ID: 962191487

View in Genome Browser
Species Human (GRCh38)
Location 3:133315525-133315547
Sequence CTCTTTATGGAATCTGTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 346}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962191487_962191489 -10 Left 962191487 3:133315525-133315547 CCAAACACAGATTCCATAAAGAG 0: 1
1: 0
2: 0
3: 27
4: 346
Right 962191489 3:133315538-133315560 CCATAAAGAGCCAGACAAGATGG 0: 1
1: 0
2: 0
3: 14
4: 204
962191487_962191490 -9 Left 962191487 3:133315525-133315547 CCAAACACAGATTCCATAAAGAG 0: 1
1: 0
2: 0
3: 27
4: 346
Right 962191490 3:133315539-133315561 CATAAAGAGCCAGACAAGATGGG 0: 1
1: 0
2: 0
3: 18
4: 192
962191487_962191491 -8 Left 962191487 3:133315525-133315547 CCAAACACAGATTCCATAAAGAG 0: 1
1: 0
2: 0
3: 27
4: 346
Right 962191491 3:133315540-133315562 ATAAAGAGCCAGACAAGATGGGG 0: 1
1: 0
2: 1
3: 17
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962191487 Original CRISPR CTCTTTATGGAATCTGTGTT TGG (reversed) Intronic
900696892 1:4017814-4017836 CTCTTTGTGGAATCTGGATGGGG + Intergenic
901884035 1:12210231-12210253 CTCTTTATGGAATAAGTGTGGGG - Intergenic
902751954 1:18522108-18522130 TTCTTTATGGAATCTCTATGAGG + Intergenic
903486842 1:23695859-23695881 CTCTTTGCTGATTCTGTGTTTGG - Exonic
904927751 1:34061985-34062007 CTGTGTATGGGATCTGTGTATGG + Intronic
907190945 1:52648397-52648419 CTCTTTATGGTAACTGGGTAGGG + Intronic
907622079 1:55991788-55991810 CCCTTTATGGTAGCTGGGTTTGG - Intergenic
912777454 1:112514738-112514760 AGCTTTATGGAATGTGGGTTAGG + Intronic
915685513 1:157628382-157628404 TTTTTTATGAAATCAGTGTTCGG - Intergenic
915792093 1:158683596-158683618 CTCTTTATGGCCTCTGAGTCTGG - Intronic
916188159 1:162152881-162152903 CTCTTAATGGAATCTTTGCTTGG + Intronic
916354589 1:163890644-163890666 CTTTTTTTGGAATATGTGATAGG - Intergenic
917637632 1:176952545-176952567 CTCCTTAAAGAATGTGTGTTCGG - Intronic
920013456 1:202886978-202887000 CTCTTTTGGGAAGCTGAGTTGGG - Intronic
920779651 1:208976243-208976265 CTCTTAATGGAAGGTGTGTCAGG - Intergenic
921424377 1:214985028-214985050 CCCATTATGGACTCTGTGTGGGG - Intergenic
1064393972 10:14965481-14965503 GTGTGCATGGAATCTGTGTTAGG + Intronic
1066787487 10:39021442-39021464 CTTTTTGGGGAATCTGTGTAAGG - Intergenic
1066795763 10:39118791-39118813 CTCTTTGTAGAATCTGTGAAGGG + Intergenic
1066808769 10:39296142-39296164 CTCTTTGTAGAATATGTGATTGG - Intergenic
1066811971 10:39351217-39351239 CTTTTTATGGAATCTGCAATGGG - Intergenic
1066816151 10:39416821-39416843 CTTTTTACGGAATCTGTATGTGG + Intergenic
1069251322 10:66270697-66270719 CTCTATATAGGATCTGTGTAGGG + Intronic
1070187143 10:74075453-74075475 CTTTTTCTGGAATCTCTTTTAGG + Intronic
1070208110 10:74284740-74284762 GTCTGTATGGAATGTGTATTTGG + Intronic
1071089732 10:81904347-81904369 ATCCTCATGGAATCTGAGTTTGG + Intronic
1071960469 10:90804778-90804800 CTCTTTTTGGATCCTGTCTTGGG + Intronic
1072141950 10:92596876-92596898 CTCTTTGTTGATTCTGTGTTTGG + Intronic
1073726915 10:106243387-106243409 CTCTTTAGGAAGTCTGTCTTTGG + Intergenic
1075221942 10:120592613-120592635 CTCTTGGGGGAATATGTGTTTGG - Intergenic
1078160205 11:8833427-8833449 GATTTTATGGAATCTGTATTAGG - Intronic
1078874817 11:15382539-15382561 TTCATTTTGGAAACTGTGTTTGG + Intergenic
1079886812 11:26000695-26000717 CTCAGTAGGGACTCTGTGTTGGG + Intergenic
1082155789 11:48809909-48809931 CTTTTTATGGAATCTGTAAGTGG + Intergenic
1082290714 11:50366680-50366702 TTCTTTATAGAATCTGTGAAGGG + Intergenic
1082291167 11:50373104-50373126 GTTTTTGTGGAATCTGTGTAAGG + Intergenic
1082299289 11:50486969-50486991 CTTTTTTTGGATTCAGTGTTTGG - Intergenic
1082302783 11:50530324-50530346 GTTTTTATGGAATCTGTGAAAGG + Intergenic
1082335154 11:51276216-51276238 CTTTTTATAGAATCTGCGATTGG + Intergenic
1082339826 11:51344225-51344247 CTTTTTGTAGAATCTGTGATTGG + Intergenic
1082350532 11:51499611-51499633 CTTTTTGTAGAATCTGTGATTGG + Intergenic
1082352409 11:51526824-51526846 CTTTTTGTAGAATCTGTGATTGG + Intergenic
1082352761 11:51531924-51531946 CTTTTTGTAGAATCTGTGATTGG + Intergenic
1082363482 11:51688352-51688374 CTTTTTGTGGAATCTGCGATTGG + Intergenic
1082365931 11:51724060-51724082 CTTTTTGTAGAATCTGTGATTGG + Intergenic
1082370852 11:51795464-51795486 CTTTTTGTAGAATCTGTGATTGG + Intergenic
1082370910 11:51796314-51796336 CTTTTTGTAGAATCTGTGATTGG + Intergenic
1082374955 11:51854974-51854996 CTTTTTGTAGAATCTGTGATTGG + Intergenic
1082376528 11:51877923-51877945 CTTTTTGTAGAATCTGTGATTGG + Intergenic
1082380410 11:51934024-51934046 CTTTTTGTAGAATCTGTGATTGG + Intergenic
1082384488 11:51993656-51993678 CTTTTTGTAGAATCTGTGATTGG + Intergenic
1082391065 11:52089722-52089744 CTTTTTGTAGAATCTGTGATTGG + Intergenic
1082393639 11:52127125-52127147 CTTTTTGTAGAATCTGTGATTGG + Intergenic
1082395588 11:52155324-52155346 CTTTTTGTAGAATCTGTGATTGG + Intergenic
1082400007 11:52219074-52219096 CTTTTTGTGGAATCTGCGATTGG + Intergenic
1082401869 11:52246273-52246295 CTTTTTGTAGAATCTGTGATTGG + Intergenic
1082407563 11:52328534-52328556 CTTTTTGTAGAATCTGCGTTTGG + Intergenic
1082416605 11:52458802-52458824 CTTTTTGTGGAATCTGCGATTGG + Intergenic
1082417658 11:52474100-52474122 CTTTTTGTGGAATCTGCGATTGG + Intergenic
1082430332 11:52657699-52657721 CTTTTTGTGGAATCTGCGATTGG + Intergenic
1082437998 11:52768206-52768228 CTTTTTGTGGAATCTGCGATTGG + Intergenic
1082438756 11:52779258-52779280 CTTTTTGTAGAATCTGCGTTTGG + Intergenic
1082442182 11:52828525-52828547 CTTTTTGTGGAATCTGCGATTGG + Intergenic
1082444076 11:52855730-52855752 CTTTTTGTAGAATCTGTGATTGG + Intergenic
1082455646 11:53024054-53024076 CTTTTTGTGGAATCTGCGATTGG + Intergenic
1082457033 11:53044455-53044477 CTTTTTATAGAATCTGCGATTGG + Intergenic
1082461092 11:53103110-53103132 CTTTTTGTAGAATCTGTGATTGG + Intergenic
1082462632 11:53125207-53125229 CTTTTTGTAGAATCTGTGATTGG + Intergenic
1082470017 11:53231693-53231715 CTTTTTGTAGAATCTGTGATTGG + Intergenic
1082470670 11:53241045-53241067 CTTTTTGTAGAATCTGTGATTGG + Intergenic
1082478447 11:53354109-53354131 CTCTTTGTAGAATCTGCGATTGG + Intergenic
1082487324 11:53481623-53481645 CTTTTTGTAGAATCTGTGATTGG + Intergenic
1082487971 11:53490974-53490996 CTTTTTGTGGAATCTGCGATTGG + Intergenic
1082498469 11:53641891-53641913 CTTTTTGTAGAATCTGTGATTGG + Intergenic
1082500975 11:53678111-53678133 CTTTTTGTAGAATCTGTGATTGG + Intergenic
1082512834 11:53849864-53849886 CTTTTTGTAGAATCTGTGATTGG + Intergenic
1082514779 11:53877921-53877943 CTTTTTGTAGAATCTGTGATTGG + Intergenic
1082524021 11:54011747-54011769 CTTTTTGTAGAATCTGTGATTGG + Intergenic
1082538581 11:54222430-54222452 CTTTTTGTAGAATCTGTGATTGG + Intergenic
1082539574 11:54236882-54236904 CTTTTTGTAGAATCTGTGATTGG + Intergenic
1082539693 11:54238582-54238604 CTTTTTGTGGAATCTGCGATTGG + Intergenic
1082541051 11:54258305-54258327 CTTTTTGTAGAATCTGTGATTGG + Intergenic
1082542349 11:54277014-54277036 CTTTTTGTAGAATCTGTGATTGG + Intergenic
1082542521 11:54279565-54279587 CTTTTTGTAGAATCTGTGATTGG + Intergenic
1083160070 11:60849213-60849235 CTCTAGATGGAGTCTGTCTTGGG - Intronic
1085300247 11:75453862-75453884 CTCTTTTTGGAAGCTATTTTGGG - Intronic
1087299537 11:96415842-96415864 TTGTTTATGCAATCAGTGTTTGG + Intronic
1087978060 11:104575166-104575188 TTCTTTATGGAATCTGTCACTGG - Intergenic
1088122351 11:106385281-106385303 TGCTTTATGTAATTTGTGTTAGG + Intergenic
1089135499 11:116245887-116245909 CTCTTTCTGGGCTCTGTGTGAGG + Intergenic
1090849670 11:130561241-130561263 CCCTTTATGGAATATTTGTTGGG + Intergenic
1093324724 12:17759883-17759905 CCCAGTAGGGAATCTGTGTTGGG + Intergenic
1094876362 12:34648525-34648547 GTCTCTGTGGAATCTGTGTAGGG + Intergenic
1095061517 12:37698158-37698180 CTTTTTGTGGAATCTGTAATTGG - Intergenic
1095072034 12:37864569-37864591 CTTTTTGTGGAATCTGTGAAGGG - Intergenic
1095075445 12:37916232-37916254 GTTTTTATAGAATCTGTGTAGGG - Intergenic
1095080994 12:37999304-37999326 CTTTTTATAGAATCTGTGAGGGG + Intergenic
1095381689 12:41602119-41602141 CTCTGTATTTATTCTGTGTTGGG + Intergenic
1099692533 12:85977020-85977042 CTCTTTACTAAACCTGTGTTTGG - Exonic
1101741807 12:107506272-107506294 CTCTTTATGGGTTCTGAGTTTGG - Intronic
1102625406 12:114231682-114231704 CTCTTTGTGGCTTCTTTGTTTGG - Intergenic
1102695150 12:114792994-114793016 GTCTTTATGGAATTTGTTTCTGG - Intergenic
1103000538 12:117382327-117382349 CTCTTTATTGAGACTCTGTTAGG - Intronic
1103394021 12:120594069-120594091 CTCTTTGCTGATTCTGTGTTTGG + Intergenic
1106789287 13:33138482-33138504 TTCTTTATGGAATGTCTGGTTGG - Intronic
1109237582 13:59843566-59843588 CTCTTTATGAAATGTCTGTGAGG - Intronic
1109948040 13:69463636-69463658 CCCTTTATGGATTCTTTCTTAGG - Intergenic
1112368717 13:98776304-98776326 CTATCTCTGGAATCAGTGTTCGG - Intergenic
1112810367 13:103211504-103211526 CTATTTATGGAATTTTGGTTGGG + Intergenic
1113583206 13:111443571-111443593 GTCTGCATGGAATTTGTGTTTGG + Intergenic
1113999171 14:16133525-16133547 CTATTTATGGAATCTGCTTGTGG - Intergenic
1114512468 14:23274228-23274250 CTCTTGATAGGATCTGTCTTAGG - Exonic
1115232086 14:31171683-31171705 GTTTTTATTGAATCTGTATTAGG + Intronic
1115418945 14:33170024-33170046 TGCTTTATGGAATCTTTGCTGGG + Intronic
1117170699 14:53092121-53092143 CTCTTTATGGTTTCTGGCTTTGG - Intronic
1119217498 14:72880406-72880428 CCCTTTTTGGCATCTGGGTTTGG - Intronic
1121283062 14:92713391-92713413 CCCTTTATGGAAACTGTGCAGGG - Intronic
1122368055 14:101208283-101208305 TTCTTTATTGATTTTGTGTTTGG + Intergenic
1123226436 15:17038731-17038753 CTGTTTATGGAATCTGCTTGTGG + Intergenic
1123305795 15:18420313-18420335 CTTTTTGTGGAATCTGTAATTGG + Intergenic
1123315345 15:18579324-18579346 CTTTTTGTGGAATCTGCATTTGG + Intergenic
1123367811 15:19450101-19450123 CTTTTTGTGGAATCTGCATTTGG + Intergenic
1124686468 15:31786882-31786904 CTCATTATGAAATGTGTGTGAGG + Intronic
1125297526 15:38219279-38219301 ATCTTTATGGAATATATTTTAGG - Intergenic
1130042745 15:80418634-80418656 CTCTCTATGGATCCTCTGTTGGG + Intronic
1136916771 16:34211053-34211075 CTTTTTGTAGAATCTGTGTGTGG - Intergenic
1136919759 16:34256300-34256322 CTTTTTGTGGAATCTGCGATTGG + Intergenic
1137694946 16:50455313-50455335 CTCTTTCTGGAGGCTTTGTTTGG + Intergenic
1138688085 16:58743788-58743810 CTCTATATTGAACATGTGTTGGG + Intergenic
1139762619 16:69198471-69198493 CTCTTTAAGGAGTTTGTGTGTGG + Intronic
1141491749 16:84378464-84378486 CTTTTTGTGGAAGCTGTGTTGGG + Intronic
1141811551 16:86379431-86379453 CACCTTATGGCATCTGTGTCTGG - Intergenic
1143509243 17:7386454-7386476 CTCTGTATGTAGTCTGTGCTGGG - Intronic
1144397996 17:14864368-14864390 CTGTTTATGGAAACTGTAATTGG + Intergenic
1145729761 17:27167842-27167864 CTCTTTGTGGAATCTATGAAGGG + Intergenic
1150975010 17:70075440-70075462 CTCTTGCTGGCATCTGTGTTTGG + Intronic
1151254237 17:72863274-72863296 CTCTTCTTGGAATCTCTTTTAGG + Intronic
1154912504 18:20674399-20674421 CTTTTTATGGAATCTGTAAGTGG + Intergenic
1154922129 18:20823123-20823145 CTTTTTATGGAATCTGTAAGTGG - Intergenic
1156466207 18:37349146-37349168 CACTTCATGGAAACAGTGTTCGG + Intronic
1156649512 18:39208465-39208487 GTCTTTCTGGTGTCTGTGTTTGG + Intergenic
1158830622 18:61273986-61274008 CTCGTCTTCGAATCTGTGTTTGG - Intergenic
1159540957 18:69775225-69775247 TTCTTTAGGGAATTTTTGTTTGG - Intronic
1164327026 19:24203089-24203111 CTTTTTATAGAATCTGTGAAGGG - Intergenic
1164335648 19:24317225-24317247 GTTTTTATAGAATCTGTGATTGG + Intergenic
1164348734 19:27304064-27304086 CTTTTTATAGAATCTGCATTTGG + Intergenic
1164359767 19:27492052-27492074 ATTTTTATGGAATCTGTGAAGGG + Intergenic
1164613810 19:29652552-29652574 TTCTTTATGGATTATGTTTTTGG + Intergenic
1165822719 19:38686699-38686721 CTCTTCCTGGACTCTGTGTGGGG + Intronic
1167820716 19:51925305-51925327 CTCTTTATGGGTGTTGTGTTGGG - Intronic
926624877 2:15082792-15082814 CTCCTCCTGGTATCTGTGTTGGG + Intergenic
928609696 2:32980395-32980417 TTCTTTATGCAATCAGTGTTAGG - Intronic
930713294 2:54569746-54569768 TTCTGTGTGGAAACTGTGTTTGG + Intronic
931041460 2:58305378-58305400 CTCAGTGGGGAATCTGTGTTGGG - Intergenic
932170675 2:69552826-69552848 CTTTTTATGGATTGTGCGTTTGG - Intronic
932287126 2:70544703-70544725 CTGTTTATGGAATATCAGTTTGG - Intronic
932568354 2:72923751-72923773 CTAGTTCTTGAATCTGTGTTTGG + Intronic
935139315 2:100338683-100338705 CTCTTTCTGGGATGTGTGTCTGG + Intergenic
936289559 2:111210534-111210556 TTTTTTATGGACTGTGTGTTTGG + Intergenic
937165487 2:119811509-119811531 CACTTTATGTTATCTCTGTTTGG - Intronic
938394671 2:130935077-130935099 CTTTTCATAGAATCTGTTTTTGG + Intronic
939709155 2:145494010-145494032 TTTATTATGGACTCTGTGTTAGG - Intergenic
941787001 2:169508161-169508183 GTCTTCATGGAATTTGTTTTTGG + Intronic
943391430 2:187273993-187274015 TTCTTTATCGAATCGCTGTTGGG + Intergenic
943401162 2:187412402-187412424 CTCATTATGGCATCTGACTTGGG + Intronic
943840956 2:192579987-192580009 CATTTTATGGAATGTGCGTTGGG - Intergenic
946101486 2:217328535-217328557 CTCTTTAAGGGATCTGCTTTAGG - Intronic
946168949 2:217882451-217882473 CTTTTTATGGAATCCTTTTTGGG - Intronic
946754527 2:222930906-222930928 ATCTTTATGTAATCTTAGTTTGG + Intronic
1169640816 20:7749937-7749959 CTCATTAAGAAATCTGTGTTAGG - Intergenic
1171736893 20:28797909-28797931 CTTTTTATAGAATCTGCATTTGG - Intergenic
1175549015 20:59804243-59804265 CTCTGTGTGAAATCTGTGCTAGG - Intronic
1176323736 21:5364701-5364723 CTGTTTATGGAATCTGCTTGTGG + Intergenic
1176481498 21:7298704-7298726 CTGTTTATGGAATCTGCTTGTGG + Intergenic
1176535633 21:8045748-8045770 CTATTTATGGAATCTGCTTGTGG - Intergenic
1177272358 21:18866072-18866094 CTTTTTATGGAATTTGTGAATGG + Intergenic
1179030355 21:37714624-37714646 CTCTTAATCCAATCTGTGTTGGG - Exonic
1179154138 21:38835171-38835193 CTCTTGATGGAAACAGTGTTTGG - Intergenic
1180505378 22:15992866-15992888 CTTTTTGTAGAATCTGTATTTGG - Intergenic
1182368680 22:29795951-29795973 ATTTTTATGGAAGCTCTGTTTGG - Intronic
1203333281 22_KI270739v1_random:29181-29203 CTTTTTGTAGAATCTGTATTTGG + Intergenic
949560487 3:5197223-5197245 GTATCTTTGGAATCTGTGTTGGG - Intronic
950150625 3:10684208-10684230 CCCTTTATGGGATCTGTTTATGG + Intronic
950323744 3:12084028-12084050 CTGTTTATGGCATCTCTGTTAGG + Intronic
953394120 3:42553517-42553539 CTCTTCATGGAAGCTGTGGGAGG - Intronic
955286776 3:57649438-57649460 TTCTTTAAGGAATCTCTGTACGG - Intronic
955305127 3:57822849-57822871 CACTTAAGGAAATCTGTGTTAGG + Intronic
955342221 3:58133770-58133792 CTCTATATAAAATATGTGTTAGG - Intronic
956209176 3:66785798-66785820 GTCTTTCTAGAATCTGTATTTGG + Intergenic
956757945 3:72408033-72408055 CTCCGTATGGCATCTGTGTCAGG - Intronic
956887649 3:73576628-73576650 CTCTTTAAGAAACTTGTGTTTGG - Intronic
957329830 3:78747791-78747813 CTATTTTTGGAATATGTATTTGG - Intronic
957492779 3:80950880-80950902 CTCTTTGTAGAATCTATGATGGG - Intergenic
957492790 3:80951050-80951072 CTTTTTGTAGAATCTATGTTGGG - Intergenic
957493496 3:80960466-80960488 CTGTTTTTGGAATCTATGTAGGG - Intergenic
957739240 3:84242036-84242058 CTTTTTAAGTAATCTGTTTTGGG - Intergenic
958220686 3:90672211-90672233 CTTTTTCTGGAATCTGTGAGTGG - Intergenic
958763463 3:98336164-98336186 CTCTTACTGGAATGTGTCTTTGG + Intergenic
958778935 3:98518807-98518829 CTCTTTTTGGACTATGTTTTTGG - Intronic
959114178 3:102156480-102156502 CTCTTTAAGTAACCTGAGTTTGG + Intronic
959639795 3:108619850-108619872 CTATTTAGGGAAACTGTGTGAGG - Intronic
959841921 3:110986288-110986310 TTCTTTATCCAATCAGTGTTAGG + Intergenic
960352850 3:116614496-116614518 ATCTTTGTGGAATTAGTGTTAGG + Intronic
962191487 3:133315525-133315547 CTCTTTATGGAATCTGTGTTTGG - Intronic
962674725 3:137746621-137746643 CTTTTTATGGATTTTCTGTTCGG - Intergenic
965976413 3:174628863-174628885 CTTTTTAAGGAATATGTGTAAGG + Intronic
969719732 4:8886879-8886901 CTCCTTCTGGGATCTGTCTTGGG - Intergenic
972667056 4:41176230-41176252 CTCTTTATGCTTTCTGTGATTGG - Intronic
972814289 4:42627158-42627180 CTAGTTATGAAATCTGTTTTTGG - Intronic
973314640 4:48747169-48747191 CTCTTCCTGGAATCTTTTTTTGG - Intronic
973406377 4:49743451-49743473 CTTTTTATGGAATCTGAAATTGG + Intergenic
974547250 4:63328337-63328359 CTTTTCATGGAATCTGTGAAGGG - Intergenic
974595903 4:64014306-64014328 CTATTAAAGGATTCTGTGTTGGG - Intergenic
974962215 4:68717873-68717895 CTCTTCATGGTATATGTGTTTGG - Intergenic
975144559 4:70953348-70953370 CTCTTTTTAAAATCTTTGTTAGG - Intronic
976191269 4:82489296-82489318 CTCTCTCTGGGATCTGTGTGGGG + Intronic
976649548 4:87420334-87420356 GTCTTTGAGGAAACTGTGTTGGG + Intergenic
976722338 4:88181072-88181094 TTGTTTATGCAATCAGTGTTAGG + Intronic
977896298 4:102369480-102369502 CCCAGTATCGAATCTGTGTTAGG + Intronic
978192415 4:105929965-105929987 CTCTTTAAGGAATATGGTTTTGG - Intronic
978807866 4:112819424-112819446 GTGTTTCTGGAATCAGTGTTTGG - Intronic
980487774 4:133482391-133482413 CTTTTTATGGAATCTATTTTTGG - Intergenic
981041548 4:140227504-140227526 CTATTTATTTACTCTGTGTTTGG + Intergenic
983722941 4:170880848-170880870 TTCTTCAAGAAATCTGTGTTTGG + Intergenic
983725406 4:170917198-170917220 CTCTTTATTTTATCTGTGTTTGG - Intergenic
985041435 4:185895345-185895367 GTCTTCTTGGATTCTGTGTTGGG - Intronic
986196537 5:5541658-5541680 CTGTTTATGGTACCTGTGCTTGG - Intergenic
987507830 5:18796233-18796255 CTTTTTATAATATCTGTGTTAGG + Intergenic
988357347 5:30195877-30195899 CTTTTTATGGAACCTGTAATTGG + Intergenic
989308909 5:39989882-39989904 CTCTTTATGGACTTTGCTTTTGG + Intergenic
989840008 5:46052605-46052627 GTTTTTGTGGAATCTGTGATGGG + Intergenic
989840338 5:46057923-46057945 GTTTTTGTAGAATCTGTGTTGGG + Intergenic
989855201 5:46277713-46277735 GTTTTTATGGAATCTGTGAAGGG - Intergenic
989943710 5:50189797-50189819 CTTTTTGTAGAATCTGTGTTTGG - Intergenic
989943891 5:50192327-50192349 CTTTTTATGGAATCTGTAAGTGG - Intergenic
989946437 5:50236951-50236973 CTCTTTGTAGAATCTGTGAGTGG - Intergenic
990061641 5:51657507-51657529 CTCTTTAGGGAATATGTATCAGG + Intergenic
991140803 5:63240146-63240168 CTCCATATGAAATCTGTGTGTGG + Intergenic
991220208 5:64205481-64205503 CCATTTGTGCAATCTGTGTTAGG + Intronic
993123388 5:83802354-83802376 TTTTTTATGGAATCTCTCTTGGG + Intergenic
995053542 5:107733642-107733664 CTCTTTATGGATTATGCCTTGGG + Intergenic
995082862 5:108074408-108074430 CTCTTTTTGGATCCTGTTTTGGG + Intronic
995142028 5:108745518-108745540 TTATTTTTTGAATCTGTGTTAGG - Intergenic
995718721 5:115106697-115106719 TTCTTTAAGGAATCTGTATACGG - Intergenic
995764918 5:115603897-115603919 GTGTTTATGGAATCTGTCATTGG - Intronic
996085493 5:119300841-119300863 TTCTTTATGGAATCTATGTGAGG + Intronic
996579975 5:125020883-125020905 CTCTTTATCGGATGTGTCTTTGG - Intergenic
996645364 5:125808468-125808490 CTCTTTCTGGAATCTCTATTAGG - Intergenic
997103113 5:130990349-130990371 CTCTTTGCTGAGTCTGTGTTTGG - Intergenic
997828048 5:137125125-137125147 CACTTAATGGAAGCTGTGTTAGG - Intronic
999826076 5:155274886-155274908 CTCTTTATCGAATCAGTGCAGGG - Intergenic
1000853135 5:166364630-166364652 CTGTCTATGGAAACTATGTTGGG - Intergenic
1001761977 5:174215031-174215053 ATCTTTTTGGTATCTGTGTCTGG + Intronic
1002331635 5:178445775-178445797 TTCTTCATGGCATCTGTCTTTGG - Intronic
1003207045 6:4021818-4021840 CTCTTAGCGGCATCTGTGTTGGG + Intronic
1003392361 6:5724858-5724880 CCCTTTTTGGAATATATGTTAGG + Intronic
1004110367 6:12712326-12712348 TTCTTTCTTGAATATGTGTTTGG + Intergenic
1004191442 6:13467441-13467463 CTCTTTATGGGCTGTGTGTGTGG - Intronic
1004606383 6:17198809-17198831 TTATTTATGGAATATCTGTTTGG + Intergenic
1006089092 6:31617255-31617277 CTCTTCATGAAATCTGTCATGGG - Intergenic
1006169120 6:32082976-32082998 CACTTTCTGGAATCTGGGCTGGG - Intronic
1009250784 6:61295309-61295331 CTTTTTATAGAATCTGTGAAGGG - Intergenic
1009934270 6:70215306-70215328 ATCATTATGTAATCTGTATTTGG - Exonic
1011487644 6:87859437-87859459 CTCTTTCTGGAATGGTTGTTTGG - Intergenic
1011860361 6:91747350-91747372 ATCTATATGGCATCTGTCTTTGG - Intergenic
1012833793 6:104239713-104239735 CTGTTTAAGAAATCTTTGTTGGG - Intergenic
1013379930 6:109558263-109558285 TTCTTTATGGATTCTGCTTTTGG + Intronic
1013723958 6:113069515-113069537 CACTTTATGGATTATGTCTTTGG - Intergenic
1013977641 6:116095270-116095292 CTCTTTATAGAAGCAGAGTTAGG + Intergenic
1014594560 6:123318210-123318232 TTCTTTATTGAATCTATGCTAGG + Intronic
1015940138 6:138441409-138441431 CTTTTTGTTCAATCTGTGTTTGG - Intronic
1016122779 6:140364319-140364341 CCCATTAGGGACTCTGTGTTGGG - Intergenic
1017273307 6:152534957-152534979 CTCTTAATGGAATCTGTTATAGG + Intronic
1018343120 6:162872815-162872837 CTCTTTATGCAAACTGTGCTTGG - Intronic
1021290569 7:18838699-18838721 ATCTTTCTGGCATCTGTGTGTGG + Intronic
1023672782 7:42596821-42596843 CTCTTTTTGGCATCAGTCTTGGG - Intergenic
1024222935 7:47302736-47302758 CTCTTCTTGGCTTCTGTGTTTGG - Intronic
1025521972 7:61746364-61746386 CTTTTTCTAGAATCTGTGATGGG - Intergenic
1025535762 7:61946251-61946273 CTTTTTGTTGAATCTGTGATGGG + Intergenic
1025576937 7:62657234-62657256 CTTTTTGTAGAATCTGTGATGGG - Intergenic
1025583653 7:62752813-62752835 CTTTTTATAGAATCTGTGAAGGG + Intergenic
1026741771 7:72983343-72983365 CTATTTATTTAATTTGTGTTTGG + Intergenic
1026803683 7:73416157-73416179 CTCTTTCTGGAATTTCTATTAGG - Intergenic
1027101964 7:75381734-75381756 CTATTTATTTAATTTGTGTTTGG - Intergenic
1027524345 7:79247762-79247784 TTGTTTATGCAATATGTGTTAGG + Intronic
1028443316 7:90889669-90889691 CTCTTTAGGGAATATGTATGTGG + Intronic
1030494228 7:110277247-110277269 CCCTTTATGACTTCTGTGTTTGG + Intergenic
1031164985 7:118217015-118217037 CACATTGTAGAATCTGTGTTTGG + Intronic
1033445365 7:141416820-141416842 CTCGTTATGTACTCTGTGTCTGG - Intronic
1035368150 7:158361732-158361754 CCCTTGTTGGTATCTGTGTTGGG - Intronic
1036144593 8:6243341-6243363 CTCTTGATTGTATTTGTGTTGGG - Intergenic
1037293182 8:17372974-17372996 CTGTTTCTGGAATGTGTGTTTGG - Intronic
1040112732 8:43577094-43577116 CTCTTTGTAGAATCTGTGAAAGG + Intergenic
1040112864 8:43578824-43578846 CTTTTTAAGGAATCTGTGAAGGG + Intergenic
1040115672 8:43615852-43615874 CTTTTTGTGGAATCTTTGGTTGG + Intergenic
1040118294 8:43650452-43650474 CTTTTTGTGGAATCTGTGAAAGG + Intergenic
1040118419 8:43652008-43652030 CTCTTTGTAGAATCTGTGAAGGG + Intergenic
1040118483 8:43652860-43652882 TTTTTTATAGAATCTGTGTAGGG + Intergenic
1040121988 8:43693927-43693949 CTTTTTATAGAATCTGTGAAGGG + Intergenic
1040124219 8:43718476-43718498 CCTTTTATGGAATCTGTGAAGGG + Intergenic
1040131208 8:43798809-43798831 CTTTTTGTAGAATCTGTGATGGG + Intergenic
1040134635 8:43838518-43838540 CTTTTTGAGGAATCTGTGATGGG + Intergenic
1040281375 8:46049505-46049527 CTTTTTGTGGAATGTGTGATGGG + Intergenic
1040282109 8:46062569-46062591 CTATTTGTGGAATCTGTGAATGG + Intergenic
1040282178 8:46063755-46063777 CTTTTTGTGGAATCTGTGAAGGG + Intergenic
1040282424 8:46068164-46068186 CTTTTTGTGGAATCTGTGAAGGG + Intergenic
1040282433 8:46068337-46068359 CTTTTTGTGGAATCTGTGAAGGG + Intergenic
1040283051 8:46077956-46077978 CTTTTTGTGGAATCTGTGAAGGG + Intergenic
1040283263 8:46081903-46081925 CTCTTTTTAGAATCTGTGATGGG + Intergenic
1040296983 8:46155953-46155975 CTCTTTGTGCAATCTGTGAATGG - Intergenic
1040321443 8:46309173-46309195 CTTTTTGTGCAATCTGTGATGGG - Intergenic
1040322069 8:46318127-46318149 CTTTTTATAGAATCTGTGAAGGG - Intergenic
1040322271 8:46321332-46321354 CTTTTTGTAGAATCTGTGTAGGG - Intergenic
1040327875 8:46366688-46366710 CTTTTTGTGGAATCTGTGAAGGG - Intergenic
1040344070 8:46469578-46469600 CTCTTTGTAGAATCTGTGAAGGG - Intergenic
1040344159 8:46470427-46470449 CTTTTTGTAGAATCTGTGATGGG - Intergenic
1040346068 8:46496568-46496590 GTTTTTATGGAATCTGTGAAGGG - Intergenic
1041119820 8:54574782-54574804 CTAGTTCTGTAATCTGTGTTGGG + Intergenic
1041223895 8:55679204-55679226 CTTTGTTTGGAATCTCTGTTAGG + Intergenic
1042245363 8:66704399-66704421 TTCTCTAAGGAATCTGTGTCTGG - Intronic
1043038047 8:75223046-75223068 CTATTTCTGAACTCTGTGTTTGG - Intergenic
1043701580 8:83294598-83294620 CTCCTGATGGAATGAGTGTTTGG + Intergenic
1043765574 8:84127489-84127511 CTATTTATGGATTCTTTGTGCGG + Intergenic
1044241754 8:89896247-89896269 TTCTTTGTGGAATTTCTGTTTGG - Intergenic
1044337803 8:91008172-91008194 CATTTTATAGCATCTGTGTTGGG - Intronic
1046980550 8:120331980-120332002 CTCTTCATGGAAATTGTTTTTGG - Intronic
1047062464 8:121243101-121243123 CTCTTGATGGAATCTCTTGTGGG + Intergenic
1047865894 8:129023931-129023953 CCCAGTAGGGAATCTGTGTTGGG - Intergenic
1047893506 8:129339570-129339592 GTCTTCATGGAAGCTCTGTTAGG - Intergenic
1048049273 8:130802119-130802141 CAGTTTATGGAATTTGTGATTGG - Intronic
1049082412 8:140453740-140453762 CTCTTTAGGGAATCGTTGTGGGG - Intronic
1050194350 9:3065342-3065364 CTCTTTATGGATTGTGCTTTTGG + Intergenic
1050946362 9:11525189-11525211 TTCTTTATTGAATGTCTGTTTGG - Intergenic
1051204562 9:14671401-14671423 CTTGTTAGGGAATCTCTGTTAGG - Intronic
1051347461 9:16165146-16165168 TTCTTTAAGGAGTATGTGTTTGG - Intergenic
1052713151 9:32081986-32082008 CTTTTTCTGGGAGCTGTGTTGGG - Intergenic
1053713187 9:40846342-40846364 CTTTTTGTGGAATCTGTCTGAGG + Intergenic
1055163752 9:73165224-73165246 CTTTTTCTGGAATCTGTTTATGG + Intronic
1058021308 9:100092146-100092168 CTCTCTATGGAATCAAAGTTAGG + Intronic
1058244438 9:102605158-102605180 CTTTTTATGGAAACTGTGAATGG - Intergenic
1058501335 9:105621124-105621146 CTCTTTATAGTAGCAGTGTTTGG + Intronic
1058898222 9:109418367-109418389 CTCTTTATGCAATCAGTGCCAGG - Intronic
1060328960 9:122646974-122646996 TTGTTTATGCAATCAGTGTTAGG + Intergenic
1060582652 9:124765254-124765276 TTCTTTAAGGAGTGTGTGTTTGG - Intronic
1062068628 9:134542833-134542855 CTCCTTCTGGAATTTGTTTTGGG + Intergenic
1203384989 Un_KI270438v1:28410-28432 CTATTTATGGAATCTGCTTGTGG + Intergenic
1203400769 Un_KI270519v1:93454-93476 CTGTTTATGGAATCTGCTTGTGG + Intergenic
1186137873 X:6538556-6538578 CTCTTGATGGGAGCTGTATTAGG - Intergenic
1186924958 X:14323361-14323383 CTCTGACTGGAAACTGTGTTTGG + Intergenic
1187685421 X:21811125-21811147 CTCTTTCCGGAAATTGTGTTGGG - Intergenic
1191239580 X:58173411-58173433 CTCTTTGTAGAATCTGTGAAGGG + Intergenic
1191261616 X:58328377-58328399 CTTTTTATAGGATCTGTGTAGGG + Intergenic
1191262177 X:58336453-58336475 CTTTTTATAGAATCTGTGAAGGG - Intergenic
1191265863 X:58392832-58392854 CTTTTTGTGGAATCTGTGAAGGG + Intergenic
1191567099 X:62553810-62553832 CTCTTTATAGAATCTGCAGTTGG + Intergenic
1191568461 X:62572317-62572339 CTTTTTATGGAATCTGAAATTGG + Intergenic
1191572770 X:62652898-62652920 CTCTTTGTAGAATCTGCCTTTGG + Intergenic
1191577190 X:62719053-62719075 CTTTTTATAGAATCTGTGAAGGG - Intergenic
1191577280 X:62720086-62720108 CTTTTTGTAGAATCTGTGATGGG - Intergenic
1191581569 X:62767862-62767884 CTTCTTATGGAATCTGTGAAAGG - Intergenic
1191582416 X:62778919-62778941 CTGTTTATGGAATCTGTGAATGG - Intergenic
1191582901 X:62785006-62785028 CTGTTTATGGAATCTGCGAATGG - Intergenic
1191582913 X:62785176-62785198 CTTTTTATAGAATCTGTGAAGGG - Intergenic
1191583451 X:62791820-62791842 CTTTTTGTGGAATCTGTGAAAGG - Intergenic
1191781751 X:64876278-64876300 TTGTTTATGCAATCTGTGTTAGG + Intergenic
1193004089 X:76596542-76596564 CTCTGTAGGGACTCTGTGTAGGG + Intergenic
1193285899 X:79714281-79714303 CTCTTTATGGAAGCTGTTGGTGG - Intergenic
1195244374 X:102982379-102982401 CTCTGTATAGAATCTGTGGTTGG + Intergenic
1196176952 X:112648788-112648810 TTTATTATGGACTCTGTGTTAGG + Intronic
1197263898 X:124346371-124346393 CTCTGTATGAACCCTGTGTTGGG + Exonic
1197490139 X:127106283-127106305 CTCTTTATAGCAACTGTGTGTGG - Intergenic
1197565699 X:128082452-128082474 CTCTTTATGCAAACATTGTTAGG + Intergenic
1199389430 X:147262358-147262380 CTCAGTAGGGACTCTGTGTTGGG - Intergenic
1201619204 Y:15936683-15936705 CTCTTGATGGTAGCTGTGTTAGG - Intergenic