ID: 962193458

View in Genome Browser
Species Human (GRCh38)
Location 3:133335945-133335967
Sequence TTTTGCTTTCTGTTGTGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4690
Summary {0: 11, 1: 34, 2: 135, 3: 445, 4: 4065}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962193458_962193463 13 Left 962193458 3:133335945-133335967 CCCTGTCACAACAGAAAGCAAAA 0: 11
1: 34
2: 135
3: 445
4: 4065
Right 962193463 3:133335981-133336003 AGCCGACACCCACCCATCAAGGG 0: 1
1: 0
2: 1
3: 16
4: 121
962193458_962193462 12 Left 962193458 3:133335945-133335967 CCCTGTCACAACAGAAAGCAAAA 0: 11
1: 34
2: 135
3: 445
4: 4065
Right 962193462 3:133335980-133336002 TAGCCGACACCCACCCATCAAGG 0: 1
1: 0
2: 0
3: 2
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962193458 Original CRISPR TTTTGCTTTCTGTTGTGACA GGG (reversed) Intronic
Too many off-targets to display for this crispr