ID: 962193260

View in Genome Browser
Species Human (GRCh38)
Location 3:133333331-133333353
Sequence ATGGATAAGCAGAGTAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 364}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962193260 Original CRISPR ATGGATAAGCAGAGTAAAGA AGG (reversed) Intronic
900306931 1:2014963-2014985 GTGGATAAGCAGAGGAAATTTGG - Intergenic
902780499 1:18701829-18701851 AGGGATAGGCAGAGGGAAGAAGG + Intronic
902908759 1:19579462-19579484 GTGGAAATGCAGAGTAAATAGGG - Intergenic
902999281 1:20253272-20253294 TGGCAGAAGCAGAGTAAAGAGGG + Intergenic
903747551 1:25598366-25598388 TTGGACAAGCAGAGTCAAGGAGG + Intergenic
905755216 1:40503518-40503540 AAGGATAAGAAAAGAAAAGAGGG - Intergenic
906294745 1:44642711-44642733 ATGGCAAAGCAGAGAAAACAGGG - Intronic
906935312 1:50209365-50209387 AGGTGTAAGCAGAGTATAGAAGG + Intergenic
907190954 1:52648509-52648531 AGGGATAAGGAGAGGAAGGAGGG - Intronic
908091975 1:60695922-60695944 AAGGAGGAGCAGAGTAAAGGAGG + Intergenic
909880439 1:80869613-80869635 ATGGATATGCAAGATAAAGATGG + Intergenic
910839190 1:91545736-91545758 ATGGACAAGCAGAGGAAAGTGGG - Intergenic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
911784603 1:101930653-101930675 ATGGATATGCAGATTATAGCAGG + Intronic
911856311 1:102881302-102881324 ATTGATATGAAGAATAAAGAAGG + Intronic
912102288 1:106224890-106224912 AGGGAAAGGAAGAGTAAAGAAGG - Intergenic
912130853 1:106597981-106598003 ATGGATAAGAAGAATCAATATGG - Intergenic
913964258 1:143362151-143362173 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
914504549 1:148277566-148277588 TGGGATAAACAGAGAAAAGAAGG - Intergenic
914509747 1:148320711-148320733 TGGGATAAACAGAGAAAAGAAGG + Intergenic
915012873 1:152705804-152705826 GTAAATAAGCAGAGTAGAGATGG + Intergenic
915985214 1:160457818-160457840 CTGCATAAGCAGAGGAAGGAAGG + Intergenic
916117900 1:161503494-161503516 TTGGGTAAGCAGAGTATAGATGG + Intergenic
916675423 1:167061219-167061241 ATGCATAAGAAGATCAAAGAAGG - Intronic
917508446 1:175649860-175649882 ATGGATCAGGAGAATACAGAGGG - Intronic
918955512 1:191201705-191201727 ATGCAAAAGCAGTGTTAAGAGGG + Intergenic
919039342 1:192362842-192362864 ATGTATAAGCAGTGAAAAAATGG - Intronic
920245067 1:204581452-204581474 ATGCATAAGCACAGAAAAAAAGG - Intergenic
920387111 1:205576967-205576989 AGGGATAAAGAGAGAAAAGACGG - Intronic
921031315 1:211337434-211337456 ATGGAGAGGCAGAGAAACGAAGG + Intronic
921479517 1:215647742-215647764 ATGGATACGTAGAGTCAAGACGG + Intronic
921883349 1:220278383-220278405 ATGGATACGTTGAGTCAAGAGGG - Intergenic
922192292 1:223330038-223330060 ATGGATAATAAGTGTATAGATGG + Intronic
922224552 1:223634062-223634084 ATCCAGAAGCAGAGTAAAGATGG + Intronic
924626806 1:245702414-245702436 ATGGAGACGCAGAGCAAACAGGG - Intronic
1062941707 10:1426803-1426825 AGGGAGAAGCAGGGTATAGAAGG - Intronic
1063206990 10:3842036-3842058 AGGGATAAGCATAGTAATAAAGG + Intergenic
1066087699 10:31987046-31987068 ATGGATAAGAAGAATCAATATGG + Intergenic
1067112906 10:43413100-43413122 ATGGATAAGTAGTGTCTAGAGGG - Intergenic
1068174145 10:53435910-53435932 ATAAATCAGCAGAGAAAAGATGG + Intergenic
1068328602 10:55530273-55530295 ATGGATAAGAATAATAATGATGG - Intronic
1069737595 10:70667354-70667376 AAAGATAAGCAGAGTTAAGGTGG - Intergenic
1071259101 10:83903235-83903257 TTGGGTAAACTGAGTAAAGAGGG - Intergenic
1071477849 10:86040087-86040109 CTGAAAAAGCAGAGTTAAGATGG + Intronic
1072039794 10:91595980-91596002 ATGAATAGGCAGAGCACAGAAGG - Intergenic
1073069042 10:100781849-100781871 ATGGAGAAGAAGAGGAGAGAGGG - Intronic
1073506878 10:104002877-104002899 GAGGATACGCAGAGTAATGATGG + Exonic
1073598972 10:104828210-104828232 ATGGTTAAGCTTAGCAAAGAAGG - Intronic
1073660612 10:105472032-105472054 ATGGAAATGAAGAGCAAAGAAGG + Intergenic
1075253869 10:120908520-120908542 AAGGAAAAGAAGAGTAAAAAGGG - Intronic
1075411356 10:122230693-122230715 ATGGGTCAGTAGGGTAAAGAAGG + Intronic
1078293492 11:10040780-10040802 AGGGATAAAGAGAGGAAAGAAGG + Intronic
1079784620 11:24656330-24656352 ATGGCTAAGCAGAGTAAGTGAGG + Intronic
1079815120 11:25046848-25046870 ATGTAAAAGCAGAATAAAAATGG + Intronic
1080097584 11:28427540-28427562 ATGGATAAGAAGAATCAATATGG - Intergenic
1081323979 11:41723402-41723424 ATGGATAGGAAGAGTCAATATGG - Intergenic
1085202099 11:74708062-74708084 AGGGAAAGGCAGAGTGAAGAAGG - Intronic
1085211170 11:74780302-74780324 ATAGATTAAGAGAGTAAAGAGGG - Intronic
1085699440 11:78733161-78733183 ATAGCTAAGCAGTTTAAAGATGG + Intronic
1086005607 11:82031786-82031808 ATGGTTAGGCAGAATACAGAAGG - Intergenic
1086028629 11:82325956-82325978 ATCAATAACCAGAGAAAAGATGG + Intergenic
1088987120 11:114918979-114919001 GTGGATGAGCAGAATAGAGAAGG - Intergenic
1089030262 11:115319376-115319398 ATGGTGAAGCAGAAAAAAGAAGG + Intronic
1089156611 11:116407574-116407596 ATGGGTAGACTGAGTAAAGAAGG + Intergenic
1092130214 12:6106164-6106186 ATGGATAAGCAAAGTACGTACGG + Intronic
1092197282 12:6556900-6556922 ATGGGTATGCACAGTAGAGAAGG + Exonic
1092404646 12:8210658-8210680 ATTTAGAAGTAGAGTAAAGAGGG + Intergenic
1093746197 12:22743488-22743510 ATGGAAAAGAAGTGGAAAGAGGG - Intergenic
1094138188 12:27151595-27151617 ATGGTGAAGCAGAGTTAATAGGG + Intergenic
1094216484 12:27948129-27948151 AGAGATAAGCAGGATAAAGAGGG - Intergenic
1094266708 12:28567922-28567944 TTAGATAAGCAGAGGAAAGGGGG + Intronic
1094474964 12:30833765-30833787 GTGGAGAAGGAGAGAAAAGAAGG + Intergenic
1094769843 12:33642626-33642648 TTGGATAAGCTGAGTGAAGATGG + Intergenic
1097507498 12:60494290-60494312 ATGGAGAAGCAGAGGAAGCAGGG + Intergenic
1098624516 12:72646655-72646677 ATGGAAAAGCAGAAGAAAGCAGG + Intronic
1099051257 12:77783983-77784005 AGGGAGAAGCAGAGTCATGATGG - Intergenic
1099356909 12:81648526-81648548 ATGGATCAGGAGATTAAATATGG + Intronic
1101562169 12:105867267-105867289 ATGATTAAGCTTAGTAAAGAAGG + Intergenic
1102698120 12:114815677-114815699 ATGGAAAAACAGAGCTAAGAAGG - Intergenic
1103277842 12:119728127-119728149 ATGAACAGGCAGAGTACAGAGGG + Intronic
1104488405 12:129172481-129172503 ATGGTTAAGCTGAGTGAGGAAGG - Intronic
1107168377 13:37310664-37310686 ATGGTGAAGCAAAGTACAGAAGG + Intergenic
1107415508 13:40196274-40196296 ATGGATAAGCAGCTCACAGAAGG + Intergenic
1107872136 13:44757232-44757254 AAAGAAAAGCAGAGTAAAGGAGG + Intergenic
1108701068 13:52944611-52944633 ATGGTTAAGCACAGGAAAGAAGG + Intergenic
1108731130 13:53236943-53236965 GTGGGTAGGCAGAGAAAAGAAGG + Intergenic
1110497005 13:76179909-76179931 CTGGAAAAGAAGAGTAAAGTTGG + Intergenic
1112982914 13:105408895-105408917 ATGGATCAGAAGAAAAAAGAGGG + Intergenic
1112990335 13:105505822-105505844 ATGGTTAAGCAAACTAAATATGG - Intergenic
1113252513 13:108469997-108470019 ATGGATACGCAATGTGAAGATGG + Intergenic
1114075580 14:19159526-19159548 ATGGATAAACAGTTTACAGATGG - Intergenic
1114086581 14:19240046-19240068 ATGGATAAACAGTTTACAGATGG + Intergenic
1114639444 14:24209522-24209544 ATGAATAATTAGAGCAAAGAAGG - Intronic
1114815434 14:25952415-25952437 ATGATTAAGCATAGTAAGGAAGG - Intergenic
1116640812 14:47460304-47460326 AAGGAAAAAAAGAGTAAAGAAGG + Intronic
1117026497 14:51625722-51625744 TTGGATAAGCAGAGAAGAGAGGG - Intronic
1118469788 14:66065287-66065309 ATTGTTAATCAGAGTAATGAGGG + Intergenic
1119996467 14:79258827-79258849 ACAGATAGGCAGAGAAAAGAAGG + Intronic
1121039877 14:90737202-90737224 AAGGATAAGCAGACAAAAAAGGG + Intronic
1121929264 14:97957548-97957570 ATGGAAGAGAAGAGAAAAGAAGG - Intronic
1122685066 14:103500120-103500142 ATGTAGAAGCAGAGAGAAGAGGG - Intronic
1202898118 14_GL000194v1_random:21664-21686 ATGGATAAACAGTTTACAGATGG + Intergenic
1125107738 15:35993325-35993347 AAGGATAAGAAAAGTACAGAAGG + Intergenic
1125192475 15:37009850-37009872 ATAGATACACAGAGTAAATATGG + Intronic
1125303454 15:38282613-38282635 ATGGATAAGCAGTGGTAGGATGG + Intronic
1125354136 15:38799079-38799101 ATGGATAAGAAGAATCAATATGG - Intergenic
1126807371 15:52364716-52364738 AAGGATATGCATACTAAAGATGG + Intronic
1127313150 15:57770190-57770212 AGGGATGAGCTGAGTAAAGAAGG - Intronic
1127661156 15:61101576-61101598 AAGGATACTCAGAGAAAAGAAGG - Intronic
1130068122 15:80622806-80622828 ATGGATCAGAAGACTTAAGATGG + Intergenic
1131666170 15:94573180-94573202 AGAGTTAAGCAGAGTAACGAAGG - Intergenic
1131856718 15:96605178-96605200 ATGGAAGAGCAGAGGAACGAAGG + Intergenic
1132516375 16:367984-368006 ATGGATAAACAGAGGGAATAGGG + Intronic
1135967324 16:27046882-27046904 GTGGATAAGGAGAGAAAATAAGG - Intergenic
1137845000 16:51678370-51678392 ATGGATAATCAGAGGCAGGAGGG - Intergenic
1138063600 16:53917112-53917134 ATGGGGTAGCAGAGTAAGGATGG - Intronic
1138833016 16:60398704-60398726 ATGGAGAGGCTGACTAAAGAAGG - Intergenic
1138852151 16:60641965-60641987 ATGAATCAGCAGAGTTAGGAAGG + Intergenic
1141458866 16:84164395-84164417 ATGAAGAAGCAGAGCACAGAGGG - Intronic
1141466523 16:84209493-84209515 ATGCATAGGCAGAGCACAGAGGG - Intergenic
1141581569 16:85003076-85003098 CTAGAAAAGCAGAGTAACGAAGG + Intronic
1145829896 17:27907450-27907472 ATGGAGAGTCAGAGGAAAGAGGG + Intergenic
1146305794 17:31728989-31729011 ATGGATAACCAGAATATAGTAGG + Intergenic
1147759962 17:42791155-42791177 CTGGGTAAGGAGAGAAAAGAGGG - Intronic
1147895467 17:43748178-43748200 TTGTATATTCAGAGTAAAGATGG + Intergenic
1148522510 17:48293724-48293746 AGGAATAAGCTAAGTAAAGAGGG + Intronic
1149143833 17:53466034-53466056 ATGCATAAACAGAGGAAGGAAGG + Intergenic
1149183827 17:53973763-53973785 ATGGAAAAGGAGAGAGAAGAGGG - Intergenic
1152971947 18:170409-170431 ATGATTAAGCTTAGTAAAGAAGG + Intronic
1153177051 18:2387820-2387842 ATGAAGAAGCAGAAAAAAGAAGG + Intergenic
1154256636 18:12786827-12786849 TTGGATAATCAGAGAAAAAAAGG - Intronic
1154261236 18:12834802-12834824 ATGGAGAAGAACAGTACAGAGGG + Intronic
1156624883 18:38896705-38896727 ATGAATAATAAGGGTAAAGAAGG - Intergenic
1156767825 18:40680050-40680072 ATGGATAAGCACAGAAATGCAGG + Intergenic
1158280413 18:55819393-55819415 ATGGAGAAGGAGACCAAAGAGGG + Intergenic
1158813740 18:61069315-61069337 ATGCAGAAGCAGAGTATGGAAGG - Intergenic
1159726854 18:71971691-71971713 AAGGATAAGCAAAGTACTGAGGG + Intergenic
1159773199 18:72573408-72573430 ATGAATAAGCAGAGCACGGAAGG - Intronic
1160064552 18:75562561-75562583 ATTGAGAGGCAGAGAAAAGAAGG + Intergenic
1164735676 19:30539400-30539422 ATGGGTGGGCTGAGTAAAGAAGG - Intronic
1164789890 19:30967383-30967405 AAGGTTAAACATAGTAAAGATGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166291971 19:41869211-41869233 ATGGGTAAGCAGGGTAGAGGGGG + Exonic
1202698029 1_KI270712v1_random:139642-139664 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
925886643 2:8399390-8399412 ATGCTTAATCAGAATAAAGATGG - Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
927013585 2:18932153-18932175 ATTGAAAAGCAGAGAAAAGAAGG - Intergenic
927595497 2:24393304-24393326 ATGAATAAACATAGTAAAGGGGG - Intergenic
929500988 2:42491956-42491978 AGGAATAAGCAGACTAAGGATGG - Intronic
929841099 2:45464182-45464204 ATGGCTAAGGAAAGTGAAGAAGG - Intronic
930363440 2:50410744-50410766 AAGGAGATGCAGAGTATAGATGG + Intronic
930497214 2:52160950-52160972 ATGAATAAGCAGAATATATAAGG - Intergenic
930720646 2:54634446-54634468 ATCAATAAGCATAATAAAGATGG + Intronic
931928535 2:67102361-67102383 GTAGATTAGCAGAGAAAAGATGG - Intergenic
932143888 2:69302263-69302285 ATGGCAAAGCAGAATACAGAAGG + Intergenic
932824962 2:74930656-74930678 ATGGATATACAGGGTAAAGGAGG - Intergenic
932970416 2:76534278-76534300 ATGGATAATAAGAGTAAAACAGG - Intergenic
933794412 2:85908051-85908073 GTGAATCAGCAGTGTAAAGATGG + Intergenic
934279283 2:91597422-91597444 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
934613902 2:95759651-95759673 ATGGATAGACAGATGAAAGATGG + Intergenic
935125923 2:100222896-100222918 AGGGATAAGCACAGGAATGATGG - Intergenic
935148622 2:100413864-100413886 CTGGTTAAGCAGAGTTAAGTGGG - Intronic
935295195 2:101643474-101643496 ATGGTTAAGCTTTGTAAAGAAGG - Intergenic
937599804 2:123717780-123717802 ATGGATAAGCATAGAAAAGCAGG - Intergenic
937617856 2:123947201-123947223 AAGTATAAGGAGAGAAAAGAAGG + Intergenic
937644987 2:124256664-124256686 ATGGATTAGCAAATTAAAGAAGG + Intronic
938490170 2:131757026-131757048 ATGGATAAACAGTTTACAGATGG - Intronic
939250150 2:139672267-139672289 AAGGATAAGCAGAGTTAGGGTGG + Intergenic
939596925 2:144136683-144136705 ATGGAGAGGCAGAGAAAAAAGGG - Intronic
939698236 2:145355643-145355665 ATGGAGAAGCTAAGTAAAAAAGG + Intergenic
940257951 2:151751220-151751242 AAGGATATTCAGACTAAAGAAGG - Intergenic
940627571 2:156194531-156194553 ATGGATAGACTGAGTAAAGTAGG - Intergenic
940689774 2:156901298-156901320 ATGGATAGCCAGAGAACAGAAGG - Intergenic
941160569 2:162029963-162029985 ATAGATAAGCAGAGGATGGATGG - Intronic
941614297 2:167701506-167701528 GTGCATCAGCAGAGTAATGAAGG + Intergenic
941649199 2:168075134-168075156 ATGGATGAGAAGAGCGAAGAAGG - Exonic
941916540 2:170817243-170817265 AGGGATAAGAAGAGTGACGAGGG - Intronic
942863434 2:180643643-180643665 ATGAATAACCAGAATATAGAAGG + Intergenic
944488911 2:200237284-200237306 AGGAATAAGAAGAGAAAAGAGGG + Intergenic
944849028 2:203698567-203698589 ACAGTTAAGCAGAGTTAAGAGGG + Intergenic
945570504 2:211461608-211461630 ATGGTTAGGCAGGGGAAAGAGGG + Intronic
946076477 2:217077743-217077765 ATGAAAAAGCAGAACAAAGAGGG - Intergenic
946286044 2:218703625-218703647 ATGGATTAAGTGAGTAAAGAAGG + Intergenic
946518072 2:220435105-220435127 ATGAATAGGCAGAGCACAGAAGG - Intergenic
948684604 2:239662523-239662545 ATGGAGGAGCAGAGTGGAGAGGG - Intergenic
1168894948 20:1317971-1317993 ATGGATAAACAGAGCCGAGAGGG - Intronic
1169482003 20:5991214-5991236 ATGCTTAAGCAGAGTAAATTAGG + Intronic
1169555787 20:6748338-6748360 ATGCAGAAGCAGACAAAAGATGG + Intergenic
1170202038 20:13754687-13754709 ATAGATAAGTAGATTAAAGTGGG - Intronic
1170662755 20:18358890-18358912 ACGGATGAGCAGAGAAAGGATGG + Intergenic
1171151833 20:22834508-22834530 AAGGATAAGCAGAATCAGGATGG - Intergenic
1172076061 20:32298576-32298598 ATGGATAATGGGAGTAGAGATGG - Intronic
1173856663 20:46254670-46254692 ATTGAGAAGAAAAGTAAAGAAGG + Intronic
1175392703 20:58637136-58637158 ATGGAGAGGCAGAGCCAAGATGG - Intergenic
1176707341 21:10126034-10126056 ATGGATAAGTAGTTTACAGATGG - Intergenic
1177472328 21:21575072-21575094 AAGAATACACAGAGTAAAGATGG + Intergenic
1178086248 21:29114703-29114725 ATTCAAAAGCAGAGTATAGATGG + Intronic
1178862503 21:36300907-36300929 ATGGACAAGCCTAGTGAAGACGG - Intergenic
1179125909 21:38590353-38590375 ATAGATGAGGAGAGGAAAGAAGG + Intronic
1180291282 22:10852692-10852714 ATGGATAAGCAGTTTACAGATGG - Intergenic
1180486640 22:15806740-15806762 GTGGAAAAGAAGATTAAAGAGGG + Intergenic
1180494087 22:15882114-15882136 ATGGATAAGCAGTTTACAGATGG - Intergenic
1180685490 22:17663169-17663191 ATGGATAAGAACATTTAAGAAGG - Intronic
1183146875 22:36001073-36001095 ATTTTTAAACAGAGTAAAGAAGG + Intronic
1183794801 22:40107789-40107811 ATGGATAAACAGAGAAAGGGGGG - Intronic
949634328 3:5966472-5966494 ATTGATAAGCAGAGAACACAGGG - Intergenic
949725988 3:7045404-7045426 AAGGATAAGAAGAGGCAAGAGGG + Intronic
951168790 3:19513548-19513570 ATGAATAAAAGGAGTAAAGAAGG - Intronic
951974079 3:28483591-28483613 ATGGATAAGAAGACTCAATATGG - Intronic
952632476 3:35486305-35486327 ATAGAAAAGCAAAGAAAAGAGGG - Intergenic
956697089 3:71927810-71927832 TTGGAGAAGCAAAGTGAAGATGG - Intergenic
956758842 3:72419377-72419399 ATGGATAAGGGGAGAAAGGAAGG + Intronic
956929785 3:74029788-74029810 AAGTATAAGCAGAATAATGAGGG - Intergenic
957612401 3:82485203-82485225 ATTAATAAGCAGAGTATATAAGG - Intergenic
957632858 3:82740560-82740582 ATGGAGAAGCAGAGAGGAGAGGG + Intergenic
957745367 3:84334058-84334080 ATTAATAAGCAGAATAAATAAGG + Intergenic
957809258 3:85196943-85196965 ATGGAAAAGCAAAGTATATATGG + Intronic
958040044 3:88216381-88216403 ATGTTTCAGCAGAGTCAAGATGG - Intergenic
959324112 3:104914188-104914210 CTGAATAAGCAGAGGCAAGAAGG + Intergenic
959483863 3:106906084-106906106 AAAGATAAGCAGAGTTAAGGTGG - Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960299031 3:115979171-115979193 ATGGGGAAGAAGAGCAAAGAGGG + Intronic
960547128 3:118928360-118928382 ATGGAGAAGGAGAGAAGAGATGG + Intronic
962193260 3:133333331-133333353 ATGGATAAGCAGAGTAAAGAAGG - Intronic
963725355 3:148914136-148914158 ATGCACAAACAGAGAAAAGAAGG + Intergenic
963812638 3:149794050-149794072 CTGGAAAAGAAGAGTAATGAGGG + Intronic
963860472 3:150304640-150304662 ATGAATAGGCAGAGCACAGAGGG - Intergenic
964167974 3:153732367-153732389 ACGGACATGAAGAGTAAAGATGG + Intergenic
965761618 3:172083684-172083706 CTGGATAATTAGAGTGAAGATGG + Intronic
966364325 3:179166553-179166575 ATTACAAAGCAGAGTAAAGAAGG - Intronic
967348128 3:188481560-188481582 TTAGAGAAACAGAGTAAAGAAGG + Intronic
967430246 3:189375668-189375690 ATGAATAGACAGAGCAAAGAGGG - Intergenic
968914387 4:3490899-3490921 ATGAATGAGCAGAGGAGAGAAGG - Intronic
969031472 4:4218471-4218493 ATGGAAAAGGAGAGGGAAGAAGG + Intronic
969516820 4:7652605-7652627 AGGGGTAAGCAGAGCAAAGAGGG - Intronic
969761474 4:9187363-9187385 ATTTAGAAGTAGAGTAAAGAGGG - Intergenic
971062175 4:22984753-22984775 ATGGGAAAGCAAAGCAAAGAGGG - Intergenic
971166426 4:24188512-24188534 GGGGAAATGCAGAGTAAAGAAGG + Intergenic
972544894 4:40071153-40071175 AAGGAGAGGCAGAGTAGAGAAGG - Intronic
973118932 4:46493543-46493565 AAAGATAAACAGAGAAAAGATGG - Intergenic
973649099 4:52979861-52979883 ATGGGTAAGGACAATAAAGAGGG - Intronic
973904320 4:55511742-55511764 ATGCATATGCAGAGCACAGAGGG - Intronic
974201048 4:58641002-58641024 TTGGAGAAGCAGAGTACTGAGGG - Intergenic
974393627 4:61306430-61306452 AAAGATAAGCAGAGTTAAGATGG + Intronic
974513878 4:62882469-62882491 AGGAAAAAGCATAGTAAAGAAGG - Intergenic
974701640 4:65456301-65456323 ATCGAAGAACAGAGTAAAGAAGG - Intronic
975793350 4:77980212-77980234 ATGGATTAGAAGAGTTAATATGG + Intergenic
975816004 4:78217577-78217599 AGGTATAAGCAGACTAAACATGG - Intronic
977016162 4:91695028-91695050 AGAGAAAAGCAGAGCAAAGAGGG - Intergenic
977209180 4:94198574-94198596 ATGCATAAGCAGAAAAAGGAAGG + Intergenic
979564617 4:122140313-122140335 ATGGATAAGAAGAATCAATATGG - Intergenic
982333226 4:154205632-154205654 ATGGATAATGATAGTAAAAAAGG + Intergenic
982376208 4:154693728-154693750 ATGAATAGGCAGAGCACAGAGGG - Intronic
982626143 4:157768651-157768673 TGGGATAAGCATAGGAAAGAAGG + Intergenic
983583484 4:169331912-169331934 ATGCATTAACAGATTAAAGAAGG - Intergenic
985212968 4:187614979-187615001 ATGGATTAGAAGACTCAAGATGG + Intergenic
985987592 5:3529689-3529711 AGGGAGAAGGAGAGAAAAGAGGG - Intergenic
987074518 5:14368314-14368336 ATGAACAAGCAGAGAAAAGGTGG - Intronic
987272680 5:16328186-16328208 ATGGATAATAAGAAGAAAGATGG + Intergenic
987501517 5:18716026-18716048 AGGGAAAAGCAGTGCAAAGATGG + Intergenic
987797260 5:22644195-22644217 ATGGTGAAGCATAGTGAAGAAGG + Intronic
989154505 5:38331380-38331402 ATGAATAGGCAGAGTTCAGAGGG - Intronic
990513781 5:56513682-56513704 ATGGGTAAGAAGAGGAAAAATGG + Intronic
991329556 5:65479100-65479122 ATAAATAACCAGAGTTAAGATGG - Intronic
991676835 5:69096593-69096615 AATGGTAAGCAGAGTTAAGAGGG - Intronic
992305088 5:75428948-75428970 ATGGATAAAGATAATAAAGATGG - Intronic
993527176 5:88979494-88979516 ATGGAAAAGCTGAGTAATAAGGG + Intergenic
994473851 5:100242350-100242372 CTGAATTAGCACAGTAAAGATGG + Intergenic
995405111 5:111785896-111785918 ATGGATAGGGAGAGGGAAGAGGG + Intronic
996108447 5:119535704-119535726 ATGGAAAAGCACATGAAAGAAGG - Intronic
997251528 5:132392410-132392432 CTGGAGAAGCAAAGGAAAGAGGG - Intronic
998769381 5:145524525-145524547 ATCCAGAAGCAGAGCAAAGAGGG + Intronic
999156667 5:149462992-149463014 ATTGATAAGCAGAATATACAAGG - Intergenic
999225543 5:150020441-150020463 ATGTATAAGCACAGGAAATATGG - Intronic
1002993623 6:2261433-2261455 ATGAATAGGCAGAGCACAGAGGG - Intergenic
1003199191 6:3943259-3943281 ATGAATATGCACAGTAAAAATGG + Intergenic
1003275613 6:4648005-4648027 ATTTATAAGCAGAGTTAAAAAGG - Intergenic
1003384987 6:5659154-5659176 GTGAACAAGCAGAGAAAAGATGG - Intronic
1003464547 6:6365970-6365992 AGGGTTAAGCAGAGTCGAGATGG + Intergenic
1003491213 6:6623553-6623575 GTGAAAAAGCAGAGGAAAGAGGG + Intronic
1004283954 6:14302987-14303009 ATGAACAGGCAGAGTACAGAGGG - Intergenic
1008077848 6:47164392-47164414 TTGGAAATGGAGAGTAAAGAGGG - Intergenic
1008118580 6:47583402-47583424 ATGAATAGGTAGAATAAAGAAGG - Intronic
1008710737 6:54223960-54223982 ATGAATAAGAAGAGTAATAAAGG + Intronic
1009803658 6:68574192-68574214 ATTGATAACCAGAATATAGAAGG + Intergenic
1010066758 6:71691199-71691221 AAAGTTAAGCAGAATAAAGAGGG + Intergenic
1010142835 6:72631388-72631410 ATTGATAAGCAAAGGAAACAAGG + Intronic
1010557100 6:77295974-77295996 ATGGATAATTACAGTAAAGTAGG - Intergenic
1010739798 6:79487326-79487348 ATGGAAAAACTTAGTAAAGATGG - Exonic
1010922215 6:81696795-81696817 ATGAATAAGCAGAGTGTAAAAGG + Intronic
1011610703 6:89147282-89147304 CTGGAAAAGCAGAGTAAAACAGG - Intronic
1011850726 6:91625102-91625124 AGACAGAAGCAGAGTAAAGAGGG - Intergenic
1012145509 6:95675638-95675660 ATGGATAAGAGGATGAAAGAAGG - Intergenic
1012180768 6:96149979-96150001 ATGGAGAAGGGGGGTAAAGAGGG - Intronic
1013141513 6:107340808-107340830 ATAGATAAGCAGTGACAAGAAGG + Intronic
1014554879 6:122833655-122833677 ATGGAGGAGGGGAGTAAAGAAGG + Intergenic
1014705555 6:124742246-124742268 ATCAATAAACTGAGTAAAGAAGG + Intronic
1015398752 6:132764620-132764642 AAGGATAAGCAGGGTAAAGGAGG - Intergenic
1017025989 6:150181112-150181134 ATGGATAGACAGACTAAAGCGGG - Intronic
1018571771 6:165219041-165219063 ATGAGTAAGCAGTGAAAAGAAGG - Intergenic
1018659176 6:166069339-166069361 ATCAATGAGCAGACTAAAGAAGG + Intergenic
1020178348 7:5900873-5900895 ATTGAAAAACAGAGTAAAGATGG + Exonic
1020304577 7:6824126-6824148 ATTGAAAAACAGAGTAAAGATGG - Exonic
1021088226 7:16449528-16449550 AGTGAGAAGCAGAGGAAAGAAGG - Intergenic
1021281898 7:18730224-18730246 GTGGAATAGCAGAGTGAAGATGG - Intronic
1022892137 7:34712307-34712329 ATGGAAAAGTAGAGTGGAGAAGG - Intronic
1023277676 7:38537970-38537992 AAGGACCATCAGAGTAAAGAAGG + Intronic
1023519527 7:41036566-41036588 AGGGATGAACAGAGAAAAGAGGG - Intergenic
1023670747 7:42573794-42573816 ATGGAAAAGCAAAGGAGAGAGGG + Intergenic
1023729069 7:43173260-43173282 ATGGCTAAGCAGAGGAAGAATGG + Intronic
1024832486 7:53477790-53477812 ATAGATTAGAAAAGTAAAGAAGG + Intergenic
1027379256 7:77588202-77588224 ATGATTAAGCTTAGTAAAGAAGG - Intronic
1030975433 7:116116203-116116225 ATGGAAAAGAAGAATAAAAATGG + Intronic
1031105244 7:117533270-117533292 ATAGACAAGCAGAGAAAAGAAGG - Intronic
1031409100 7:121421139-121421161 ATGACTAAGCACAGTAAACAGGG - Intergenic
1033107620 7:138543506-138543528 AAGGATAACCTGAGTAAACATGG - Intronic
1033383273 7:140845380-140845402 AACTATAAGCAGAGTAAAAAGGG + Intronic
1033754925 7:144390447-144390469 CTGGATAAGCAGAGGAAGGAAGG - Intergenic
1035893884 8:3375387-3375409 ATGGAAAAAAAGAGAAAAGATGG - Intronic
1036271574 8:7309189-7309211 ATTTAGAAGTAGAGTAAAGAGGG - Intergenic
1036349774 8:8001161-8001183 ATTTAGAAGTAGAGTAAAGAGGG + Intergenic
1036845048 8:12161682-12161704 ATTTAGAAGTAGAGTAAAGAGGG + Intergenic
1036866417 8:12404003-12404025 ATTTAGAAGTAGAGTAAAGAGGG + Intergenic
1038084807 8:24183816-24183838 ATTGAAAAGCAGTGTTAAGAGGG - Intergenic
1038129217 8:24710663-24710685 ATGGAGGAACAGAGTAAGGAGGG + Intergenic
1038948674 8:32390105-32390127 ATGGGAAAGCAGAGTGAAGAGGG - Intronic
1039402524 8:37282214-37282236 ATAGCTAAGCAGTGTTAAGAGGG + Intergenic
1039768377 8:40656264-40656286 TAGGATAGGCAGAATAAAGAAGG + Intronic
1043779712 8:84316138-84316160 CTGGGAAATCAGAGTAAAGATGG - Intronic
1044754333 8:95445747-95445769 AAGGAACAGCAGAGTAAAGGAGG - Intergenic
1045188987 8:99864963-99864985 AGGGTGAAGCAGAGTCAAGAAGG - Intronic
1045809455 8:106204449-106204471 ATTAATCAGCATAGTAAAGAGGG - Intergenic
1046100557 8:109609610-109609632 ATGGAAAAGGAGAATAGAGAAGG - Intronic
1046408757 8:113811424-113811446 GTAAATAAGCAGAGAAAAGAGGG + Intergenic
1046942845 8:119947746-119947768 ATGGATAATCACAGTACAAAAGG + Intronic
1047031199 8:120883122-120883144 AAGGGAAAGCAGACTAAAGATGG + Intergenic
1047521304 8:125597259-125597281 ATGGATAGGGACAGTAAAGGAGG - Intergenic
1047547483 8:125833166-125833188 CTGCTTACGCAGAGTAAAGAGGG - Intergenic
1048147303 8:131857978-131858000 ATGGAGAAGGAGAAGAAAGAAGG - Intergenic
1050314088 9:4383408-4383430 ATGGATAAGCAAACTAATGTGGG + Intergenic
1051230000 9:14945968-14945990 ATGAATAAGCAGAATATATAAGG + Intergenic
1051434464 9:17016488-17016510 ATGGATAATGAGAGCAAAGGAGG - Intergenic
1051746732 9:20301881-20301903 GTGAATAGGCAGAGTACAGAGGG - Intergenic
1053644529 9:40112754-40112776 ATGGATAAACAGTTTACAGATGG - Intergenic
1053761453 9:41352097-41352119 ATGGATAAACAGTTTACAGATGG + Intergenic
1054325552 9:63710634-63710656 ATGGATAAGCAGTTTACAGATGG - Intergenic
1054350225 9:64013642-64013664 ATGGATAAACAGTTTACAGATGG + Intergenic
1054540046 9:66263215-66263237 ATGGATAAACAGTTTACAGATGG + Intergenic
1054964318 9:71004942-71004964 ATAAAAAAGAAGAGTAAAGAAGG + Intronic
1055735382 9:79323539-79323561 AGGAATAAGCTGAGAAAAGAAGG - Intergenic
1055822395 9:80282545-80282567 ATGTATAACCAGATTACAGATGG - Intergenic
1055873965 9:80920389-80920411 ATGATTAAGCTTAGTAAAGAAGG - Intergenic
1055935493 9:81600780-81600802 ATAGGTAACCTGAGTAAAGAAGG + Intronic
1056302849 9:85259549-85259571 GTGAACTAGCAGAGTAAAGAAGG - Intergenic
1056305986 9:85290790-85290812 ATGGCTAAGCAGAAAAGAGATGG + Intergenic
1058320876 9:103629188-103629210 ATGGATCAGCAGAGGAGAGAGGG - Intergenic
1058805744 9:108589800-108589822 ATGGAGAACAAGAGTGAAGAAGG + Intergenic
1059223621 9:112650619-112650641 ATGGAAAAGAAGAGGAAAAAAGG + Intronic
1059457597 9:114409427-114409449 ATGAGTGAGCAGAGCAAAGAAGG + Intronic
1059892727 9:118822121-118822143 ATGAATAGGCAGAGCATAGAGGG - Intergenic
1060163107 9:121384965-121384987 TTTGAAAAGCAGAGAAAAGATGG + Intergenic
1060328277 9:122640157-122640179 GTGGATAATAATAGTAAAGAAGG - Intergenic
1060373506 9:123097802-123097824 ATGCAGAAGAAGAGAAAAGACGG + Exonic
1060373852 9:123100786-123100808 TTGGAAAAGAAGAGTAAATAAGG + Intronic
1061869901 9:133515081-133515103 AGGGATAAGGAGAGAAAAGAGGG - Intronic
1202792088 9_KI270719v1_random:94914-94936 ATGGATAAGTAGTTTACAGATGG - Intergenic
1185825385 X:3244271-3244293 ATGGATAAACAGAGGAAGGAAGG + Intergenic
1186289503 X:8081019-8081041 ATGGGGAAGCAGAGCACAGAAGG + Intergenic
1186536933 X:10359685-10359707 AAGGATGAGGAGAGTAGAGAGGG + Intergenic
1186672733 X:11783231-11783253 AAGGAAAAGAAAAGTAAAGAAGG + Intergenic
1186839522 X:13471211-13471233 AAGGAAAAGCAGAGTAAGGAGGG + Intergenic
1186991981 X:15079921-15079943 TGGGAAAAGCAGGGTAAAGAAGG + Intergenic
1189197126 X:39162157-39162179 ATGGGAAAGGAGAGGAAAGAAGG - Intergenic
1189692762 X:43634320-43634342 AAGGAAAAGCATGGTAAAGAAGG + Intergenic
1190030341 X:46966342-46966364 AGGGAAAAGCAAAGCAAAGAAGG - Intronic
1191614078 X:63149111-63149133 AAAGATAAGAAGAGTAAAGAAGG + Intergenic
1191622218 X:63229816-63229838 AAAGATAAGAAGAGTAAAGAAGG - Intergenic
1192612050 X:72576473-72576495 AGGGATAGGCAGCGGAAAGAGGG + Intergenic
1193623578 X:83788597-83788619 ATGGATAGGAAGAATAAATATGG + Intergenic
1193688398 X:84607758-84607780 ATGGATAAGAAGAATCAATATGG - Intergenic
1194260896 X:91694344-91694366 ATGTTTAAGCTTAGTAAAGAAGG - Intergenic
1194440097 X:93921530-93921552 ATAGAGAAGCAGTGTGAAGAAGG - Intergenic
1196036149 X:111147443-111147465 ATGGATGAGCAGAGTCAATATGG + Intronic
1197846307 X:130807333-130807355 ATGGAAAAGCAGATTAAAATTGG + Intronic
1198013557 X:132585222-132585244 ATGGAGGAGAAGATTAAAGAGGG - Intergenic
1198673111 X:139102835-139102857 ATGGACAAGCAGGGTTTAGAAGG + Intronic
1198999669 X:142620000-142620022 ACGGATAAGCTTAGTAAGGAAGG - Intergenic
1199401184 X:147400739-147400761 GTGCTTAAGCAGAGAAAAGATGG - Intergenic
1200369570 X:155709542-155709564 ATTGATAATCAGAATAAATAAGG - Intergenic
1200579547 Y:4933146-4933168 ATGTTTAAGCTTAGTAAAGAAGG - Intergenic
1201107779 Y:10776245-10776267 ATGGAAAAGCATAGAGAAGAAGG - Intergenic
1201151183 Y:11096491-11096513 ATGGATAAACAGTTTACAGATGG + Intergenic
1201253811 Y:12087759-12087781 ATGGATAAACAGAGGAAGGAAGG - Intergenic
1201401677 Y:13610355-13610377 ATAAATAAACAGAGTAAACAGGG - Intergenic
1201693890 Y:16802024-16802046 ATGGATAAGCAGAGAGTAGATGG + Intergenic
1201744750 Y:17359661-17359683 ATGTATCAGCAGAGTAAGGGAGG + Intergenic