACCTTCTAGTGGTGG - Intronic
1171097017 20:22342194-22342216 CTCAGCTTGCATGCATGTGCAGG - Intergenic
1172149984 20:32783547-32783569 CTCAGCTTCCATTCTCTTGGTGG + Intronic
1173020621 20:39265053-39265075 CCCTGCTTGCAGTCTAGTGGGGG + Intergenic
1173738562 20:45379093-45379115 TCAAGCTTACATTCTAGTGGAGG + Intronic
1174714218 20:52739511-52739533 TGGAGCTTGCATTCTACTGGGGG + Intergenic
1175152213 20:56943977-56943999 GGAAGCTTGCATTCTAGTGGAGG - Intergenic
1178389408 21:32185888-32185910 TTCATCCTGCATTCTAGTGCAGG + Intergenic
1182001274 22:26921827-26921849 CTCACCCTGCATTCTACTGCTGG + Intergenic
1182807237 22:33083559-33083581 CTCAGCTTACATTTCAGTAGGGG + Intergenic
1183671977 22:39278316-39278338 CTCAGCTTCCCTTCTGGTGGAGG + Intergenic
1183674915 22:39293793-39293815 TACACCTTCCATTCTAGTGGGGG - Intergenic
1183908691 22:41062320-41062342 CTGATGTTGCATTCCAGTGGAGG + Intergenic
1184835448 22:47018405-47018427 CTCAGATTGCATTAAAATGGGGG - Intronic
949754004 3:7388083-7388105 CTCAGCTTGAATGTTATTGGTGG + Intronic
949840968 3:8319541-8319563 CTTGGCTTGGATTATAGTGGTGG - Intergenic
950687638 3:14629937-14629959 GTCAGCTTACATTCAAGTGACGG - Intergenic
951481553 3:23167271-23167293 TAGAGCTTACATTCTAGTGGGGG - Intergenic
954886985 3:53883393-53883415 CGGAGCTTACATTCTAGTGTGGG - Intergenic
956011738 3:64839043-64839065 GTGAGCTTCCATTCCAGTGGAGG + Intergenic
956897954 3:73683057-73683079 GAGAGCTTGCATTCTAGTGAGGG + Intergenic
957122783 3:76117732-76117754 CGAAGCTTACATTCTAGTGGGGG + Intronic
958076652 3:88690058-88690080 CTCAGCTTCCATCCCAGGGGAGG - Intergenic
959316378 3:104812977-104812999 CTCAGCTTGAATGTTATTGGTGG - Intergenic
959383205 3:105667962-105667984 CTGAGCTTGCCTTCTAGATGAGG - Intronic
959672136 3:108990657-108990679 CAGAGCTTCCATTCTAGTTGGGG - Intronic
959678578 3:109066239-109066261 TGGAGCTTACATTCTAGTGGGGG - Intronic
960056904 3:113282370-113282392 GTCAGCTTGCATGCTAGGGCTGG + Intronic
960334319 3:116397522-116397544 CGAAGCTTGCATTGTAGTGTAGG - Intronic
962186949 3:133270258-133270280 CTCAGCTTGCATTCTAGTGGTGG - Intronic
964004889 3:151815073-151815095 CACAGTTGACATTCTAGTGGTGG + Intronic
965736024 3:171822098-171822120 AGTAGTTTGCATTCTAGTGGGGG + Intergenic
966268938 3:178081745-178081767 CTGAGGTTCCATTCTGGTGGGGG - Intergenic
967231482 3:187341660-187341682 ATCAGCTTTCTTTCTAATGGTGG + Intergenic
967687961 3:192439584-192439606 CTGAGCTTACAATCTAGTGGTGG + Intronic
969111960 4:4849824-4849846 CTCAGCTTCCTTTTCAGTGGAGG + Intergenic
970953866 4:21787876-21787898 CAGAGCTGACATTCTAGTGGGGG + Intronic
971191800 4:24435566-24435588 TGGAGCTTGCAATCTAGTGGAGG - Intergenic
972408416 4:38767573-38767595 AAGAGTTTGCATTCTAGTGGGGG + Intergenic
972474613 4:39438629-39438651 TGCAGCTTGCATTCTAGTAGGGG - Intronic
972774545 4:42229094-42229116 TGAAGCTTGCATTCTAGTAGAGG - Intergenic
972835845 4:42869049-42869071 TGCATCTTGCATTCCAGTGGGGG + Intergenic
973342436 4:49019149-49019171 CAGAGTTTGCATTCTAGTAGGGG + Intronic
977231491 4:94455814-94455836 CTCAGCTCACTTTCTGGTGGAGG + Intronic
978889567 4:113807781-113807803 CTCAGCTTTTATTCCAGTGTTGG - Intergenic
981301292 4:143188774-143188796 ATAGGCTTGCATTCTAGTTGGGG + Intronic
985426116 4:189832303-189832325 GCCAGCTTGGATTCTAGTGACGG + Intergenic
985599429 5:818816-818838 CCCAGCATGGATTATAGTGGTGG - Intronic
989480075 5:41920500-41920522 CAGAGCTTATATTCTAGTGGAGG + Exonic
989507713 5:42246588-42246610 AGAAGCTTACATTCTAGTGGGGG - Intergenic
990380357 5:55216955-55216977 TGAAGCATGCATTCTAGTGGGGG - Intergenic
991022632 5:61996382-61996404 GTCAGCTTGCACTACAGTGGGGG - Intergenic
991132128 5:63134628-63134650 CTGAGCTTAAATTCTAGTGGGGG + Intergenic
991520954 5:67495888-67495910 CTCAGCATGCAGGCTACTGGGGG + Intergenic
992062961 5:73075126-73075148 CTGAGCTTGCATTATAGTGAGGG + Intronic
992744513 5:79806077-79806099 AGGAGCCTGCATTCTAGTGGAGG + Intergenic
993189703 5:84666589-84666611 CTGAGCTTACATTTTATTGGAGG + Intergenic
994750799 5:103734517-103734539 CAAAGCTTGCATTCCAGTGTAGG - Intergenic
994851639 5:105061726-105061748 CACAGCTTACATTCCAGTTGTGG - Intergenic
995493341 5:112715281-112715303 CTGAGCTTAAATTTTAGTGGGGG + Intronic
995848523 5:116520346-116520368 TAGAGCTTACATTCTAGTGGAGG - Intronic
996266157 5:121543206-121543228 CTCAGCTTGCAGCCTAATGGGGG + Intergenic
996381061 5:122863077-122863099 AGGAGCTTGCATTCTAGTTGGGG + Intronic
996606904 5:125334162-125334184 CTCAGCCTGCAGTCTATTGTGGG - Intergenic
997698367 5:135879170-135879192 CTGAGCATGCATCCTAGTGATGG + Intronic
998079695 5:139264426-139264448 TGGAGCTTACATTCTAGTGGAGG - Intronic
998210570 5:140194219-140194241 CACAGCCTACAGTCTAGTGGAGG + Intronic
999525521 5:152402045-152402067 CTGAGCTTACAGTCTAGTTGGGG + Intronic
999686425 5:154107431-154107453 TTCATCTTGCATTCTAGCGGAGG - Intronic
1001666977 5:173441339-173441361 AGGAGCTTGCATTCTAGTGTGGG - Intergenic
1001703065 5:173721367-173721389 ATAAGCTTGCATTCCAGGGGAGG - Intergenic
1004149240 6:13099309-13099331 TACAACTTGCATTCTACTGGAGG - Intronic
1007428691 6:41763883-41763905 CAAAGCTTGCAGTCTAGTTGGGG - Intergenic
1007705653 6:43789503-43789525 TGGAGCTTGCATTCTAGTTGGGG - Intergenic
1008721755 6:54362368-54362390 CTCTGCATGCATTCTAGAAGTGG + Intronic
1008766662 6:54925334-54925356 TGAAGCTTACATTCTAGTGGGGG - Intronic
1010392010 6:75348737-75348759 CTTAGCTTGCTTTCTATTTGGGG - Intronic
1011607527 6:89118777-89118799 CTGAGCTTACATTCTAGAGGGGG + Intergenic
1012706851 6:102542250-102542272 CTCAGCTTGGATTTTGTTGGTGG + Intergenic
1013702397 6:112789088-112789110 CTCATCTTGCATTTTATTTGAGG - Intergenic
1014410141 6:121105616-121105638 CTCAGCTTGGTTTCTACTGTCGG - Intronic
1014627809 6:123751067-123751089 CAGAGTTTACATTCTAGTGGGGG + Intergenic
1015556010 6:134462357-134462379 CCCAGCCTGGAGTCTAGTGGTGG + Intergenic
1017228246 6:152044493-152044515 CTCAGCTTGCAGACTATTGTGGG - Intronic
1017442832 6:154479632-154479654 CTCGTCTTGAATTGTAGTGGGGG - Intronic
1017934918 6:158997117-158997139 ATCTGCTTGCCTTCTAGTGAGGG - Intronic
1018045529 6:159962793-159962815 CCCAACTTGCATACTAGTGCAGG - Intergenic
1018853013 6:167654789-167654811 CTCAGTTTGCTATCTAGTGCGGG - Intergenic
1021537296 7:21720290-21720312 CTCTGCATCCATTCCAGTGGTGG + Intronic
1022078467 7:26996956-26996978 CTCAGCTTGCAGCCTATTGTGGG + Intergenic
1022174935 7:27863594-27863616 CAGAGCTTGCATTCCAGTGCTGG - Intronic
1023760362 7:43460114-43460136 CTAAGATTGCCTTATAGTGGAGG + Intronic
1024868001 7:53925908-53925930 CGGAGCTTGCACTCTAGTGGGGG - Intergenic
1026371364 7:69702942-69702964 TCCTGCTTGCATTCTAGTTGAGG + Intronic
1026861576 7:73793478-73793500 CTCAGTTTGGATTGGAGTGGGGG + Intergenic
1028311597 7:89344560-89344582 CCGAGCTTCCATTTTAGTGGAGG + Intergenic
1028538013 7:91910830-91910852 TGGAGCTTACATTCTAGTGGGGG + Intergenic
1029008412 7:97233331-97233353 CTCAGCTTGCTGTTTAGTGCAGG - Intergenic
1029935802 7:104423044-104423066 TGGAGCTTGCATTCTAGTGAGGG + Intronic
1030545398 7:110888819-110888841 CAAAGACTGCATTCTAGTGGAGG - Intronic
1032123851 7:129176435-129176457 CTAAGTTTACATTCTACTGGAGG + Intergenic
1033355539 7:140596013-140596035 CTCAGCTTGCATTCTGTTATCGG + Intronic
1033437872 7:141350380-141350402 CAGACCTTACATTCTAGTGGGGG - Intronic
1034270949 7:149803217-149803239 CCCAGCTCGCAGTCTGGTGGGGG - Intergenic
1035247973 7:157577407-157577429 CAAAGCATGCATTCTAGTGCTGG + Intronic
1036707684 8:11057314-11057336 GCAAGCTTACATTCTAGTGGGGG - Intronic
1039576497 8:38628016-38628038 ATAAGCTTGTATTCTACTGGGGG + Intergenic
1039622330 8:39009875-39009897 TGGAGCTTGCATTCTAGTGATGG + Intronic
1042075900 8:64994280-64994302 CCCAGCTTCCATTCTCGTAGAGG - Intergenic
1042204224 8:66312296-66312318 TAGAGCTTGCATTCTAGTGGGGG - Intergenic
1043038416 8:75228272-75228294 GGGAGCTTACATTCTAGTGGAGG + Intergenic
1044293990 8:90506101-90506123 CTCAGCTTGCAGACTATTGTGGG + Intergenic
1044294087 8:90506866-90506888 CTCAGCTTGCAGACTATTGTGGG + Intergenic
1045243628 8:100423957-100423979 CAGAGCTTACATTTTAGTGGGGG + Intergenic
1045531967 8:102993819-102993841 CTCACCTTGCATAGTAGTGTAGG - Intergenic
1046278861 8:111998193-111998215 TTGAGCTTACATTCTAGTGGTGG - Intergenic
1047237228 8:123052458-123052480 TGCAGCTTGCATTCTAGCTGGGG - Intronic
1048239110 8:132723638-132723660 ATGAGCTTGCAGTTTAGTGGGGG - Intronic
1048746659 8:137621922-137621944 CGGAGCTTGCAGTCTAGGGGAGG + Intergenic
1049138144 8:140924402-140924424 CGGAGCTTGCATTGTAGTGGGGG - Intronic
1049268485 8:141681961-141681983 CTCTGCTTCCCTTCAAGTGGGGG + Intergenic
1050068562 9:1786630-1786652 CAGAGTTTACATTCTAGTGGGGG - Intergenic
1050217163 9:3339684-3339706 TGAAGCTTACATTCTAGTGGGGG + Intronic
1050656419 9:7833421-7833443 TAGAGCTTACATTCTAGTGGAGG - Intronic
1057642276 9:96835950-96835972 CTGAGATTGCATGCTACTGGTGG - Intronic
1057846196 9:98526613-98526635 AGGAGCTTACATTCTAGTGGGGG - Intronic
1059369580 9:113816502-113816524 TGGAGCTTGCATTCTAGAGGAGG - Intergenic
1061206796 9:129168900-129168922 TAGAGCTTACATTCTAGTGGTGG - Intergenic
1061664002 9:132149775-132149797 TGCAGCTTGCAGTCTGGTGGAGG + Intergenic
1062155211 9:135044394-135044416 TTAAGCTTGCATTCTATTGGAGG + Intergenic
1186788425 X:12974630-12974652 CTCAGCTTTCAGTCCAGTGGCGG - Intergenic
1187498031 X:19813222-19813244 CTCAGCTTTCTTTCTAGCAGAGG + Intronic
1189229747 X:39443090-39443112 CGGAGCCTACATTCTAGTGGGGG + Intergenic
1189410518 X:40766400-40766422 TAGAGCTTGCATTCCAGTGGGGG - Intergenic
1191925172 X:66301304-66301326 CAGAACTTACATTCTAGTGGAGG - Intergenic
1192372256 X:70524197-70524219 AAGAGCTTACATTCTAGTGGGGG - Intergenic
1195009461 X:100721407-100721429 TACAGCTTACAATCTAGTGGGGG - Intronic
1195405733 X:104511254-104511276 GTGAGCTTACATTCTAGTGAAGG - Intergenic
1195761230 X:108248659-108248681 ATGAGCTTGCTTTCTAGTTGTGG - Intronic
1196172799 X:112608528-112608550 CGAAGCTTACATTCTAGTGTGGG - Intergenic
1197181488 X:123541629-123541651 CAGAGCTTCCATTCTAGTGGAGG + Intergenic
1198256783 X:134931063-134931085 TGCAGCTTACATTCTAGAGGAGG - Intergenic
1199084706 X:143615437-143615459 CGGAGCTTACAATCTAGTGGAGG - Intergenic
1199412947 X:147546256-147546278 GTAAGCTTGCATTCTAATGAAGG - Intergenic
1199444668 X:147908533-147908555 CTGAGCTTACACTCTAGTGAGGG + Intergenic
1199654153 X:149978199-149978221 TATAGCTTACATTCTAGTGGGGG - Intergenic
1199871075 X:151899490-151899512 CTTGGCTTGCAGTCTAATGGTGG - Intergenic
1199967532 X:152832329-152832351 GACAGCCTGCCTTCTAGTGGAGG - Intronic
1201411338 Y:13702448-13702470 CTCAGCTTTCAGACCAGTGGAGG - Intergenic