ID: 962193459

View in Genome Browser
Species Human (GRCh38)
Location 3:133335946-133335968
Sequence GTTTTGCTTTCTGTTGTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1888
Summary {0: 8, 1: 32, 2: 104, 3: 307, 4: 1437}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962193459_962193463 12 Left 962193459 3:133335946-133335968 CCTGTCACAACAGAAAGCAAAAC 0: 8
1: 32
2: 104
3: 307
4: 1437
Right 962193463 3:133335981-133336003 AGCCGACACCCACCCATCAAGGG 0: 1
1: 0
2: 1
3: 16
4: 121
962193459_962193462 11 Left 962193459 3:133335946-133335968 CCTGTCACAACAGAAAGCAAAAC 0: 8
1: 32
2: 104
3: 307
4: 1437
Right 962193462 3:133335980-133336002 TAGCCGACACCCACCCATCAAGG 0: 1
1: 0
2: 0
3: 2
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962193459 Original CRISPR GTTTTGCTTTCTGTTGTGAC AGG (reversed) Intronic
900303776 1:1992168-1992190 TTTCTGTTTTCTTTTGTGACAGG + Intronic
900935470 1:5763836-5763858 GTGCTGCTTTCTGTTGTCCCTGG - Intergenic
901090338 1:6636638-6636660 GTTCTGTTTGCTGGTGTGACTGG + Intronic
901253467 1:7799773-7799795 GTTTTGCTTTGCTTTGAGACAGG + Intronic
901269136 1:7937178-7937200 CTTTTCCTTTCTTTTGAGACAGG + Intronic
901328983 1:8389955-8389977 GTTTGGCTTTGTGTCTTGACAGG - Intronic
901352266 1:8608046-8608068 TTTTTACTTTCTGTAGAGACAGG + Intronic
901471226 1:9457799-9457821 GTTTTGTTTTGTTTTGTGACGGG - Intergenic
901719556 1:11185595-11185617 GTTCTGTTTTGTTTTGTGACAGG - Intronic
902060092 1:13634747-13634769 GATTAGATTTCTGTTGTGTCAGG + Intergenic
902119295 1:14148191-14148213 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
902143664 1:14378628-14378650 GTTTTGCATTCTGCTGTGACGGG - Intergenic
903105091 1:21071231-21071253 GTTTCATTTTCTGTAGTGACAGG - Intronic
903374027 1:22854504-22854526 TTTTTTCTTTCTTTTGAGACAGG - Intronic
903388683 1:22947788-22947810 GTTTTGGTTTTTGTAGAGACGGG + Intergenic
903407834 1:23113399-23113421 GTTTTGTTTTGTTTTGAGACAGG - Intronic
903448950 1:23439818-23439840 GTTTTGTTTTGTTTTGAGACAGG + Intronic
903818485 1:26082681-26082703 GTTTTACTTTTTTTTGAGACAGG + Intergenic
903825581 1:26142706-26142728 GTTTTTTTTTCAGTAGTGACAGG - Intergenic
903864763 1:26389969-26389991 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
903890996 1:26570476-26570498 GTTTTGTTTTGTTTTGAGACAGG - Intronic
903940840 1:26930170-26930192 GTTTTGTTTTGTTTTGAGACAGG + Intronic
904249861 1:29215564-29215586 GTTTTGTTTTTTTTTGAGACAGG - Intronic
904521045 1:31096241-31096263 GTGTTACTTTGTGTAGTGACAGG + Intergenic
904523496 1:31114182-31114204 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
904705951 1:32390903-32390925 GTTTTGCTTTGTTTTGAGATGGG - Intronic
904717024 1:32476139-32476161 GTTTTGTTTTGTTTTGAGACAGG + Intronic
905562083 1:38935616-38935638 GTTTTGTTTTGTTTTGAGACAGG + Intronic
905736391 1:40330078-40330100 GCTTTGCTTTTTTTTGAGACAGG + Intergenic
905795626 1:40814696-40814718 GTTTTGTTTTTTTTTGAGACAGG - Intronic
906232325 1:44174621-44174643 GTTTTGTTTTGTTTTGTAACAGG - Intergenic
906353110 1:45080388-45080410 GTTTTGTTTTCTGTTATAATAGG + Intronic
906783165 1:48590548-48590570 GTTTTGTTTTGTTTTGAGACAGG - Intronic
906915382 1:50004180-50004202 GTGTTGCTTTCTGCTGTGACAGG - Intronic
907023638 1:51094259-51094281 GTATTGCTTTCTGCTGTGACAGG - Intergenic
907107485 1:51897289-51897311 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
907876984 1:58500023-58500045 GTCTTGCTTTCTGTTTTCAAAGG - Intronic
908291968 1:62676756-62676778 GTTCTGTTTTCTGGTGTCACAGG + Intronic
908394877 1:63716262-63716284 GTTTTGTTTTTTGTAGAGACAGG - Intergenic
908475690 1:64485584-64485606 GTTTTGTTTTGTTTTGAGACAGG + Intronic
908554809 1:65247241-65247263 GTTTTATTTTCTGTAGAGACGGG - Intergenic
908599104 1:65719591-65719613 GTTTTGTTTTCTGTTTTAATAGG + Intergenic
908838144 1:68249472-68249494 GTTTTGTTTTATTTTGAGACAGG - Intergenic
908959020 1:69671760-69671782 GTTATGCTTTCTGCTATGACAGG + Intronic
908980422 1:69949881-69949903 GTTTTGGTTTGTGTTATCACAGG + Intronic
909618977 1:77646223-77646245 GTTTTTTTTTCTTTTGAGACAGG + Intronic
909657855 1:78050637-78050659 TTTTTTCTTTTTTTTGTGACGGG + Intronic
910103004 1:83598627-83598649 CCTTTGCCTTCTGCTGTGACTGG + Intergenic
910229758 1:84974030-84974052 GTTTTCCTTTCTGCTCTAACCGG - Intronic
910422440 1:87080816-87080838 TTGTTACTTTCTGATGTGACAGG - Intronic
910470521 1:87547698-87547720 GTGTTGCTTTCTGCTGTGACAGG + Intergenic
910574440 1:88744245-88744267 GCTTTGCTTTCAGTTCTGAAAGG + Intronic
910754224 1:90669559-90669581 GTTTTGGTTTGTTTTGAGACAGG - Intergenic
911006822 1:93234786-93234808 GTTTTGTTTTGTTTTGAGACCGG + Intronic
911241471 1:95471674-95471696 GTTTTACTTTCTGCTGTGACAGG + Intergenic
911373499 1:97023557-97023579 GTTTTGCTTTCTGCTATAATGGG - Intergenic
911441731 1:97935166-97935188 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
911487060 1:98515644-98515666 GATTGGCTTTCTTCTGTGACAGG - Intergenic
911728775 1:101269887-101269909 TTTTTTCTTTCTTTTGAGACAGG + Intergenic
911967824 1:104389975-104389997 GTTTTTCTTTCTGCTGTAACAGG - Intergenic
912015241 1:105026736-105026758 GTGTTGCTTTCTGCTGTGACAGG - Intergenic
912036762 1:105325681-105325703 GTTTTTCTTTCTGCTCTAACAGG + Intergenic
912135770 1:106658837-106658859 GTTTTTCTTTCTGCTCTAACAGG - Intergenic
912242531 1:107926683-107926705 GTTTGGATTTCTGCTGTGATGGG - Intronic
912415713 1:109507281-109507303 GTCTTGCTCTCTGTTGTACCTGG + Exonic
912609141 1:111025366-111025388 GTTTTACTTTCCCCTGTGACAGG - Intergenic
912789417 1:112637451-112637473 GTTTTGTTGTTTGTTGAGACAGG + Intronic
912877680 1:113378633-113378655 GTTTTGCTTTGTTTTGAGACAGG + Intergenic
912899366 1:113631080-113631102 GTTCTGCTTTCCCTTGTGACAGG + Intronic
913253615 1:116934149-116934171 GTTTTGTTTTTTTTTGAGACAGG + Intronic
913648983 1:120891617-120891639 GTTATGCTTTCTCTTGTTTCTGG + Intergenic
913703250 1:121395516-121395538 GTTTTGCTTTAAGTTGTTAGGGG - Intergenic
913939646 1:125088417-125088439 GTTTTGCTTTAAGTTGTTAGGGG + Intergenic
913979422 1:143496680-143496702 GTTTTGCTTTAAGTTGTTAGGGG - Intergenic
913998799 1:143675002-143675024 GTTTTGTTTTGTTTTGCGACAGG + Intergenic
914073827 1:144322330-144322352 GTTTTGCTTTAAGTTGTTAGGGG - Intergenic
914105328 1:144644030-144644052 GTTTTGCTTTAAGTTGTTAGGGG + Intergenic
914297508 1:146342897-146342919 GTTATGCTTTCTCTTGTTTCTGG - Intergenic
914509427 1:148318050-148318072 GTTTTGTTTTGTTTTGCGACAGG + Intergenic
914527276 1:148481439-148481461 GTTATGCTTTCTCTTGTTTCTGG - Exonic
914639120 1:149585694-149585716 GTTATGCTTTCTCTTGTTTCTGG + Intergenic
915422918 1:155799427-155799449 GTTTTGTTTTGTTTTGAGACAGG - Intronic
915958833 1:160246790-160246812 TTTTTCTTTTCTGTAGTGACGGG - Intronic
916124922 1:161560762-161560784 GTTTTGTTTTGTTTTGAGACGGG - Intergenic
916134813 1:161642107-161642129 GTTTTGTTTTGTTTTGAGACGGG - Intronic
916321717 1:163512264-163512286 GTGTTGCTTTCCACTGTGACAGG - Intergenic
916529226 1:165639795-165639817 GTTTTGTTTTGTTTTGAGACAGG - Intronic
916790689 1:168122454-168122476 GTTTTGATGTCTGTTTTAACAGG - Intronic
917226509 1:172789145-172789167 GTTTTGTTTTCTGTTATAATAGG + Intergenic
917300671 1:173570785-173570807 GTTTTGCTTTCCACTGTCACAGG + Intronic
917405036 1:174696630-174696652 GTGTTGTGTTCTGCTGTGACAGG + Intronic
917440172 1:175062032-175062054 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
917796580 1:178537353-178537375 GTTTGACTTTCTGCTGTGGCAGG - Intronic
917986745 1:180327276-180327298 GCTTTGCTCTCTGCTTTGACAGG + Intronic
918220249 1:182430209-182430231 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
918234042 1:182561320-182561342 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
918597699 1:186310967-186310989 ATTTTGGTTTCTTTTGTGATAGG + Intronic
918683454 1:187384689-187384711 GTTTTTCTTACTGTTATGACTGG + Intergenic
919067669 1:192713933-192713955 GTGTTGCTTTCTGCTGTGACAGG - Intergenic
919316631 1:195979154-195979176 GTTTTGTTTTCTGCTATAACAGG + Intergenic
919455772 1:197818319-197818341 ATGATGCTTTCTGCTGTGACAGG - Intergenic
919516792 1:198534783-198534805 GTTTTGCTTTGTTTTCTGAGTGG - Intronic
919605471 1:199676963-199676985 GTGTTGATTTCTGTTCTGGCAGG - Intergenic
919654544 1:200184711-200184733 GTTTTGTTTTCTGTAGAGACAGG + Intergenic
919891061 1:201975277-201975299 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
920064195 1:203254599-203254621 GTTTTGCTTTATGTGTTCACTGG - Intronic
920101602 1:203520336-203520358 GTTTTGCTTTGTTTTTTGAAGGG + Intergenic
920154359 1:203936553-203936575 GTTTTTCTTTTTTTTGAGACGGG + Intergenic
920576588 1:207065354-207065376 GTTTTGTTTTGTTTTGAGACAGG + Intronic
920595047 1:207260251-207260273 ATTTTGCTTTTCGCTGTGACAGG + Intergenic
920596824 1:207280144-207280166 GTGTTGCCTTCTGCTGTAACAGG + Intergenic
920626185 1:207602892-207602914 GATTTTGTTTCTGTTGTGAATGG - Intronic
920641434 1:207755108-207755130 GTTTTGTTTTGTTTTGAGACAGG - Intronic
921135487 1:212255801-212255823 ACTTTGCTTCCTGTTGTGATAGG + Intergenic
921296270 1:213706345-213706367 GTTTTGTTTTCTGCTATAACAGG + Intergenic
921388337 1:214593992-214594014 TTTTTGCTTTTTGTTGAGATGGG - Intergenic
921634471 1:217476615-217476637 GTTTTGATTTCTGCTATAACAGG - Intronic
921746126 1:218742727-218742749 ATGTTGCTTTCTGCTGTGACAGG - Intergenic
921769650 1:219021530-219021552 GTGTTGCTTTCTGCTGTGATAGG - Intergenic
921987741 1:221330467-221330489 GTTTTGCTTTGTTTTGAGACAGG - Intergenic
922044190 1:221927927-221927949 GTGTTGCTTTCTGCTGTGACAGG - Intergenic
922128944 1:222757604-222757626 GTTTTTGTTTTTGTTGAGACAGG - Intergenic
922145265 1:222937877-222937899 GTTTTGTTTTGTTTTGAGACAGG + Intronic
922377034 1:224979373-224979395 GTTTTGATTTCTGCTGTGACAGG - Intronic
922590361 1:226771125-226771147 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
922685212 1:227633607-227633629 GTTTTGTTTTCTGCTGTAACAGG - Intronic
922876903 1:228947237-228947259 GTTAGGCTATCTGTTGTTACAGG - Intergenic
922924332 1:229335311-229335333 TTTTTTCTTTCTTTTGAGACAGG - Intronic
923799793 1:237197014-237197036 TTTTTTCTTGCTGTTGTGAATGG + Intronic
924214004 1:241800639-241800661 GTTCTGCTTTGTTTTGAGACAGG - Intronic
924229670 1:241953033-241953055 GTTTTTGTTTTTGTTTTGACAGG - Intergenic
924490921 1:244536514-244536536 GTGTTGCTTTCCGCTGTGACAGG + Intronic
924516316 1:244768963-244768985 ATTTTACTTTGTGTTGTGATGGG + Intergenic
924629133 1:245720905-245720927 GTTTTGCTTTCTACTGTGACAGG - Intergenic
924833974 1:247629323-247629345 GTTTTGCTTTCTGCTGTGGCAGG + Intergenic
924887990 1:248240869-248240891 GTTTTCCTTTCTGCTCTTACAGG - Intergenic
1063169895 10:3499539-3499561 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1063213375 10:3901616-3901638 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1063866701 10:10373190-10373212 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1064140382 10:12785255-12785277 GATGTGCCTTCTGTTGTGTCTGG + Intronic
1064192861 10:13222694-13222716 GTTTTGTTTTGTTTTGAGACGGG + Intronic
1064428415 10:15250752-15250774 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1064696915 10:17975928-17975950 GTTTTCCTTTCTGCTTTAACAGG + Intronic
1064987626 10:21226627-21226649 ATGTTGCTTTCTGCTGTGACAGG + Intergenic
1065076118 10:22080870-22080892 TTCTTACTTTCTGATGTGACAGG + Intergenic
1065239554 10:23692540-23692562 GTTTTACTTTCTGATGTGATTGG - Intergenic
1065615299 10:27515143-27515165 GTTTCTTTTTCTGCTGTGACAGG + Intronic
1065716799 10:28578149-28578171 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1065836115 10:29659990-29660012 CTTTTTCTTTCTTTTGTGGCTGG - Intronic
1065921718 10:30399006-30399028 GTTTTGCTTTCTGCTGTGACAGG - Intergenic
1066117767 10:32255545-32255567 CTTTTTCTTTCTTTTGAGACAGG + Intergenic
1066375912 10:34857482-34857504 GTTTTGTTTTTTGTAGAGACAGG + Intergenic
1066425147 10:35301633-35301655 GTTTTGCTTTGTTTTGAGACAGG + Intronic
1066527495 10:36297053-36297075 GTTTTGCTTTCTGCTGTGACAGG + Intergenic
1066649834 10:37643623-37643645 TTTTTTCTTTCTGCTATGACAGG + Intergenic
1066780484 10:38941370-38941392 GTTTTGCTTTAAGTTGTTAGGGG - Intergenic
1066956230 10:42176648-42176670 GTTTTGCTTTAAGTTGTTAGGGG - Intergenic
1067203815 10:44197029-44197051 GTTTTCCTTTCTTTTCAGACAGG + Intergenic
1067465217 10:46492846-46492868 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1067487267 10:46662402-46662424 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1067607538 10:47679606-47679628 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1067621970 10:47891755-47891777 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1068027688 10:51668411-51668433 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1068104141 10:52592322-52592344 GTTTTGCTTTCTGCTCTGACAGG + Intergenic
1069085767 10:64137908-64137930 CTTTTGCTTTTAGTTGTAACTGG - Intergenic
1069343323 10:67438797-67438819 GCTTTGCTCTCTGCTGTGACAGG - Intronic
1069394757 10:67976788-67976810 GTTTTACTTTTTGCTGTAACAGG - Intronic
1069765044 10:70850184-70850206 TTTTTTCTTTTTGTTGAGACAGG + Intronic
1070205002 10:74249353-74249375 GTTTTGTTTTCATTTGTGAGTGG + Intronic
1070308536 10:75255786-75255808 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1070314601 10:75297914-75297936 GTTTTGATTTCTGTTTTCACTGG + Intergenic
1070324779 10:75381227-75381249 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1070464137 10:76702926-76702948 GTGTTACTTTCTGCTGTGACAGG - Intergenic
1070592065 10:77808441-77808463 GTTTTGTTTTCTGTAAAGACAGG + Intronic
1071017943 10:81020623-81020645 GTTTTTCTTTCTGCTCTAACAGG - Intergenic
1071543013 10:86505158-86505180 GTTTTTTTTTCTGTAGAGACAGG + Intronic
1071623092 10:87140967-87140989 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1071799542 10:89043301-89043323 GTATTGCTTTCCGCTGTGACAGG + Intergenic
1072162831 10:92784321-92784343 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1072399990 10:95087742-95087764 GCTTTCCTTTCTGCTGTAACAGG + Intergenic
1072650745 10:97293143-97293165 TTTTTTTTTTCTGTTGAGACAGG + Intergenic
1072988869 10:100170010-100170032 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1073226793 10:101927759-101927781 CTTTTTCTTTTTGTAGTGACAGG - Intronic
1073561434 10:104500168-104500190 GTTTTGCTTTGTTTTGAGACAGG - Intergenic
1073823507 10:107292156-107292178 GTTTTGCTTTCTGCTATAACAGG + Intergenic
1073827210 10:107337431-107337453 GCTTTGCTCTCTGCTGTGACAGG + Intergenic
1074040231 10:109780953-109780975 GCTCTGCTTTCTATTGTTACTGG - Intergenic
1074328871 10:112482920-112482942 CTTTTGAATTCTGTCGTGACTGG + Intronic
1074408354 10:113201028-113201050 GTTCTACTTTCCGCTGTGACAGG - Intergenic
1074668678 10:115761658-115761680 GTTTTGTTTTGTTTTGTGAGTGG + Intronic
1074839453 10:117334501-117334523 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1074976098 10:118582981-118583003 GTTTTGTTTTGTTTTGTGACAGG + Intergenic
1075194866 10:120347806-120347828 GTTTTGCTTGCTGCTGTATCAGG - Intergenic
1075292437 10:121241961-121241983 GTTTTGTTTTCTTTGGAGACAGG + Intergenic
1075331384 10:121576726-121576748 GTATAGCTGTCTGTTGAGACAGG - Intronic
1075830645 10:125408012-125408034 GTGTTGCTTTCTGCTGTTACAGG + Intergenic
1075993092 10:126854470-126854492 GTTTTGAATTCTGTAGTGCCTGG - Intergenic
1076675381 10:132144921-132144943 GTTTTGTTTTTTTTTGAGACAGG - Intronic
1076894692 10:133304282-133304304 GTTTTGTTTTTTGTTGAGACAGG - Intronic
1077124664 11:927070-927092 GTTTTTCTTTTTTTTGAGACAGG + Intronic
1077427333 11:2489288-2489310 GTTCTGCTTTCTGTGGCAACAGG - Intronic
1077586455 11:3457470-3457492 TTTTTGTTTTCTTTTGAGACAGG - Intergenic
1077858768 11:6156854-6156876 GTTTTGCTTTCTACTGTGACAGG - Intergenic
1077969769 11:7177097-7177119 GTTTTGCTTTCTTCTCTAACAGG - Intergenic
1078574809 11:12491166-12491188 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1078872031 11:15356489-15356511 GTTTTTCTTACTCTTGTGAATGG - Intergenic
1078992524 11:16664435-16664457 GTGTTGCTTTCTGCTGTGACAGG - Intronic
1079047781 11:17123253-17123275 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1079090957 11:17479898-17479920 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1079182750 11:18208358-18208380 GTTTTCCTTTCTGCTCTAACAGG - Intronic
1079369510 11:19838627-19838649 GTTTTGTTTTATTTTGAGACAGG + Intronic
1079532897 11:21476844-21476866 GTGTTGCCTGCTGCTGTGACAGG - Intronic
1079626125 11:22619009-22619031 GTTTTCCTTTCTGCTGTAACAGG + Intergenic
1079985219 11:27192843-27192865 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1080075412 11:28141680-28141702 GTTTTGCTTTGTTTTGATACAGG - Intronic
1080405686 11:31976717-31976739 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1080452608 11:32390982-32391004 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1080664490 11:34323839-34323861 GTTTTGCTTTGTGTTGGTAAGGG - Intronic
1080665951 11:34336635-34336657 GTTTTGTTTTTTTTTGAGACAGG - Intronic
1080707247 11:34707894-34707916 GTTTTGCTCCCTGCTGTGACAGG + Intergenic
1081212704 11:40355577-40355599 GTGTTGCTTTTTGCTGTGACAGG + Intronic
1081371164 11:42305213-42305235 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1081472733 11:43391224-43391246 TTTTTACTTTTTGTTGAGACAGG - Intronic
1081550519 11:44107576-44107598 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1081904744 11:46661029-46661051 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1082195462 11:49298940-49298962 GTGTTGCTTTTCGTTGTAACAGG + Intergenic
1083667347 11:64283046-64283068 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1083874916 11:65517333-65517355 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1084206867 11:67600090-67600112 GTTTTGATTTCTTCTTTGACGGG - Intergenic
1084242457 11:67831501-67831523 TTTTTGTTTTCTTTTGAGACAGG - Intergenic
1084299770 11:68240615-68240637 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1084348901 11:68579353-68579375 GTTTTGTTAACTGTTGTTACAGG - Intronic
1084526267 11:69700081-69700103 GTTTTGTTTTTTTTTGAGACAGG - Intronic
1084688114 11:70709203-70709225 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1084886536 11:72212191-72212213 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1085147203 11:74212244-74212266 GTGTTGCTTTCCACTGTGACAGG - Intronic
1085178327 11:74510555-74510577 GTTTTGCTTTCTGCTGTGAGAGG - Intronic
1085330227 11:75642724-75642746 GCTATACTTTCTGTTGTGGCTGG - Intronic
1085468057 11:76737578-76737600 GTTTTGTTTTGTTTTGAGACGGG + Intergenic
1085572242 11:77569483-77569505 GTGTTGTTTTCTGCTGTGACAGG + Intronic
1085637343 11:78168932-78168954 GTTTTGCTGTCCCTTGTGTCGGG + Intergenic
1085910745 11:80822525-80822547 ATTTTGCTTTATGTTGTCACAGG + Intergenic
1085916774 11:80899267-80899289 GTTTTGCCATCTTTTCTGACTGG + Intergenic
1085958873 11:81435704-81435726 GTTTTGTTTTGTTTTGGGACAGG + Intergenic
1086001203 11:81987610-81987632 GTTTGGCTTTCTTTTGTGCATGG + Intergenic
1086105971 11:83147755-83147777 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1086391156 11:86365180-86365202 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1086660476 11:89410612-89410634 GTGTTGCTTTTCATTGTGACAGG - Intronic
1086838328 11:91653506-91653528 GTTCTGCTTTCCACTGTGACAGG + Intergenic
1087059861 11:93966918-93966940 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1087329951 11:96768428-96768450 ATTTGGTTTTCTGTTTTGACAGG + Intergenic
1087349932 11:97019190-97019212 GTTCTGCTTTCTGCTGTGACAGG - Intergenic
1087380726 11:97401584-97401606 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1087417253 11:97872307-97872329 ACTTTGCTGTCTGCTGTGACAGG + Intergenic
1087464116 11:98483954-98483976 TTTTTGTTTTCTTTTGAGACAGG + Intergenic
1087473095 11:98601599-98601621 GTTTTACTTTCTGTTTTGACAGG + Intergenic
1087492459 11:98845519-98845541 GTTTTGCTTTCTGCTGTGACAGG + Intergenic
1087498272 11:98917915-98917937 GTCTTGCTTTCTGCTGCTACAGG + Intergenic
1087572900 11:99952878-99952900 GTTTTTCTTTCTGTACTTACAGG + Intronic
1087835805 11:102873592-102873614 GTTTTTCTTTTTTTTGAGACAGG - Intronic
1087950922 11:104219494-104219516 GTTTTTCTTTCCGCTGTTACAGG + Intergenic
1088154957 11:106791232-106791254 GTTTTGCTTTCTGCTATGACAGG + Intronic
1088211081 11:107457165-107457187 GTTTCGCGATCTTTTGTGACAGG + Intronic
1088269155 11:108016270-108016292 CTTTTCTTTTCTGTTGAGACAGG + Intronic
1088274045 11:108065555-108065577 CTTTTGCTTTCTGCTGTGAAAGG + Intronic
1088478254 11:110266756-110266778 GTTTTGTTTTCTGTAGAGGCAGG + Intronic
1088531955 11:110820099-110820121 CTTTTTCTTTCTGTAGAGACAGG + Intergenic
1088624315 11:111718399-111718421 GTTTTGCTTTCTGCTGCCATGGG + Intronic
1088854520 11:113735293-113735315 ATTTTTCTTTCTGTTGTTAAAGG - Intronic
1088897807 11:114091339-114091361 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1088938336 11:114426721-114426743 GTTTTGCTTTCTGCTGTGACTGG + Intronic
1088960732 11:114662279-114662301 GTTTTGCTGTCTGCTATAACAGG - Intergenic
1089085287 11:115811944-115811966 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1089167404 11:116487792-116487814 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1089414195 11:118273209-118273231 TTTTTGCTTGCTTTTGAGACAGG - Intergenic
1089483528 11:118827052-118827074 ATTTTGTTTTGTTTTGTGACAGG + Intergenic
1089569527 11:119394959-119394981 GTTTTGTTTTCTGCTATAACAGG + Intergenic
1089904928 11:122028836-122028858 GTTTGGTTTTCAGATGTGACTGG - Intergenic
1090451849 11:126813244-126813266 GTCTTGTTTTCCTTTGTGACTGG + Intronic
1090677026 11:129007975-129007997 GTTTTGCTTTCCACTGTGACAGG + Intronic
1090966358 11:131600755-131600777 GCTTTGCTTCTTGTTGTGTCTGG - Intronic
1091469069 12:710953-710975 TTTTTGTTTTCTTTTGAGACAGG + Intergenic
1091513804 12:1157274-1157296 TTTTAGCTTTCTGTAGAGACAGG + Intronic
1091967313 12:4755353-4755375 GTTTTCCTTTCTGCTCTAACAGG + Intronic
1092164100 12:6332266-6332288 GTTTTACTTTTTGTAGAGACAGG - Intronic
1092357259 12:7806561-7806583 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1092412687 12:8266204-8266226 TTTTTGTTTTCTTTTGAGACAGG - Intergenic
1092733736 12:11559072-11559094 GTTTTGCTTTGTTTTGAGATAGG - Intergenic
1092930900 12:13314770-13314792 GTTTTGCTTTCTGTAGACTCAGG + Intergenic
1093124149 12:15307751-15307773 GTTTTCCTTTCTGCTCTAACAGG + Intronic
1093259612 12:16918643-16918665 GTGTTGCTTTCCACTGTGACAGG + Intergenic
1093321377 12:17719041-17719063 GTGTTGCTTTCCACTGTGACAGG + Intergenic
1093619893 12:21276783-21276805 GTTTTGCTTTCCACTGTGACAGG - Intronic
1094168249 12:27464535-27464557 TTTTTGCTTTTTGTAGAGACAGG - Intergenic
1094419686 12:30257524-30257546 GTTTTACTTTCCCCTGTGACAGG - Intergenic
1094537652 12:31336200-31336222 GTTTTGCTTTTTTTTGAGACAGG - Intergenic
1094817477 12:34202632-34202654 GTTTTCCTTTCTGCTCTAACAGG - Intergenic
1095099640 12:38166692-38166714 GTTTTCCTTTCTGCTCTAACAGG + Intergenic
1095150057 12:38783511-38783533 GTTTTACTTTCTGCTATAACAGG - Intronic
1095169594 12:39019143-39019165 GTGTTGCTTTCCACTGTGACAGG - Intergenic
1095436412 12:42193507-42193529 TTTTTGGTTTTTGTTGAGACAGG + Intronic
1095625003 12:44304241-44304263 GTGTTGCATTCTGCTATGACAGG - Intronic
1096084208 12:48854608-48854630 GTTTTACTTTCTGTAGAGACAGG + Intergenic
1096141000 12:49242471-49242493 GTTTTGTTTTGTGTTGAGATGGG + Intronic
1096316838 12:50575386-50575408 GTTTTGTTTTTTTTTGAGACAGG + Intronic
1096406774 12:51349536-51349558 GTTTTGTTTTGTTTTGAGACTGG - Intergenic
1096697504 12:53359408-53359430 GTTTTGTTTTGTTTTTTGACAGG - Intergenic
1096702770 12:53397016-53397038 GTTTTGTTTTTTGTTTTGAGCGG + Intronic
1097426137 12:59446659-59446681 GTGTTGCTTTTTATTGTGACTGG + Intergenic
1097563727 12:61240413-61240435 GTTTTCCTTTCTGCTCTAACGGG + Intergenic
1097585682 12:61513265-61513287 GTTTTGCTTTGTTTTGTGGCAGG - Intergenic
1097714950 12:62955923-62955945 GTTCTGCTTTCCGCTATGACAGG + Intergenic
1097791225 12:63817701-63817723 GTTTTCCTTTCTGCTATAACAGG - Intergenic
1097847002 12:64377090-64377112 GATTTGCATTCTGTAGTGATTGG + Intronic
1097972899 12:65653577-65653599 GTTTTGTGTTGTGTTGCGACTGG - Intergenic
1097989197 12:65817277-65817299 GTTTTGTTTTGTTTTGAGACGGG - Intergenic
1098013019 12:66074242-66074264 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1098046599 12:66407586-66407608 GTGTTGCTTTCCGCTGTGACAGG - Intronic
1098060205 12:66553798-66553820 GTATTGCTTTCCATTGTGATAGG - Intronic
1098208032 12:68133359-68133381 GTTTTGTTTTCTGTTATAATAGG + Intergenic
1098330794 12:69350794-69350816 GTTTTGTTTTATTTTGAGACAGG + Intronic
1098582861 12:72121472-72121494 GTGTTGCTTTCCATTGTTACAGG + Intronic
1098622750 12:72623978-72624000 GCTTTGCTTTCTTTTGTAACTGG + Intronic
1098667482 12:73181414-73181436 GTTTTGCTTTCTGCTGTGACGGG + Intergenic
1098797420 12:74908555-74908577 TTTTTTCTTTGTGTTGTGAGAGG + Intergenic
1098959032 12:76719185-76719207 GTGTTGCTTTCTGCTGTGACAGG - Intergenic
1099059583 12:77889975-77889997 GTTTTGGTGTCAGTTTTGACTGG - Intronic
1099182982 12:79488860-79488882 GTTTTGTTTTGTCTTGAGACAGG + Intergenic
1099433620 12:82618593-82618615 GTTTTACTTTCTGCTATAACAGG - Intergenic
1099491310 12:83292108-83292130 GTGCTGCTTTCTGTTGTGACAGG - Intergenic
1099616033 12:84937588-84937610 GTTTTTCTTTCTCCTGTGACAGG - Intergenic
1099620534 12:84997499-84997521 GTTCTGCCTTCTGTTGTAATCGG - Intergenic
1099931337 12:89078463-89078485 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1100134762 12:91542055-91542077 GTTTTGGTTTTTATTGTGAAAGG + Intergenic
1100252557 12:92843328-92843350 TTTTTATTTTCTGTTGAGACAGG + Intronic
1100320361 12:93485813-93485835 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1100381116 12:94062844-94062866 GTGTTGCTTTCCACTGTGACAGG - Intergenic
1100424444 12:94470572-94470594 GGTTTGTATTCTGTTGTGCCTGG - Intergenic
1100588241 12:95999364-95999386 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1100758269 12:97776606-97776628 TTTTTCCTTTCTGTTGGTACTGG + Intergenic
1100804173 12:98263628-98263650 GTTTTGCTGTGTGTTATGAGTGG - Intergenic
1100893276 12:99150191-99150213 GTTGTGCTTTCAGTTTTTACAGG + Intronic
1100996730 12:100308853-100308875 GCTTTGCTTTCTGCTGTTACAGG + Intronic
1101035239 12:100699169-100699191 GTTTTGTTTTGTTTTGTGAGAGG - Intergenic
1101981397 12:109410311-109410333 GTTTTACTTTTTGTAGAGACAGG + Intronic
1101991734 12:109491185-109491207 GTTTTTCTTTCTCTCGTTACTGG + Intronic
1102097449 12:110251700-110251722 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1102288644 12:111680684-111680706 GTTTTGTTTTTTTTTGAGACAGG - Intronic
1102432272 12:112892836-112892858 GTATTGCTTTCTGTTATCAGAGG - Intronic
1103018243 12:117512855-117512877 GTTTGGCCTTCTGGTGTCACTGG - Intronic
1103078225 12:118002418-118002440 GTTTTGTTTTGTTTTGTGACAGG - Intergenic
1103143851 12:118576973-118576995 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1103608857 12:122108699-122108721 GTTTTGCTTTCACTTGTGTGTGG + Intronic
1103650245 12:122426407-122426429 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1103787543 12:123444423-123444445 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1104002329 12:124868067-124868089 GTTTTCATTTTTGTTGAGACAGG + Intronic
1104048175 12:125178183-125178205 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1104435906 12:128756402-128756424 TTTTTTTTTTCTGTTGAGACAGG - Intergenic
1104514412 12:129411372-129411394 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1104660438 12:130608184-130608206 GCTTTGGTTTCTGTTGTGAATGG + Intronic
1105427028 13:20302683-20302705 GTTTGGCTTTCTGTTCCCACTGG - Intergenic
1105555056 13:21439513-21439535 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1105666135 13:22558530-22558552 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1106070696 13:26408117-26408139 TTTTTGTTTTTTGTTGAGACAGG + Intergenic
1106278800 13:28243690-28243712 GTTTTTGTTTCTGTTGTGAGAGG + Intronic
1106451917 13:29889784-29889806 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1107177996 13:37422477-37422499 GGGTTGCTTTCTGCTGTGACAGG - Intergenic
1107309903 13:39065674-39065696 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1107370279 13:39737910-39737932 GTGTTGCTTTCTGCTGTGACAGG + Intronic
1107633381 13:42366095-42366117 GTTGTGCTTTCTATTCTCACAGG + Intergenic
1107753963 13:43599415-43599437 GTGTTGCTTTCCTCTGTGACAGG - Intronic
1107908088 13:45080374-45080396 GTTTTGCTTTTTGTAGAGACAGG + Intergenic
1108137834 13:47385070-47385092 GTTTTGCTTTCTGCAGTGACAGG - Intergenic
1108356020 13:49629255-49629277 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1108400629 13:50038613-50038635 TTTTTGTTTTGTTTTGTGACAGG - Intergenic
1108580578 13:51824945-51824967 TTTTTGCTTTCTTTTGAGACAGG - Intergenic
1108955949 13:56156911-56156933 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1108972930 13:56400667-56400689 GTGTTGCTTTCCACTGTGACAGG - Intergenic
1109022845 13:57119801-57119823 GGTTTGCTTTCTGCTATAACAGG + Intergenic
1109100823 13:58181608-58181630 GTGCTGCTTTCTGCCGTGACAGG + Intergenic
1109302044 13:60599747-60599769 TTTTCGATTTCTGTTGTGCCTGG + Intergenic
1109336779 13:61004226-61004248 GTTTTGCTTTCTGCTGTGACAGG + Intergenic
1109554626 13:63955771-63955793 GTATTGCATTCTGCTGTGACAGG + Intergenic
1109566961 13:64130878-64130900 GCTTTGCTCTCTGCTGTAACAGG - Intergenic
1109583700 13:64371770-64371792 GTTTTGTTTTCTGCTGTGACAGG + Intergenic
1109685734 13:65818161-65818183 ATTTTGTTTTCTGCTGTAACGGG - Intergenic
1109747537 13:66646946-66646968 GTGTTGCTTTCCACTGTGACAGG - Intronic
1109824208 13:67696978-67697000 GTTTTGCTTTCTGTTGTGACAGG - Intergenic
1109826543 13:67728751-67728773 GTTTTTCTTTCTGCTCTAACAGG + Intergenic
1110235408 13:73212598-73212620 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1110236124 13:73219931-73219953 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1110310327 13:74041734-74041756 GTTTTCTTTTCTGTTTTGAAGGG - Intronic
1110448873 13:75618564-75618586 GTGTTGCTTTCCACTGTGACAGG + Intergenic
1110487653 13:76065891-76065913 ATATTACTTTCTGCTGTGACGGG + Intergenic
1110665872 13:78116722-78116744 GTATTGTTTTCTGCTGTGACAGG + Intergenic
1110974088 13:81807774-81807796 GTTTTGCTTTCTACCATGACAGG - Intergenic
1111099317 13:83561019-83561041 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1111316590 13:86569684-86569706 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1111335464 13:86815813-86815835 GTGTTGCTTTCCACTGTGACAGG - Intergenic
1111365337 13:87235305-87235327 CTTTTGCTTTCTGCTATAACAGG + Intergenic
1111442433 13:88297587-88297609 GTTTTGTTTTGTTTTGTGATGGG - Intergenic
1111513340 13:89294591-89294613 GCTTTTCTTTCTGCTGTAACAGG + Intergenic
1111530253 13:89527334-89527356 GTTTTGTTTTTTGTAGAGACAGG + Intergenic
1112072375 13:95868592-95868614 GTTTTGTTTTGTTTTGTGACAGG - Intronic
1112474606 13:99719466-99719488 GTTTTGTTTCTTGATGTGACTGG - Intronic
1112619000 13:101035448-101035470 GTTTTCCTTTCTGCTCTAACAGG + Intergenic
1112865904 13:103898221-103898243 GTGTTGCTTTCCACTGTGACAGG + Intergenic
1112901606 13:104363809-104363831 GATTTGCTTTCTGCTATAACAGG + Intergenic
1113213016 13:108004001-108004023 GTTTTGCTTTTCGCTGTGACAGG + Intergenic
1113278904 13:108767104-108767126 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1113279399 13:108772342-108772364 TTTTTTCTTTCTTTTGAGACAGG - Intronic
1113516461 13:110906124-110906146 ATTTTGCTTTTTGTTGTTTCAGG - Exonic
1113830866 13:113294754-113294776 GTTTTGTTTTGTTTTGTGACAGG - Intergenic
1113853732 13:113432765-113432787 CTTTTGGTATCTGCTGTGACTGG - Intronic
1114457761 14:22867765-22867787 TTTTTGCTTTTTTTTGAGACAGG - Intergenic
1114462464 14:22895767-22895789 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1114729203 14:24973110-24973132 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1114887865 14:26877296-26877318 GTTTTGTTTTCTTTTGTGTTTGG - Intergenic
1114898546 14:27026171-27026193 GTGTTGCTTTCCACTGTGACCGG + Intergenic
1114968832 14:28000928-28000950 GTTTTGCTTTCTACTGCGACAGG - Intergenic
1115183134 14:30653293-30653315 ACTTTGCTTTTTGTTGAGACAGG - Intronic
1115371296 14:32617629-32617651 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1115608132 14:35026224-35026246 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1115620422 14:35135041-35135063 TTTTTGCTTTCTGCTATAACAGG + Intronic
1115660888 14:35493649-35493671 GTGTTGCTTTCTGCTGTGACAGG - Intergenic
1115700327 14:35947239-35947261 GTTTTGCTTTCTCATGAGTCAGG + Intergenic
1115710112 14:36041180-36041202 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1115829023 14:37313590-37313612 CTTTTGCCTTCTGTTTTGAGTGG - Intronic
1115831189 14:37343472-37343494 AGTTTGGTTTCTGTTTTGACTGG + Intronic
1115918247 14:38342087-38342109 GCTTTGCTTTCTGCTGTGACAGG - Intergenic
1116021748 14:39469580-39469602 GTTCTGCTTTCTGCTATGACAGG + Intergenic
1116047482 14:39762720-39762742 GTGTTGATTTCTGTTCTGATGGG + Intergenic
1116062914 14:39947015-39947037 ATTTTGCTTTCTGCTGTGACAGG + Intergenic
1116087154 14:40254562-40254584 GTTTTGTCTTCTGCTGTGACAGG + Intergenic
1116106358 14:40513336-40513358 GTTTTGCTTTCTGCTGTGACAGG - Intergenic
1116238941 14:42315574-42315596 GTTTTTCTTTGTTTTGAGACAGG - Intergenic
1116392729 14:44413091-44413113 ATATTTCTTTCTGCTGTGACAGG - Intergenic
1116406964 14:44578594-44578616 GTTTTCCTTTCTGCTCTAACAGG - Intergenic
1116413094 14:44649028-44649050 ATGTTGCTTTCTGCTCTGACAGG - Intergenic
1116445786 14:45009310-45009332 GCTTTGGTTTCTGGTGTGAGTGG + Intronic
1116480946 14:45391379-45391401 GTTTTGCTTTTTGTTGTAACAGG - Intergenic
1116495375 14:45553537-45553559 GTGTTGTGTTCTGCTGTGACAGG + Intergenic
1116588763 14:46744223-46744245 GTTTTGCTTTTCGTTTTTACAGG - Intergenic
1117330615 14:54708291-54708313 GTGTTGCTATCAGTTGAGACAGG + Intronic
1117607102 14:57440911-57440933 GTGTTGCTTTCTTCTGTGACAGG + Intergenic
1117692665 14:58324279-58324301 TTTTTTCTTGCTGTTGTGACAGG + Intronic
1117795543 14:59389322-59389344 GTGTTGCTTTCTGCTGAGACAGG + Intergenic
1117843139 14:59881460-59881482 ATGTTGCTTTCTGCTGTGACAGG + Intergenic
1117906838 14:60598317-60598339 GTTTTGTTTTGTTTTGAGACTGG + Intergenic
1117923300 14:60748234-60748256 GTTTTCCTTTTTTTTGAGACAGG + Intronic
1118034279 14:61849575-61849597 GTGTTGCTTTCTGCTGTGATAGG + Intergenic
1118358096 14:65031913-65031935 GTTTTGGTTTTTATTGAGACAGG - Intronic
1118361185 14:65058294-65058316 GTTTTCATGTCTCTTGTGACTGG + Intronic
1118543432 14:66857906-66857928 GTGTTGCTTTCTGCTGTGACAGG - Intronic
1118557340 14:67039785-67039807 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1118587711 14:67371017-67371039 GTTTTCCTTTTTTTTGAGACAGG - Intronic
1118632604 14:67719647-67719669 GTTTTCCTTTTTGTAGAGACGGG + Intronic
1118814075 14:69296685-69296707 GTTTTATTTTGTGTTGAGACAGG - Intronic
1118871607 14:69747782-69747804 GTTTTGTTTTCCATTGTGAAAGG - Intronic
1118962291 14:70545388-70545410 GTTCTGCTTTCTGCCATGACAGG - Intergenic
1119419845 14:74502002-74502024 GTTTTGCTTTGTGTTGAGTGAGG - Intronic
1119441280 14:74630527-74630549 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1119542089 14:75446308-75446330 GTTTTCCTTTCTGTTGGGAAAGG - Intronic
1119715131 14:76853756-76853778 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1120040674 14:79749436-79749458 GTTTTTTTTTTTGTAGTGACAGG + Intronic
1120100007 14:80434520-80434542 GTGTTGCTTTCCGCTGGGACAGG - Intergenic
1120107854 14:80516696-80516718 GTGTTGCTTTCCACTGTGACAGG + Intronic
1120275602 14:82369649-82369671 GCTTTGCTCTCTGCTGTGACAGG - Intergenic
1120467906 14:84884904-84884926 GTGTTGCTTTCCATTGTGAAAGG - Intergenic
1120770977 14:88380127-88380149 AGTTTGCTTTCTGCTGTGATGGG + Intergenic
1120963404 14:90145989-90146011 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1121375828 14:93410200-93410222 GTATTGCTTTTTGCTATGACAGG - Intronic
1121759875 14:96435800-96435822 GTTTTTCTTTCTGCTCTAACAGG + Intronic
1121785154 14:96653248-96653270 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1122513450 14:102288906-102288928 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1122706084 14:103622615-103622637 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1202936760 14_KI270725v1_random:94734-94756 GTTTTGCTTTAAGTTGTTAGAGG + Intergenic
1123393112 15:19898465-19898487 GTTTTGCTTTAAGTTGTTAGGGG - Intergenic
1123396437 15:19943025-19943047 GTTTTGCTTTAAGTTGTTAGGGG - Intergenic
1123502468 15:20902506-20902528 GTTTTGCTTTCTGCTATGATGGG - Intergenic
1123508738 15:20973103-20973125 GTTTTGCTTTCCACTGTGATAGG + Intergenic
1123559718 15:21476173-21476195 GTTTTGCTTTCTGCTATGATAGG - Intergenic
1123565962 15:21546852-21546874 GTTTTGCTTTCCACTGTGATAGG + Intergenic
1123595952 15:21913472-21913494 GTTTTGCTTTCTGCTATGATGGG - Intergenic
1123602219 15:21984139-21984161 GTTTTGCTTTCCACTGTGATAGG + Intergenic
1123701852 15:22920014-22920036 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1124530720 15:30503325-30503347 GTTGTTCTTTCTGGTGTGATGGG - Intergenic
1124694391 15:31851862-31851884 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1124767940 15:32504370-32504392 GTTGTTCTTTCTGGTGTGATGGG + Intergenic
1124844407 15:33276269-33276291 GTTTTCCTTTCTGCTCTAACAGG + Intergenic
1125253920 15:37740317-37740339 GTTTTGTTTTCTGCTTTCACTGG - Intergenic
1125272182 15:37951994-37952016 GTTTTGTTTTCTGTTATAATGGG - Intronic
1125567595 15:40689049-40689071 GTGTGGCTTTCTGCTGTGCCAGG - Intergenic
1125575054 15:40749507-40749529 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1126053455 15:44707986-44708008 GTGTTGCTTTGTGCTATGACTGG + Intronic
1126121025 15:45251769-45251791 GTTTTGTTTTGTTTTCTGACAGG + Intergenic
1126360006 15:47836418-47836440 GTTTGGTTTTCTGTTTTGAGGGG - Intergenic
1126534039 15:49741655-49741677 GATTTGCTTTCCACTGTGACAGG - Intergenic
1126706752 15:51413538-51413560 GTGTTGCTTTCCACTGTGACAGG - Intergenic
1126709551 15:51441877-51441899 GTTTTCCTTTCTGCTCTAACAGG + Intergenic
1126794380 15:52248145-52248167 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1126979945 15:54229100-54229122 TTGTTGCTTTCTGCTGTGACAGG + Intronic
1127083528 15:55404390-55404412 ATTTTGCTTTCTGTTGTAAAGGG - Intronic
1127250615 15:57233347-57233369 TTTTTACTTTTTGTTGAGACAGG + Intronic
1127263292 15:57341417-57341439 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1127752682 15:62060946-62060968 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1127971644 15:63966685-63966707 GTATTGCTTTCTGCTGTGACAGG + Intronic
1127986843 15:64079518-64079540 TTTTTGTTTGCTGTTGAGACAGG - Intronic
1128259180 15:66220541-66220563 TTTTTGCTTTGTTTTGAGACAGG + Intronic
1128706168 15:69838707-69838729 GTTTTGCTTTGTTTTGTCAATGG - Intergenic
1128901182 15:71423933-71423955 GTGTTGCTTTCCACTGTGACAGG + Intronic
1128966139 15:72060580-72060602 GTGCTGCTTTCTCCTGTGACGGG - Intronic
1129030748 15:72615970-72615992 GTTTCGCTTTCTGCTGTGACAGG + Intergenic
1129137976 15:73571250-73571272 GTTTTGTTTTGTGTTAAGACAGG - Intronic
1129477592 15:75796494-75796516 GTTTTGCTTTCTGCTGTGACAGG + Intergenic
1129564989 15:76612240-76612262 TTTTTGCTTTTTTTTGAGACAGG + Intronic
1129642273 15:77393013-77393035 GTCTTGCTTTCCGCTGTGACAGG - Intronic
1129835658 15:78703771-78703793 GTTTCACTTTCTGCTGTGACAGG + Intronic
1129972580 15:79792891-79792913 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1130131091 15:81143303-81143325 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1130301889 15:82686385-82686407 GTTTTCTTTTTTGTTGTCACTGG - Intronic
1130400462 15:83547326-83547348 GTGTTGCTTTCCACTGTGACAGG + Intronic
1130511676 15:84594865-84594887 GTTTTGCTTTCTGCTGTGACAGG - Intergenic
1130610351 15:85355229-85355251 CTTTTTCTTTCTTTTGAGACAGG + Intergenic
1131236040 15:90697975-90697997 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1131323626 15:91421515-91421537 ATGCTGCTTTCTGCTGTGACAGG + Intergenic
1131407682 15:92179130-92179152 GTTTTACTTTCTTTTGTGACAGG - Intergenic
1131410742 15:92205636-92205658 GTTTTCCTTTCTGCTCTAACAGG + Intergenic
1131497857 15:92930436-92930458 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1131631945 15:94186879-94186901 GTTTTTCTTTCTGCTCTAACAGG - Intergenic
1131976977 15:97956901-97956923 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1132120980 15:99175155-99175177 TTTCTTCTTTCTGTGGTGACAGG - Exonic
1132165781 15:99588121-99588143 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1202968060 15_KI270727v1_random:203335-203357 GTTTTGCTTTCTGCTATGATAGG - Intergenic
1202974325 15_KI270727v1_random:273945-273967 GTTTTGCTTTCCACTGTGATAGG + Intergenic
1132736960 16:1391322-1391344 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1132938652 16:2495930-2495952 GTTTTCTTTTCTTTTGAGACAGG - Intronic
1133110400 16:3544675-3544697 GTCTTGTTTTCTCTTGAGACAGG + Intronic
1133126262 16:3648161-3648183 GTTTTGTTTTCTTTTGAGACAGG - Intronic
1133133038 16:3689831-3689853 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1133158129 16:3890159-3890181 TTTTTACTTTCTGTAGCGACAGG + Intergenic
1133353838 16:5121403-5121425 CTTTTGTTTTCTTTTGAGACAGG - Intergenic
1133505617 16:6409407-6409429 GTTTTGTTTTGTTTTGAGACCGG - Intronic
1133751458 16:8729296-8729318 GTTTTTGTTTTTGTTGAGACAGG - Intronic
1133772081 16:8872709-8872731 GTTTTGTTTTGTTTTGAGACGGG - Intergenic
1133911955 16:10073913-10073935 GTTTTTTTTTTTTTTGTGACGGG - Intronic
1134018559 16:10906352-10906374 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1134409099 16:13988627-13988649 GTTTTGCTTTGTTTTGAGACAGG + Intergenic
1134409316 16:13990228-13990250 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1135180593 16:20270771-20270793 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1135263608 16:21002195-21002217 GTTTATCTTTCTGAAGTGACTGG - Intronic
1135321019 16:21496480-21496502 TTTTTGTTTTCTGTAGAGACGGG - Intergenic
1135373853 16:21927982-21928004 TTTTTGTTTTCTGTAGAGACGGG - Intergenic
1135437933 16:22442739-22442761 TTTTTGTTTTCTGTAGAGACGGG + Intergenic
1135481363 16:22823202-22823224 TTTTTGCTCTCTAGTGTGACTGG + Intronic
1135562230 16:23485802-23485824 AATTTGCTTTCTGTTCTGATTGG - Intronic
1135754399 16:25084356-25084378 GTTTTGTTTTCTTTTGAAACAGG - Intergenic
1135760917 16:25137448-25137470 CTTTTTTTTTCTTTTGTGACAGG + Intronic
1136249600 16:28995583-28995605 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1136447194 16:30329690-30329712 TTTTTGTTTTCTGTAGAGACGGG - Intergenic
1136698912 16:32115175-32115197 GTTTTGCTTTAAGTTGTTAGGGG - Intergenic
1136768696 16:32812648-32812670 GTTTTGCTTTAAGTTGTTAGGGG + Intergenic
1136799420 16:33058475-33058497 GTTTTGCTTTAAGTTGTTAGGGG - Intergenic
1136957092 16:34801425-34801447 GTTTTGCTTTAAGTTGTTAGGGG - Intergenic
1137455737 16:48616488-48616510 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1138081112 16:54092275-54092297 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1138275558 16:55731532-55731554 TTTTTGCTTTTTGTAGAGACAGG - Intergenic
1138648943 16:58446274-58446296 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1138904599 16:61315471-61315493 GTTTTGTTTTGTTTTGAGACTGG - Intergenic
1139103931 16:63802716-63802738 GTTTTTCTTTCTGTTCTAACAGG + Intergenic
1139443724 16:66983502-66983524 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1139899631 16:70317764-70317786 GTTTTTTTTTTTGTTGAGACAGG - Intronic
1140058219 16:71544397-71544419 GTTTTGTTTTGTATTGAGACAGG - Intronic
1140261057 16:73380055-73380077 CTTTTGCTTTCTCTTGTGCTTGG - Intergenic
1140467032 16:75190781-75190803 GTTTTGCTTGTTTTTGAGACGGG - Intergenic
1140567064 16:76055910-76055932 ATGTGGCTTTCTGCTGTGACAGG + Intergenic
1140925819 16:79582563-79582585 GTTTTTCTTTCTGTGGGCACTGG - Intergenic
1141022006 16:80506227-80506249 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1141031820 16:80595876-80595898 TTTTTGCTTTCTGTTGTTCTTGG - Intergenic
1141037344 16:80639851-80639873 CTTTTGCTTTCTGCTATAACAGG - Intronic
1141485012 16:84333214-84333236 GCTTTGCTCTCTGCTGTGACAGG - Intergenic
1141528862 16:84631845-84631867 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1141982167 16:87557307-87557329 GTTTTGCTTTCTGTTCAGCCTGG - Intergenic
1203071114 16_KI270728v1_random:1074756-1074778 GTTTTGCTTTAAGTTGTTAGGGG + Intergenic
1142543535 17:681138-681160 TTTTTGTTTTCTGTTTTGAGAGG + Intronic
1142634845 17:1250480-1250502 TTTTTGGTTTTTGTTGTTACTGG + Intergenic
1143208596 17:5165573-5165595 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1143273289 17:5691380-5691402 GTTTTATTTTTTGTAGTGACAGG - Intergenic
1144095474 17:11896586-11896608 ATTTGGGTTTCTGTTGTGAATGG - Intronic
1144097874 17:11918235-11918257 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1144211438 17:13018644-13018666 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1144309128 17:13996509-13996531 GTTTCTTTTTCAGTTGTGACTGG - Intergenic
1144482893 17:15642145-15642167 GTTTTGCATTCTCTTCTGAGTGG + Intronic
1144887627 17:18474395-18474417 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1144915791 17:18722886-18722908 GTTTTGCATTCTCTTCTGAGTGG - Intronic
1145012226 17:19375889-19375911 GTTTTCCTTTCTCTTGGGAGTGG - Intronic
1145117568 17:20225514-20225536 GTGTTGCTTTCTGCTGTGATGGG + Intronic
1145144589 17:20469905-20469927 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1145176042 17:20701307-20701329 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1145229037 17:21157686-21157708 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1145693062 17:26765419-26765441 GTTTTGCTTTAAGTTGTTAGGGG - Intergenic
1145709803 17:26962046-26962068 GTTTTGCTTTAAGTTGTTAGGGG - Intergenic
1145882421 17:28362082-28362104 GCTATGCTTTGTGTTGTCACAGG - Exonic
1146040640 17:29450515-29450537 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1146078767 17:29758039-29758061 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1146087748 17:29845729-29845751 GTTTTATTTTCTGTAGAGACAGG + Intronic
1146132123 17:30287196-30287218 GTTTTATTTTCTGTAGAGACAGG + Intronic
1146242675 17:31244568-31244590 GTGTTGCTTTCTGCTATGACAGG + Intronic
1146763375 17:35497084-35497106 GTTTTGTTTTTTGTAGAGACAGG - Intronic
1147127801 17:38384307-38384329 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1147180206 17:38679800-38679822 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1147222869 17:38949412-38949434 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1147322587 17:39655189-39655211 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1147474338 17:40695596-40695618 TTTTTGCTTTGTTTTGTTACAGG - Intergenic
1148078313 17:44952796-44952818 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1148145836 17:45364393-45364415 GTTTTGTTTTGTTTTGAGACTGG - Intergenic
1148184814 17:45634716-45634738 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1148196978 17:45720994-45721016 ATTTTGCTTTGTTTTGAGACAGG + Intergenic
1148235622 17:45966992-45967014 GTTTTGATGTCGGGTGTGACAGG + Intronic
1148616567 17:49004806-49004828 CTTCTGCTTTTTGTTTTGACAGG - Intronic
1148763178 17:50019620-50019642 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1149054515 17:52347074-52347096 GTTTTCCTTTCTGCTATGACAGG + Intergenic
1149058532 17:52393097-52393119 GTTTTGCTTTCTATTGTAAATGG - Intergenic
1149188438 17:54030000-54030022 ATGTTGCTTTCTGCTATGACAGG - Intergenic
1149249342 17:54749985-54750007 GTACTGCTTTCTACTGTGACAGG + Intergenic
1149489553 17:57073381-57073403 GTTTTGCTTTGTTTTGAGACAGG - Intergenic
1149721031 17:58843822-58843844 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1149830101 17:59864506-59864528 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1149887939 17:60359637-60359659 TTTTTGCTTTTTGTAGAGACAGG - Intronic
1149988240 17:61364700-61364722 GTTTTGTTTTGTTTTGAGACGGG - Intronic
1150105560 17:62460171-62460193 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1150125772 17:62633665-62633687 TTTTTTTTTTCTGTAGTGACTGG - Intronic
1150350799 17:64442992-64443014 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1150440634 17:65188548-65188570 GTGTTGGTTTCTTTTGTTACAGG - Intronic
1150541393 17:66103872-66103894 CTGTTTCTTTCTGCTGTGACAGG - Intronic
1150658886 17:67058635-67058657 TTTTTGTTTTTTGTTGAGACAGG + Intergenic
1150722559 17:67625990-67626012 GTTTTGGTTTTTTTTGAGACAGG + Intronic
1150735592 17:67734493-67734515 GTTTTGCTTTGTTTTGAGATGGG + Intronic
1150787428 17:68174327-68174349 CTTTTGCTTTGTCTTGTCACGGG - Intergenic
1150800095 17:68274458-68274480 GTTTTGTTTTTTCTTGAGACAGG - Intronic
1150981609 17:70148496-70148518 ATTTTGCTTTCTTTTGTTAGTGG + Intergenic
1152534934 17:80945120-80945142 TTTTTGTTTTTTGTTGAGACAGG - Intronic
1152550066 17:81025050-81025072 GTTTTGTTTTGTTTTGAGACGGG - Intergenic
1152557889 17:81063616-81063638 GTTTTGCTTTCTGTGTTTGCAGG + Intronic
1153074541 18:1147899-1147921 GTTTGGCTTTCTGCTATGACAGG - Intergenic
1153129140 18:1834592-1834614 GTTTTACTTTCTGCTATGATAGG - Intergenic
1153296540 18:3551782-3551804 TTTTTTCTTTCTTTTGAGACAGG + Intronic
1153365382 18:4249757-4249779 ATTTTGCTTTCTGTAGAGACGGG + Intronic
1153440464 18:5112463-5112485 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1153783035 18:8510945-8510967 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1154049951 18:10944774-10944796 GTTTTGCTTTTGGTTGTCTCTGG - Intronic
1154085900 18:11305422-11305444 GTTTTGCTCTCTGCTATAACGGG + Intergenic
1154085981 18:11305842-11305864 GTTCTTCTTTCTGCTGTGACAGG + Intergenic
1154254096 18:12767856-12767878 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1154407384 18:14106840-14106862 GTTTTGCTTTCTGCTGTGATAGG - Intronic
1154408283 18:14117705-14117727 TCTTTGCTTTCTGCTGTGATTGG - Intronic
1154518477 18:15198710-15198732 GTTTTGCTTTAAGTTGTTAGCGG + Intergenic
1155137913 18:23014889-23014911 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1155181407 18:23351399-23351421 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1155767352 18:29652417-29652439 GTGTTTCTTTTTGCTGTGACAGG - Intergenic
1155873943 18:31061945-31061967 GTTTTGCTTTCTGGGGAGAGGGG - Exonic
1156021670 18:32606471-32606493 GTGTTGCTTTCTGCTGTTACAGG + Intergenic
1156080782 18:33332579-33332601 GTTTTGCTTTGCTTTGAGACAGG + Intronic
1156094157 18:33509658-33509680 GTTTTGCTTTCTGTTGTGACAGG - Intergenic
1156155714 18:34300069-34300091 GTTTTACTTTCTGCTGTGACAGG - Intergenic
1156618571 18:38820402-38820424 CTTTTTCTTTCTATTGTGAAAGG - Intergenic
1156912485 18:42426805-42426827 GTTTTACTTTCCACTGTGACAGG + Intergenic
1156996720 18:43477995-43478017 CTTTTTCTTTCTGTAGTTACAGG + Intergenic
1157022740 18:43806032-43806054 GTTTTGCTTTCTGCTGTGCCAGG + Intergenic
1157151204 18:45220553-45220575 GTCTGTCTTTCTGTTGTCACAGG + Intronic
1157440427 18:47707454-47707476 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1157548526 18:48564622-48564644 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1158329366 18:56344664-56344686 GATTTTCTTTCTTTTGTGAAAGG - Intergenic
1158949167 18:62475770-62475792 GCTTTGCTGTCTGCTGTGACAGG + Intergenic
1159130839 18:64278613-64278635 GTTCTGCTTTCCATTGTGACAGG + Intergenic
1159212492 18:65343714-65343736 GTTTTCCTTTCTGTTCTAACAGG + Intergenic
1159731493 18:72033542-72033564 GTTTTTCTTTCTGCTATAACAGG + Intergenic
1159896601 18:74002399-74002421 GCTTTGCCTTCTGTTATGACAGG + Intergenic
1160062555 18:75546307-75546329 GTTTTGGTTTATATTGTTACTGG + Intergenic
1160068015 18:75595668-75595690 GTGTTGCTTTATTTAGTGACAGG - Intergenic
1160913480 19:1485976-1485998 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1161059068 19:2205697-2205719 GTTTTGTTTTTTTTTGAGACAGG + Intronic
1161176235 19:2843872-2843894 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1161290030 19:3488919-3488941 GTTTTGTTCTGTGTTGAGACAGG - Intergenic
1161368036 19:3892370-3892392 GTTTTATTTTCTGTAGAGACAGG + Intronic
1161381151 19:3965668-3965690 GTTTTGTTTTGTCTTGAGACAGG + Intronic
1161435348 19:4259549-4259571 GTTTTTATTTCTGTAGAGACAGG + Intronic
1161646876 19:5458510-5458532 GTTTTTGTTTTTGTTGAGACAGG - Intergenic
1161754780 19:6124275-6124297 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1162217102 19:9145292-9145314 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1162517361 19:11156700-11156722 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1162535162 19:11259055-11259077 CTTTTTCTTTCTTTTGAGACAGG + Intronic
1162915397 19:13871991-13872013 GTTTTGTTTTGTTTTGAGACGGG - Intronic
1163001135 19:14368092-14368114 GTTTTGTTTTGTTTTGAGACGGG - Intergenic
1163105526 19:15120924-15120946 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1163185548 19:15636568-15636590 ATGTTGCTTTCTGCTGTGACAGG + Intronic
1163275955 19:16284332-16284354 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1163306057 19:16479750-16479772 GTTTTGTTTTGTTTTGAGACGGG - Intronic
1163308563 19:16498098-16498120 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1163527115 19:17828259-17828281 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1163553431 19:17979055-17979077 GTTTTGTTTTTTGTTTTGAGAGG - Intronic
1163568768 19:18067865-18067887 TTTTTTCTTTCTGTAGAGACGGG + Intronic
1163573123 19:18094788-18094810 GTTTTGTTTTGTTTTGGGACAGG - Intronic
1163690188 19:18734510-18734532 TTTTTTCTTTCTGTAGAGACAGG - Intronic
1164490939 19:28714024-28714046 GTTTTCCTTTCTGCTGTGGCAGG - Intergenic
1165169233 19:33879589-33879611 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1165236415 19:34425549-34425571 GTTTTGTTTTTTGTAGAGACAGG + Intronic
1165645273 19:37430933-37430955 GTGTTGCCTTCTGCTGTGACAGG - Intronic
1165873362 19:38988881-38988903 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1166370630 19:42298655-42298677 CTTTTGTTTTCTGGTGAGACAGG + Intronic
1166513377 19:43426508-43426530 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1166674036 19:44728369-44728391 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1167030413 19:46955591-46955613 TTTTTGTTTTGTTTTGTGACAGG + Intronic
1167235762 19:48313875-48313897 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1167243611 19:48360176-48360198 GTTTTGCTTCCTGAGGTAACAGG - Exonic
1167321758 19:48800991-48801013 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1167378654 19:49125955-49125977 GTTTTGTTTTTTTTTGAGACTGG + Intronic
1167582302 19:50352406-50352428 GTTTTGCTTTCCACTGTGACAGG + Intronic
1167840214 19:52110639-52110661 GTTGTGGCGTCTGTTGTGACAGG - Intergenic
1168113054 19:54205820-54205842 GTATTGTTTTGTTTTGTGACAGG + Intronic
1168150635 19:54446059-54446081 GTTTTGGTTTTTGCTGTGACTGG + Intergenic
1168448964 19:56448226-56448248 ACGTTGCTTTCTGCTGTGACAGG - Intronic
1168615563 19:57834275-57834297 GTTTTGCTTTCTGCTATGACAGG + Intronic
1168621221 19:57881172-57881194 GTTTTGCTTTCTGCTATGACAGG - Intronic
1202683057 1_KI270712v1_random:28339-28361 GTTTTGCTTTAAGTTGTTAGGGG - Intergenic
925484833 2:4316478-4316500 GTATTGCTTTCCATTATGACAGG + Intergenic
925548117 2:5040475-5040497 GTTTTGCCTTTTGTAGTGAAAGG - Intergenic
925589716 2:5497493-5497515 GTTTTGATTTTTGCTGTGACAGG - Intergenic
925706956 2:6694753-6694775 GTCTTGTTTTCTGTTGTCATTGG - Intergenic
925952921 2:8932421-8932443 GTATTGCATTGTATTGTGACTGG - Intronic
926518754 2:13883460-13883482 GTATTGCTTTCTGCTGTGACAGG - Intergenic
926600808 2:14843807-14843829 GTTTTGCTTTCCGCTGTGATAGG - Intergenic
926601930 2:14854675-14854697 GTTTTCCTTTCTGCTCTAACAGG - Intergenic
926726893 2:16005380-16005402 TTTTTTCTTCCTTTTGTGACAGG + Intergenic
927001751 2:18802726-18802748 GTTTTGCTTTCTTCTGTGAGGGG + Intergenic
927424886 2:22970851-22970873 GTTTTTCTTTCTGCTATAACGGG - Intergenic
927570400 2:24153959-24153981 GCTTTATTCTCTGTTGTGACAGG + Intronic
927692872 2:25220713-25220735 GTTTTGTTTTGTTTTGCGACAGG + Intergenic
927752556 2:25682566-25682588 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
928140295 2:28723006-28723028 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
928293448 2:30060653-30060675 GATTTGCTTTCTGCCGTGGCAGG - Intergenic
928326862 2:30326119-30326141 GTTATGATGTCTGTTGTGATGGG - Intergenic
928458766 2:31450225-31450247 ATTTTGCTTTCTGCTATAACAGG - Intergenic
928468054 2:31541823-31541845 GCTTTACTTTCCATTGTGACAGG - Intronic
928483961 2:31711040-31711062 ATGTTGCTTTCTGCTGTGACAGG - Intergenic
928563508 2:32517334-32517356 GTTTAGGTTTTTGTTGAGACAGG - Intronic
928588514 2:32788594-32788616 GCTTGTCTTTCTGTTGTGAGTGG + Intronic
928750133 2:34460693-34460715 ATATTGCTTTCTGCTGTGACAGG + Intergenic
928781781 2:34831288-34831310 GTTTTGCTTTCTGCTGTGACAGG + Intergenic
928834848 2:35531016-35531038 GTTTTGCTTCCTGCCGTGACAGG + Intergenic
928864111 2:35896289-35896311 ATGTTGCTTTCTGCTGTGACAGG + Intergenic
928981914 2:37144890-37144912 GTTTTGTTTTGTTTTGAGACAGG + Intronic
929281834 2:40088155-40088177 GTGTTGCTTTCTGCTGTGATAGG + Intergenic
929635259 2:43512841-43512863 GTTTTTCTTTCCTTTGTGGCAGG - Intronic
929844823 2:45513007-45513029 ATTTTGCTTTCTGTTGTCAGAGG - Intronic
929942203 2:46342853-46342875 GTTTTGTTTTATCTTTTGACTGG + Intronic
930227135 2:48805264-48805286 GTTTTGTTTTGTTTTGTGACAGG - Intergenic
930439781 2:51391173-51391195 CCTTTGCTCTCTGTTGTCACAGG + Intergenic
930640249 2:53847241-53847263 ATTTTGTTTTGTTTTGTGACAGG + Intergenic
930657662 2:54022385-54022407 GTTTTGTTTTGTTTTGAGACAGG + Intronic
930705401 2:54500549-54500571 GTTTTGTTTTGTTTTGAGACAGG + Intronic
930726781 2:54689453-54689475 GTTTTTGTTTCTATTGTGAATGG - Intergenic
930895543 2:56441364-56441386 ATGTTGCTTTGTGCTGTGACAGG + Intergenic
931162046 2:59703068-59703090 GTTTTCCTTTCTGCTGTAGCAGG + Intergenic
931506249 2:62930240-62930262 GTTTTGTTTTGTCTTGAGACAGG - Intronic
931572150 2:63680433-63680455 GTTTTGCTTTCCACTGTGACAGG - Intronic
931683435 2:64771487-64771509 GTTTTGCTTTATTTTCTTACTGG - Intergenic
931849814 2:66241058-66241080 GTTTTGCTTTCTGGTGATAATGG - Intergenic
932044922 2:68338917-68338939 GTTTTGTTTTGTTTTGTGACAGG - Intergenic
932259847 2:70318013-70318035 ATTTTACTTTCTGTAGAGACGGG + Intergenic
932491008 2:72120387-72120409 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
932511274 2:72294455-72294477 GTTTTCCTTTTTGTAGAGACGGG + Intronic
932858891 2:75267644-75267666 GTTTTGTTTTTTGCTGTGACAGG + Intergenic
932993861 2:76824275-76824297 GTTTTGCATTCTCTTTCGACTGG + Intronic
933441836 2:82324553-82324575 GTCCTGCTTCCTGTTGTCACAGG + Intergenic
933576978 2:84080224-84080246 GTTTTGCTTTCTGCTATGACGGG + Intergenic
933636985 2:84719514-84719536 GTTTTGTTTTGTTTTGAGACAGG + Intronic
933838315 2:86264041-86264063 GTGTTGCTTTCTGTTTCAACAGG - Exonic
933979397 2:87538149-87538171 GTTTTGCTTGCTCTTCTGCCTGG - Intergenic
934248740 2:90326834-90326856 GTTTTGCTTTAAGTTGTTAAGGG + Intergenic
934260839 2:91476649-91476671 GTTTTGCTTTAAGTTGTTAGGGG - Intergenic
934304164 2:91808599-91808621 GTTTTGCTTTAAGTTGTTAGGGG - Intergenic
934329091 2:92044151-92044173 GTTTTGCTTTAAGTTGTTAGGGG + Intergenic
934467310 2:94274074-94274096 GTTTTGCTTTAAGTTGTTAGGGG + Intergenic
934707963 2:96497926-96497948 GTTCAGGTATCTGTTGTGACTGG - Exonic
934766125 2:96881098-96881120 GTTTTGTTTTCTGTGGAGTCGGG - Intronic
934870516 2:97861036-97861058 ATTTTGCTTTCTGCTGTGACAGG - Intronic
934928865 2:98404093-98404115 GAGTTGCTTTCTGCTATGACAGG - Intergenic
935018940 2:99212084-99212106 GTGTTGCTTTTGGCTGTGACAGG + Intronic
935137429 2:100320631-100320653 GGTTTGCTTTCTGGTTTCACCGG - Intronic
935139597 2:100341091-100341113 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
935257547 2:101324973-101324995 GTTCTGCTTTCTTTTGTGTTAGG + Intergenic
935320984 2:101889095-101889117 GTTTTGCTTTTTGCTATGAGGGG + Intronic
935639439 2:105276916-105276938 TTTTTGCTTTATTTTGTGAGGGG - Intronic
935677515 2:105608863-105608885 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
935812828 2:106816959-106816981 GTGTTGCTTTCTGCTGTAACAGG - Intronic
936026787 2:109037141-109037163 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
936314428 2:111412642-111412664 GTTTTGCTTGCTCTTCTGCCTGG + Intergenic
936949433 2:117963195-117963217 GTTCTGCTGTCTGTTTTCACTGG - Intronic
937134589 2:119541929-119541951 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
937189096 2:120076313-120076335 GTTTTGTTTTTTTTTGAGACAGG + Intronic
937341115 2:121091152-121091174 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
937496576 2:122426555-122426577 GTTTTGCTTTGTTTTGAGACTGG + Intergenic
937559662 2:123206174-123206196 GTTTTGCTTTCTGCTGTGACAGG + Intergenic
937717124 2:125045311-125045333 GTTTTGCTTGTTTTTGTAACTGG - Intergenic
937753687 2:125510002-125510024 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
938025035 2:127940270-127940292 GTTTTGTTTTGTTTTGAGACTGG - Intergenic
938102759 2:128508440-128508462 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
938518458 2:132039209-132039231 GTTTTGCTTTAAGTTGTTAGGGG + Intergenic
938954610 2:136286240-136286262 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
939126729 2:138186678-138186700 GCTTTTCTTTCTGTTGAGACAGG + Intergenic
939144428 2:138395751-138395773 GTTTTGCTTTCTGTTGTGACGGG - Intergenic
939405183 2:141746404-141746426 GTTTTGCTTTCAGCTGTGACAGG + Intronic
939443301 2:142276657-142276679 GTTTTCCTTTCTGCTCTAACAGG + Intergenic
939710398 2:145509830-145509852 GTTTTTCTTTCTGCTATTACAGG + Intergenic
939732270 2:145799210-145799232 GTTTTGATTTTTTTTGAGACAGG - Intergenic
940057814 2:149531643-149531665 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
940152110 2:150614041-150614063 GTTTTGCTATGTGTTGTGAATGG - Intergenic
940226448 2:151406330-151406352 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
940402665 2:153265427-153265449 GTGTTGCTTTCTACTGTGACAGG + Intergenic
940444050 2:153754951-153754973 GTTTTGCTTTCTTCTATAACAGG + Intergenic
940468573 2:154064122-154064144 TTTTTGCTTTCTGTTGTGACAGG - Intronic
940503918 2:154528171-154528193 GTTTTGTTTTCTGCTATAACAGG + Intergenic
940722433 2:157297192-157297214 GCTTGGCTTTCTGTTGGGGCTGG - Intronic
941045941 2:160676076-160676098 GTTTTTCTTTTTTTTGAGACAGG + Intergenic
941138574 2:161747314-161747336 GTGTTGTTTTCTGCTGTGACAGG + Intronic
941184250 2:162301837-162301859 GTTCTGCTTTCTGAAGTCACTGG - Intronic
941256165 2:163233940-163233962 GTTTTACTTTCTCTTGTAAGTGG + Intergenic
941357384 2:164510996-164511018 GTTTTGCTTTCCACTGTGACAGG - Intronic
941411201 2:165159360-165159382 GTTTTGTTTTCTTTTGAGACAGG + Intronic
941528347 2:166632977-166632999 GTGTTGCTTTCTGCTATGACAGG + Intergenic
941707537 2:168675578-168675600 GTTTTGTTTTGTTTTGAGACAGG - Intronic
941742141 2:169046647-169046669 GTGTTGCTTTCCACTGTGACAGG - Intergenic
941746090 2:169088244-169088266 GTGTTGCTTTCCACTGTGACAGG + Intronic
941851922 2:170191584-170191606 GTGTTACTTTCTACTGTGACAGG + Intronic
941931567 2:170946015-170946037 GTTTTGTTTTGTTTTGAGACAGG + Intronic
941940591 2:171033198-171033220 GTTTTGTTTTGTTTTGAGACAGG - Intronic
942044125 2:172089435-172089457 TTTTTGCGTTCTGTTGTGTGTGG + Exonic
942060530 2:172224950-172224972 TTTTTACTTTCTGTAGAGACAGG + Intergenic
942273076 2:174296818-174296840 GTTTGGTTTTCTTTTGAGACAGG - Intergenic
942391891 2:175503315-175503337 GCTTTGCTCTTTGCTGTGACAGG + Intergenic
942740407 2:179170193-179170215 TTTTTGCTTTCTGATTTCACAGG - Intronic
942778596 2:179613970-179613992 GTGTTGTTTTCTGTTGTGACAGG + Intronic
942850999 2:180485347-180485369 AATTTGCTTTTTGTAGTGACAGG - Intergenic
942972374 2:181971822-181971844 ATGTTGCTTTCTGTTGTGCCAGG + Intronic
943117603 2:183692395-183692417 GTTTTGCTTTCTACTGTGACAGG + Intergenic
943208325 2:184928791-184928813 ATTTTGCTTTCTGTTGTGGCAGG + Intronic
943302617 2:186223048-186223070 GTATTGTTTTCTAGTGTGACAGG - Intergenic
943318670 2:186419085-186419107 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
943326315 2:186502362-186502384 CTTTTTCTTTTTGTTGAGACGGG - Intronic
943427994 2:187759904-187759926 GTTTTGCTTTCTGCTGTGACAGG + Intergenic
943485541 2:188474495-188474517 GTTTTCCTTTTTGTTATAACAGG + Intronic
943694485 2:190909868-190909890 GTTTTATTTTCTGTAGAGACAGG - Intronic
944078475 2:195758779-195758801 GTGTTGCTGTCTTCTGTGACAGG - Intronic
944096048 2:195968884-195968906 GTTTTGCTTTCTGCTGCAACAGG + Intronic
944105091 2:196071022-196071044 GTATTTCTTTCTTTTGTGACTGG - Intergenic
944287337 2:197966498-197966520 GTATTGCTTTCTGCTGTGACAGG + Intronic
944616546 2:201465862-201465884 GTGTTGCTCTCTGCTGTGACAGG + Intronic
944772640 2:202930051-202930073 GTTTTGTTTTGTTTTGAGACAGG + Intronic
944806444 2:203286274-203286296 GTTTTCTTTTCTTTTGAGACAGG - Intronic
944855207 2:203760466-203760488 GTGTTGCTTTCTGCTGTGGCAGG + Intergenic
944954943 2:204798290-204798312 TTGTTGCTTTCTGCTGTGACAGG - Intronic
945082352 2:206098717-206098739 GTTTTTCTTTTTGTAGAGACAGG + Intergenic
945086195 2:206135022-206135044 GTTTTTTTTTCTTTTGAGACAGG + Intronic
945127530 2:206529402-206529424 CTTTTTCTTTCTTTTGAGACAGG + Intronic
945334328 2:208573539-208573561 GTGTTGCTTTCCACTGTGACAGG - Intronic
945371776 2:209027292-209027314 GCTCTGCTTTCTTTTGTGAAGGG + Intergenic
945455153 2:210043381-210043403 GTTTTGTTTTGTTTTGAGACAGG - Intronic
945610144 2:211990853-211990875 GTTTAGATTTCTTATGTGACTGG + Intronic
945634445 2:212330239-212330261 GTTTTGTTTTCTGTTGGTAATGG + Intronic
945739859 2:213646010-213646032 GTTTTCTTTTCTGTTCTAACAGG + Intronic
945771159 2:214044776-214044798 GTTTTGCTTTGTGCTGTGACAGG - Intronic
945803845 2:214465886-214465908 ATGTTGCTTTCTGCTGTGACAGG + Intronic
946002709 2:216496133-216496155 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
946808407 2:223496238-223496260 GTTTTGTTTTTTTTTGAGACGGG - Intergenic
946829404 2:223712525-223712547 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
947009270 2:225547569-225547591 GTTTTGCTTTCCTCTGTGATAGG + Intronic
947198510 2:227594019-227594041 CTTTTTCTTTCTGTGGGGACAGG - Intergenic
947312457 2:228818948-228818970 GTTTTCCTTTCTGCTCTAACAGG + Intergenic
947439852 2:230109720-230109742 GCTTTGTTCTCTGCTGTGACAGG + Intergenic
947572006 2:231243405-231243427 TTTTTTCTTTCTTTTGAGACAGG - Intronic
947630027 2:231646369-231646391 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
947728068 2:232412207-232412229 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
947951985 2:234156083-234156105 GCTTTGTTTTCTGTTGTGATTGG - Intergenic
947965875 2:234281157-234281179 GTTTTGCTTTCAGCTGTGTGAGG - Intergenic
948384208 2:237571624-237571646 GTTTTGCTTTTTGTAGAAACAGG + Intergenic
1168742177 20:201143-201165 GTTTTCCTTTCTGCTCTAACTGG + Intergenic
1168803274 20:657609-657631 CTTTTTCTTTCTTTTGAGACAGG + Intronic
1168877740 20:1182810-1182832 GTTTTGCTTTGTTTTGTTCCTGG + Intronic
1169025868 20:2370792-2370814 GTCTGGCTTTCTGTAGTGACTGG + Intergenic
1169182430 20:3581244-3581266 CCTTTGCTTTCTTTTGAGACAGG - Intronic
1169237844 20:3946447-3946469 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1169597187 20:7213918-7213940 GTGTTGCTTTCTACTGTGACAGG - Intergenic
1169623828 20:7540248-7540270 GTGTTGCTTTCCACTGTGACAGG - Intergenic
1169686902 20:8285585-8285607 GTTTAACTTTCTGTTTGGACTGG + Intronic
1169818496 20:9683722-9683744 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1169818762 20:9686398-9686420 GTTTTGTTTTATTTTGAGACAGG + Intronic
1169988615 20:11474283-11474305 GTGTTGCTTTCTGCTATGACAGG - Intergenic
1169994117 20:11537252-11537274 GTATTGCTTTCTCTTGTTAATGG - Intergenic
1170062651 20:12275902-12275924 GTGTTGCTTTATGCTGGGACAGG - Intergenic
1170129696 20:13005770-13005792 GTTTTGCACACTGTTGTGATTGG - Intergenic
1170161428 20:13316305-13316327 CTAGTGCTTTCTGTTTTGACAGG - Intergenic
1170311411 20:14996741-14996763 GTGTTGCTTTCTGCTGTGACAGG - Intronic
1170449746 20:16470487-16470509 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1171326552 20:24298796-24298818 GGTATGTTTTCTTTTGTGACTGG + Intergenic
1171937878 20:31293307-31293329 GTTTTTCTTTCTGCTCTAACAGG - Intergenic
1172045195 20:32075196-32075218 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1172059949 20:32180570-32180592 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1172608060 20:36228784-36228806 GTTTTCCTTTCTGTTGTCCGTGG - Intronic
1172943685 20:38672089-38672111 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1172993855 20:39055568-39055590 TTTTTGTTTTTTGTTGAGACAGG - Intergenic
1173287274 20:41684119-41684141 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1173361422 20:42347828-42347850 GTTTGGCTTTCTATTGTGCATGG + Intronic
1173511700 20:43634402-43634424 GTTTCACTTTCTTTGGTGACTGG - Intronic
1174008113 20:47426741-47426763 GTTTTGTTTTCTGTAGAAACGGG - Intergenic
1174652522 20:52139741-52139763 CTTTTGGTTTCTGATGTTACTGG - Intronic
1174695404 20:52551780-52551802 GTGTTGCTTTCCGCTGTGACAGG + Intergenic
1174811950 20:53653611-53653633 GTTTTGATTTTTTTTGAGACAGG + Intergenic
1174813800 20:53669637-53669659 GTTTTGTTTTCTTTTGAGACAGG + Intergenic
1174938421 20:54897745-54897767 GTGCTGCTTTCCGTTGTTACAGG - Intergenic
1176187076 20:63786515-63786537 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1176417014 21:6482088-6482110 CTTTTGCTTGCTGTTGAGTCAGG - Intergenic
1176586552 21:8594242-8594264 GTTTTGCTTTAAGTTGTTAGGGG - Intergenic
1176743252 21:10626952-10626974 GTTTTGCTTTAAGTTGTTAGCGG - Intergenic
1176940057 21:14912589-14912611 CTTTTGCTTTCTGCTATAACAGG + Intergenic
1177329083 21:19632829-19632851 GTTTTGTTTTCTGTTATAGCAGG - Intergenic
1177456233 21:21343615-21343637 GTTTTCCTTTCTGCTCTAACAGG - Intronic
1177467331 21:21503466-21503488 CTATTCCTCTCTGTTGTGACAGG - Intronic
1177692703 21:24531938-24531960 ATGTTGCTTTCTGCTTTGACAGG - Intergenic
1177771196 21:25518612-25518634 CTATTACTTTCTGCTGTGACAGG - Intergenic
1177907194 21:26986367-26986389 GTTTTGTTTTGTTTTCTGACTGG - Intergenic
1177969907 21:27777108-27777130 GTTCTGCTTTCTGCTATGACAGG - Intergenic
1178271453 21:31193599-31193621 ATTTTGCTTTGTGTTGATACAGG + Intronic
1178543072 21:33471269-33471291 GTATTGCTTTTTATTGTAACAGG - Intronic
1179215689 21:39365551-39365573 GTTTTTTTTTTTTTTGTGACTGG + Intergenic
1179224357 21:39440528-39440550 GTTTTGTTTTTTTTTGAGACAGG - Intronic
1179232120 21:39513774-39513796 GTTTTGCTTTGTTTTGTTTCTGG - Intronic
1179556129 21:42177820-42177842 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1179692512 21:43090421-43090443 CTTTTGCTTGCTGTTGAGTCAGG - Intergenic
1179834823 21:44023782-44023804 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1180269360 22:10571147-10571169 GTTTTGCTTTAAGTTGTTAGGGG - Intergenic
1180281203 22:10698425-10698447 GTTTTGCTTTAAGTTGTTAGCGG - Intergenic
1180534486 22:16386295-16386317 GTTTTGCTTTAAGTTGTTAGGGG - Intergenic
1180721146 22:17909517-17909539 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1180859319 22:19068216-19068238 CTTTTGCTTTCAGAAGTGACCGG - Exonic
1180947245 22:19703142-19703164 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1181119085 22:20653481-20653503 CTTTGCCTTTCTGTTGTCACTGG + Intergenic
1181325384 22:22040759-22040781 TTCTTGCTTTCTGATGTGGCTGG - Intergenic
1181336915 22:22142778-22142800 GTTTTGCTTTCTGAGATAACGGG - Intergenic
1181594378 22:23904832-23904854 GTTTTGTTTTCTGTTGCCAGGGG + Intergenic
1181716745 22:24736813-24736835 GTTCTGCTTTCTGCTGTGACAGG - Intronic
1181829069 22:25544895-25544917 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1181946277 22:26520159-26520181 GTTTTGTTTTCTTTTGAGACAGG + Intergenic
1182170784 22:28226928-28226950 TTTTTGTTTTGTTTTGTGACAGG + Intronic
1182172236 22:28243349-28243371 GTTTTGTTTTGTTTTGAGACGGG - Intronic
1182480949 22:30608391-30608413 GTTTTGTTTTTTGTTGAGAGAGG + Intronic
1182652757 22:31865487-31865509 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1182704122 22:32264563-32264585 GTTTTGTTTTGTTTTGAGACTGG - Intergenic
1183256616 22:36766493-36766515 GTTTAGCATTCTGTTCTGCCAGG - Intronic
1183452072 22:37902043-37902065 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1183820470 22:40341893-40341915 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1183902335 22:41015824-41015846 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1184037290 22:41924640-41924662 GTTTTGGTTTTTTTTGAGACAGG - Intergenic
1184804986 22:46788958-46788980 TTTCTGCTTGCTGTGGTGACAGG + Intronic
1203289365 22_KI270735v1_random:18491-18513 GTTTTGCTTTAAGTTGTTAGGGG + Intergenic
949093708 3:60924-60946 GTTTTGCTTTGTTTTGAGACAGG + Intergenic
949149290 3:745293-745315 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
949235813 3:1806838-1806860 GTTTTGCTTTCTATTATAACAGG + Intergenic
949596993 3:5558560-5558582 TTTTAGCTTTCTGCTGTGGCTGG + Intergenic
950460247 3:13117231-13117253 GATTTGCTTTCTCTGATGACTGG - Intergenic
950511623 3:13432112-13432134 AATTTGCTTTCTTTTGTAACAGG + Intergenic
950613904 3:14144197-14144219 ATTTTGCTTCCTGTTCTGAAAGG + Intronic
950695767 3:14700009-14700031 ATTTTGCTTTCCACTGTGACAGG + Intronic
951004903 3:17604129-17604151 GTTTTGTTTTTTGTAGAGACAGG + Intronic
951029397 3:17864076-17864098 GTGTTGCTTTCTGCTGTGACTGG + Intronic
951032350 3:17896157-17896179 GTTTTTCTTTCTGCTCTAACAGG + Intronic
951181812 3:19668273-19668295 GTTTTGCTTTGTATTGTAACAGG - Intergenic
951255055 3:20439098-20439120 GCTTTGCTCTCTGCTGTGACAGG - Intergenic
951322968 3:21269928-21269950 GTTTTGCTTTGTGTTGTTTTGGG - Intergenic
951352417 3:21622386-21622408 GCTTTCCTTTCTGCTTTGACAGG - Intronic
951379647 3:21968152-21968174 ATGTTGCTTTCCGCTGTGACTGG - Intronic
951393071 3:22130549-22130571 GTGTTGCTTTCTGCTGTGACAGG + Intronic
951492192 3:23283745-23283767 GTTTTGTTTTGTTTTGAGACAGG - Intronic
951495162 3:23317341-23317363 GCATTGCTTTCTGCTGTGACAGG + Intronic
951794629 3:26524457-26524479 GTTTTTCTTTCTGCTCTAACAGG + Intergenic
951838561 3:27008502-27008524 GAGTTGCATTCTGTTTTGACAGG - Intergenic
951904183 3:27688078-27688100 GTTTTCCTTTCTGCTCTAACAGG - Intergenic
952149115 3:30567280-30567302 GTTTTTCTTTCTGCTCTAACAGG - Intergenic
952192584 3:31039394-31039416 GTTTTGCTGACTGTGGTGGCTGG - Intergenic
952295681 3:32059904-32059926 TTTTTTCTTTCTTTTGAGACAGG - Intronic
952317126 3:32240791-32240813 GTTTTGTTTTGTTTTGAGACAGG + Intronic
952356999 3:32593567-32593589 TTTTTTCTTTCTGTAGAGACGGG + Intergenic
952367808 3:32690388-32690410 GTTTTGTTTTGTTTTGAGACAGG + Intronic
952518010 3:34125089-34125111 GTGTTTCTTTCTTCTGTGACAGG + Intergenic
952518844 3:34133789-34133811 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
952566741 3:34668455-34668477 GGTTTGCTTTCCGCTGTGACAGG - Intergenic
952688483 3:36176198-36176220 GTGTTGCTTTCCACTGTGACAGG + Intergenic
952812009 3:37412286-37412308 GTGTTGTTTTCTGCTGTGACAGG + Intronic
953455943 3:43042474-43042496 CTTTTGTTTTCTTTTGAGACAGG - Intronic
953722460 3:45368507-45368529 GTTTTCCTTTCTGCTCTAACAGG - Intergenic
954025318 3:47778487-47778509 GTTTTGTTTTGTTTTGAGACAGG + Intronic
954065056 3:48099129-48099151 GCTTTGCTCTCTGGTGTGAGAGG + Intergenic
954585928 3:51736833-51736855 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
954679770 3:52337795-52337817 GTTTTGTTTTGTTTTGAGACAGG + Intronic
954765759 3:52914736-52914758 GTTTTGTTTTGTTTTGAGACAGG - Intronic
955585330 3:60471464-60471486 GTGTTGCTTTCTACTGTGACAGG + Intronic
956206618 3:66761717-66761739 GTTTTGCTTTGTTTTGAGACAGG + Intergenic
956506891 3:69950287-69950309 GTTTTGCTTTGTTTTGAGACAGG - Intronic
956899915 3:73704595-73704617 GTTTTATTGTCTGTTGTGCCAGG - Intergenic
956957252 3:74355458-74355480 GTTTTGTTTTGTTTTGAGACAGG + Intronic
957018974 3:75102067-75102089 ATGTTGCTTTCTGCTGTGAGAGG + Intergenic
957057784 3:75457396-75457418 TTTTTGTTTTCTTTTGAGACAGG - Intergenic
957085844 3:75675692-75675714 GTTTTCCTTTCTGCTCTAACAGG + Intergenic
957120880 3:76090418-76090440 GTTTTTGTTTTTGTTTTGACAGG - Intronic
957485593 3:80858461-80858483 GTGTTGCTTTCCGCTGTCACAGG - Intergenic
957924715 3:86793741-86793763 GTTTTGCTTCCTGTGTTGAATGG + Intergenic
957976224 3:87448140-87448162 ATGTTGCTTTCTGCTGTGACAGG + Intergenic
958085404 3:88799014-88799036 GTTTTGCTTTCTGCTATTACAGG + Intergenic
958147008 3:89639325-89639347 GTGTTTCTTTCTTCTGTGACAGG - Intergenic
958670520 3:97197929-97197951 GCATTGCTTTCTACTGTGACAGG + Intronic
958765435 3:98361465-98361487 GTTTTGCTTTCTGTTATAACAGG + Intergenic
958822299 3:98989224-98989246 CTTTTGCCTTCTGCTGTGATTGG + Intergenic
958839866 3:99191131-99191153 GTTGTGCTTTCTGCTATGACAGG - Intergenic
959003829 3:100996473-100996495 GTTTCTCTTTCTGTGTTGACTGG + Intergenic
959118607 3:102206841-102206863 GTTTTGCTTTCTGCTGTGACAGG + Intronic
959189955 3:103098137-103098159 GTTTGGATGTCTGCTGTGACAGG + Intergenic
959409148 3:105998352-105998374 GTTTTGCTTTCTGCTGTGACAGG + Intergenic
959443868 3:106412969-106412991 GTTTTGATTTCTGTTGTGACAGG + Intergenic
959602053 3:108198445-108198467 GTTTTGTTTTGTTTTGAGACAGG + Intronic
959640238 3:108623889-108623911 GTATGGCTTTCTGATGTGACGGG + Intronic
959806707 3:110562807-110562829 GTGTTGTTTTCTGCTGTGACAGG + Intergenic
960067201 3:113386928-113386950 AAGCTGCTTTCTGTTGTGACAGG - Intronic
960094014 3:113670760-113670782 ATTTTGCTTTTTTTTGAGACAGG + Intronic
960153634 3:114275736-114275758 GTGTTGCTTTCCACTGTGACAGG + Intergenic
960692434 3:120361106-120361128 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
960869904 3:122238298-122238320 GCTTTTCTCTCTGCTGTGACAGG - Intronic
961193351 3:124981008-124981030 GTTTTGGTTTTTGTAGGGACAGG + Intronic
961304475 3:125947703-125947725 GTTTTTTTTTCTGTAGAGACAGG - Intergenic
961610299 3:128132130-128132152 GTGTTGCTTTCTGCTGTGACAGG - Intronic
961952188 3:130761858-130761880 GTTTTGCTTTCTGCTGTGATAGG - Intergenic
962038895 3:131683911-131683933 GTATTGCTTTCTGCTGTGATGGG + Intronic
962078826 3:132115146-132115168 GTGTTGTTTTCTGCTGTAACAGG + Intronic
962106423 3:132395356-132395378 GTTTTCCTTTCTGCTCTAACAGG - Intergenic
962151821 3:132901963-132901985 GTTTTTCTTTCTGCTCTGAGAGG - Intergenic
962193459 3:133335946-133335968 GTTTTGCTTTCTGTTGTGACAGG - Intronic
962483217 3:135815859-135815881 GTTTTGCTTTCTGCTCTGATAGG - Intergenic
962528862 3:136260077-136260099 GTTTTGTTTTGTTTTGAGACAGG + Intronic
962688275 3:137868314-137868336 GTTTTCCTTTCTGCTCTAACAGG - Intergenic
962699139 3:137979704-137979726 GTTTTGTTTTCTGTTATCAAAGG + Intergenic
962704792 3:138032618-138032640 GTTTTGCTTTGTTTAGAGACGGG + Exonic
962870963 3:139492441-139492463 GTGTTGCTTTTGGCTGTGACAGG + Intergenic
962997978 3:140650768-140650790 GTGTTGCTTTCTGCTGTGACAGG - Intergenic
963411232 3:144930883-144930905 GTTTTGTTTTCTGTTATAACAGG - Intergenic
963430578 3:145197013-145197035 GTGTTGCTTTCTGCTGTGAAAGG - Intergenic
963528848 3:146447937-146447959 TTGTTACTTTCTGTTATGACAGG + Intronic
963692170 3:148518719-148518741 GTTTCCCTTTCTGTTCTAACAGG - Intergenic
963927490 3:150966306-150966328 GTTTTGTTTTGTTTTGAGACTGG - Intronic
964021676 3:152021123-152021145 GTTTTGCTTTCTGCTATGACAGG - Intergenic
964140885 3:153397407-153397429 GTTTTGCTTTCCACTGTGACTGG + Intergenic
964179224 3:153864328-153864350 GTTCTGCTTTCTGCTGTGACAGG - Intergenic
964349691 3:155790708-155790730 ATGTTGCTTTCTGCTGTAACAGG - Intronic
964489452 3:157219784-157219806 GTTTTGCTTTGTTTTGAGACAGG + Intergenic
964686668 3:159403535-159403557 GTGTTGCTTTCCACTGTGACAGG - Intronic
964879590 3:161408779-161408801 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
964961053 3:162427391-162427413 GTTTTGCTTTCCACTGTGTCAGG - Intergenic
964965151 3:162482614-162482636 GTATTGCTTTCTGCTGTGACAGG + Intergenic
964976266 3:162623674-162623696 GTTTTCCTTTCTGCTCTAACAGG + Intergenic
965125447 3:164622255-164622277 GTTTTGTTTTTTGTTTTTACAGG - Intergenic
965181003 3:165403919-165403941 GTGTTGCTTTCCATTGTGACAGG - Intergenic
965236991 3:166136935-166136957 GTTTTGCTTTCTACTGTGACAGG + Intergenic
965250736 3:166341593-166341615 GTTTTTCTTTCTGCTATAACAGG - Intergenic
965253054 3:166368082-166368104 GTTTTGCTTTCTGTTGTGACAGG - Intergenic
965742500 3:171890457-171890479 GTTTTGCTTTCCACTGTGACAGG + Intronic
965784474 3:172321544-172321566 GTTTTGTTTTGTTTTGAGACAGG + Intronic
965843451 3:172934231-172934253 ATTTTCCTTTCTGTTCAGACTGG + Intronic
965853945 3:173065746-173065768 ATGTTGTGTTCTGTTGTGACAGG - Intronic
965980191 3:174681080-174681102 GTGTTTCTTTCTGCTGTGACAGG - Intronic
965988974 3:174792213-174792235 CTCTTTCTTTCTGTTGAGACAGG - Intronic
966252320 3:177879764-177879786 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
966454103 3:180095011-180095033 GTGTTACTTTCTCCTGTGACAGG + Intergenic
966463428 3:180203061-180203083 GTGTTGCTTTCTGCAATGACAGG - Intergenic
966758174 3:183390889-183390911 GTTTTGTTTTGTTTTGAGACAGG - Intronic
966864806 3:184251694-184251716 GTTTTGCTTTGTTTTGAGACAGG - Intronic
966985622 3:185177768-185177790 GTTTTGTTTGTTGTTGTGTCTGG - Intergenic
967111144 3:186295077-186295099 GTTTCTCTTTTTGCTGTGACAGG + Intronic
967359335 3:188611709-188611731 GTTTTGCTTTCTCTCATGTCTGG - Intronic
967631224 3:191744371-191744393 GTTTTCCTCTCTGTTCTAACAGG + Intergenic
967649068 3:191963321-191963343 GTTGGTCTTTCTGTTGTGGCCGG + Intergenic
967697059 3:192544129-192544151 GTGTTGCTGTCTGCTGTGACAGG + Intronic
968013945 3:195309946-195309968 GTTTTGCTTTCTTTTCTGAATGG - Intronic
968110229 3:196040096-196040118 GTTTTGTTTTGTTTTGAGACAGG + Intronic
968113112 3:196065982-196066004 GTTTTGTTTTTTTTTGAGACAGG - Intronic
968328362 3:197841836-197841858 GTTTTGTTTTGTTTTGTGACAGG + Intronic
968622111 4:1608481-1608503 GTCTTGCTCTCTGTTGTCCCAGG + Intergenic
968946335 4:3666551-3666573 ATTTTGCTTTATTTTGTCACAGG - Intergenic
969001649 4:3987403-3987425 TTTTTGTTTTCTTTTGAGACAGG - Intergenic
969155856 4:5209225-5209247 TTTTTTCTTTCTTTTGAGACAGG + Intronic
969752374 4:9121275-9121297 TTTTTGTTTTCTTTTGAGACAGG + Intergenic
970904837 4:21203521-21203543 GTTGTGATTTCTTTTCTGACTGG + Intronic
971577766 4:28298562-28298584 CTTCTGCTTTCTGTTTTGAAAGG + Intergenic
971807059 4:31372204-31372226 GTTTTGCTTTCTGCGGTGGGTGG + Intergenic
972225714 4:37008835-37008857 GTTAGGTTTTCTGTTGTGAATGG + Intergenic
972253681 4:37331925-37331947 ATGTTGCTTTCTGCTGTGACAGG - Intronic
972278566 4:37582018-37582040 GTTTTGCTTTCTGCTCTGATAGG + Intronic
972366584 4:38381325-38381347 GAATTGCTTTCTGTTCTGAAGGG - Intergenic
972492184 4:39598250-39598272 GTTTTGCTTTCTGTTTTGTGTGG + Intronic
972777638 4:42257661-42257683 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
973053810 4:45629745-45629767 GTTTTGCTTTCTGCTGTGACAGG - Intergenic
973060529 4:45718618-45718640 GTATTGCTTTCCATGGTGACAGG - Intergenic
973078319 4:45958883-45958905 GTTTTGCCATCTGTTCTTACTGG - Intergenic
973198597 4:47474350-47474372 GTTTTGTTTTGTTTTGAGACTGG - Intergenic
973214510 4:47654555-47654577 GTGTTGCTTTCTGCTGTGATAGG - Intronic
973227346 4:47801672-47801694 CCTCTGCTTTCTGCTGTGACAGG - Intronic
973228155 4:47810191-47810213 GTTTTGTTTTGTTTTGAGACAGG + Intronic
973348447 4:49082306-49082328 GTGTTGCTTTCCACTGTGACAGG - Intergenic
973783524 4:54313856-54313878 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
974080033 4:57202651-57202673 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
974299348 4:60042946-60042968 ACTTTGCTCTCAGTTGTGACAGG + Intergenic
974353104 4:60774590-60774612 GTTTTGCTTTCTGGTATGACAGG + Intergenic
974532664 4:63129537-63129559 TTTTTGGTTGCTGTTGTTACAGG + Intergenic
974597333 4:64030811-64030833 GTTTTGCTTTCTGCTATAACAGG + Intergenic
974609198 4:64193162-64193184 GTTTTGCCTTCTGCTGTAACAGG + Intergenic
974771696 4:66423176-66423198 ATCTTGCTTTCTGCTGTTACAGG - Intergenic
974780045 4:66543234-66543256 GTTTTCCTTTCTGCTCTAACAGG - Intergenic
974790039 4:66675845-66675867 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
974801192 4:66820722-66820744 GTTTTCCTTTCTGTCTTTACTGG + Intergenic
974864895 4:67567687-67567709 GTTTTGCTCTCTCTTGTTCCTGG + Intronic
975040132 4:69736093-69736115 GTTTTGCTTTCCACTGTGACAGG - Intronic
975095439 4:70451206-70451228 GTTTTTCTTTCTGCTCTAACAGG + Intronic
975314339 4:72933852-72933874 GTTTTGCTTTCCGCTGTGACAGG + Intergenic
975376014 4:73646389-73646411 GTTCTGCTTTCCACTGTGACAGG + Intergenic
975444776 4:74449747-74449769 GTTTTGTTTTGTTTTGAGACAGG - Intronic
975660598 4:76684973-76684995 GTTTTTCATTTTGTTGTGAGTGG + Intronic
975759897 4:77609316-77609338 GTTTTGTTTTGTTTTGAGACAGG + Intronic
975817682 4:78235940-78235962 GTTTTGTTTTGTTTTGTAACAGG - Intronic
975935338 4:79572840-79572862 GTTTTGTTTTCTTTTTTGAGAGG - Intergenic
976003875 4:80404536-80404558 GTATTGCCTTGTTTTGTGACTGG + Intronic
976082934 4:81375986-81376008 GTTTTGTTTTCCACTGTGACAGG + Intergenic
976242389 4:82972057-82972079 GTTTTGTTTTGTTTTGAGACAGG + Intronic
976588577 4:86826207-86826229 GTTTTTCTTTTTGTAGAGACAGG - Intronic
976600233 4:86931568-86931590 TTTTTGCTTTCTGTAGATACAGG + Intronic
976624501 4:87165399-87165421 GTTTTGTTTTGTTTTGAGACAGG + Intronic
976627282 4:87199819-87199841 GTTTTGTTTTGTTTTGAGACAGG - Intronic
976728611 4:88240650-88240672 GTTTTGCTTTCTGTTGTGACAGG + Intergenic
976909763 4:90287899-90287921 GTTTTGCTATTTGTTTTAACTGG - Intronic
977275936 4:94977417-94977439 GTTTTGTTCTCTGGAGTGACAGG + Intronic
977307336 4:95341901-95341923 ATTTTGGTTTCTGCTGTGACAGG - Intronic
977384322 4:96319579-96319601 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
977527941 4:98166845-98166867 GTTTTGCCTTCTACTGTAACAGG + Intergenic
977611063 4:99032231-99032253 GTTTTGTTTTTTTTTGAGACAGG + Intronic
977644391 4:99395692-99395714 ATTTTGCTTTCTGCTATGACAGG - Intergenic
978008769 4:103652349-103652371 GTTTTGCTTTCTCCTGTGACAGG + Intronic
978030799 4:103938401-103938423 GTTTTTCTTTCTGATATTACAGG - Intergenic
978058921 4:104311828-104311850 GTTTTGTTTTCTGTTATAATAGG - Intergenic
978082953 4:104616732-104616754 GTTTTGCTTTCTACTCTGACAGG + Intergenic
978118273 4:105048562-105048584 GTTTTGCTTTTACTTGTGTCAGG - Intergenic
978212773 4:106157603-106157625 GTTTTGCATTCTGCTGTAACAGG + Intronic
978258183 4:106718203-106718225 ATGTTGCTTTCTGCTGTGACAGG - Intergenic
978287709 4:107098379-107098401 GTGTTGCTTTCTGCTGTGACAGG - Intronic
978520261 4:109608491-109608513 GTTTTGTTTTGTTTTGAGACAGG + Intronic
978654255 4:111048259-111048281 GTGTTGCTTTCTGCTGTGACAGG - Intergenic
978676792 4:111327683-111327705 GTTTTCCTTTCTGCTCTAACAGG + Intergenic
978700791 4:111643254-111643276 ATTTTGCTTCCAGTTTTGACTGG + Intergenic
978781433 4:112559202-112559224 GTTTTGTTTTGTTTTGAGACAGG + Intronic
978808847 4:112828980-112829002 GTTTTGCTTTTAGTAGAGACAGG - Intronic
978922525 4:114201399-114201421 GTTTTCCTTTCTGCTATAACCGG + Intergenic
979041859 4:115808481-115808503 GTTTTCCTTTCTGTTTTACCAGG - Intergenic
979073581 4:116241796-116241818 GTTTTGCTTTCTATTGGGACAGG + Intergenic
979213389 4:118133325-118133347 GATTTGCTCTCTGCTATGACAGG + Intronic
979565185 4:122146414-122146436 GTGTTGCTTTCCACTGTGACAGG + Intergenic
979647185 4:123083940-123083962 TTTGTGCTTTCTGTTTTGAAAGG + Intronic
979826361 4:125238681-125238703 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
979937670 4:126717975-126717997 GTTTTGCTTTTTTTTGTTCCAGG + Intergenic
979945730 4:126829583-126829605 GTGTTGCTTTCCATTGTGACAGG - Intergenic
980226803 4:129998061-129998083 GCGTTGCTTTCTGCTGTGACAGG - Intergenic
980412874 4:132446545-132446567 GTTTTCCTTTCTGCTCTAACAGG - Intronic
980442427 4:132866769-132866791 CTTCTGCTTTCTGCTGTGACAGG - Intergenic
980442860 4:132870567-132870589 GTTTTCCTTTCTGCTCTAACAGG - Intergenic
980531347 4:134060081-134060103 GTTTTGCTTTCCATTGAGACAGG - Intergenic
980720777 4:136691982-136692004 CTTTTGCTTTACGTTTTGACTGG + Intergenic
980950659 4:139372890-139372912 TTTTTGTTTTCTTTTGAGACAGG + Intronic
980981866 4:139661319-139661341 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
981329098 4:143487938-143487960 GTTTTCCTTTCTGTTCTAACAGG - Intergenic
981336490 4:143574146-143574168 TTTTTGTTTTCTGTAGGGACAGG + Intergenic
981501254 4:145454334-145454356 TTTTTTCTTTTTGTTGAGACAGG + Intergenic
981518469 4:145635334-145635356 GGTTTGCTTTCTGCTATAACAGG + Intronic
981996050 4:150976854-150976876 GTTCTGCTTTCCGCTGTGACAGG - Intronic
982214721 4:153070995-153071017 GTTTTATTTTTTTTTGTGACTGG + Intergenic
982225701 4:153164142-153164164 GTTTTGTTTTGTTTTGAGACAGG + Intronic
982339725 4:154284637-154284659 GTGTTGCTTTGTGCTGTGACAGG - Intronic
982622664 4:157727112-157727134 TTGTTGCTTTCTGCTCTGACAGG - Intergenic
982715019 4:158797691-158797713 GTTTTGTTTTGTTTTGAGACAGG - Intronic
982828402 4:160028229-160028251 GCTTTGCTCTCTGCTGTGACAGG + Intergenic
982911456 4:161148105-161148127 CTGTTGCTATCTGCTGTGACAGG - Intergenic
983166067 4:164478315-164478337 GTTTTGCTTTCTACTCTGGCAGG + Intergenic
983338179 4:166421976-166421998 GTGTTGCTTTTCATTGTGACAGG + Intergenic
983493007 4:168411462-168411484 GTGTTGCTTTTCGCTGTGACAGG - Intronic
983593975 4:169445245-169445267 GTTTTTGTTTCAGTAGTGACAGG - Intronic
983962045 4:173766575-173766597 GTTTTGCATTCTCTTTAGACAGG + Intergenic
984127376 4:175828926-175828948 GTTTTGTTTTGTTTTGAGACAGG + Intronic
984732112 4:183077790-183077812 TTTTTTCTTTCTTTTGAGACAGG - Intergenic
985229346 4:187798618-187798640 GTTTTGCTTTCCACGGTGACAGG - Intergenic
985251000 4:188024471-188024493 GTTTTGTTTTTTTTTGAGACAGG + Intergenic
985444167 4:190011835-190011857 GTTTTCCTTTCTGCTCTAACAGG - Intergenic
986085200 5:4437898-4437920 GCGTTTCTTTCTGCTGTGACAGG + Intergenic
986182144 5:5403172-5403194 GTTTTGCTTTGTCTTGAGACAGG + Intergenic
986320263 5:6625669-6625691 GTTTTGCTTTCTTTTTGGTCAGG - Exonic
986544552 5:8880866-8880888 GTTTACCTTTCTGTTTTAACAGG + Intergenic
986631300 5:9776198-9776220 GTTTTGCTTTCCACTGTGACAGG + Intergenic
986941320 5:12953810-12953832 GTTCTCCTTTCTGTTCTAACAGG - Intergenic
987163865 5:15173769-15173791 GTTTTGCTTTCTGCTGTAACAGG - Intergenic
987327861 5:16828738-16828760 GTTTTGTTTTGTTTTGAGACAGG + Intronic
987537294 5:19206016-19206038 CTGTTGCTTTCTGCTGTGACAGG - Intergenic
987644456 5:20650196-20650218 GTTTAGCTTTCTGTTGAGGTTGG - Intergenic
987822992 5:22990697-22990719 GTTTCCCTTTCTGTTCTAACAGG - Intergenic
988082627 5:26433085-26433107 GTGTTGCTTTCTCTTGCAACAGG - Intergenic
988340025 5:29959535-29959557 GTTTTGCTTTCTGCTATGACAGG - Intergenic
988376176 5:30438987-30439009 GTATTGCTTTCTGCTGTGAGAGG - Intergenic
988518560 5:31926047-31926069 TTTTTACTTTCTGTCGAGACAGG - Intronic
988653600 5:33182160-33182182 GTTTTGCTCTCTGTTGCTTCAGG + Intergenic
988936856 5:36092526-36092548 GTTCTGCTTTCTGTTGTTCAGGG - Intergenic
988956460 5:36324642-36324664 GTTTTCCTTTCTGCTATAACAGG + Intergenic
989301243 5:39896521-39896543 GTTTTGTTTTGTTTTGAGACGGG + Intergenic
989440854 5:41471402-41471424 GTTTTGCTTTCTGCTGTGACAGG - Intronic
989628861 5:43460707-43460729 GTTTTCCTTTCTGCTCTAACAGG - Intronic
989672501 5:43935547-43935569 GTTTTCCTTTCTGCTATAACAGG - Intergenic
989980242 5:50634906-50634928 GTTATGCTTTCTCTTGTTTCTGG + Intergenic
990190532 5:53255000-53255022 GTTTTGCTTTGAGTTGTCAGTGG - Intergenic
990232886 5:53734148-53734170 GCTCTGCCTTGTGTTGTGACAGG + Intergenic
990251665 5:53921764-53921786 GTTTTGTTTTGTTTTGAGACAGG - Intronic
990434106 5:55770168-55770190 GTTTTACTTTCTAATGTCACTGG + Intronic
990592768 5:57282916-57282938 GTTTTGTTTTCTGTTATAATAGG - Intergenic
990644317 5:57826643-57826665 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
990827821 5:59922092-59922114 GTGTTGCTTTCCACTGTGACAGG - Intronic
991018798 5:61958863-61958885 GTTTTCCTTTCTGCTCTAACAGG + Intergenic
991219816 5:64200259-64200281 TTTTTACTTTCTGTAGAGACAGG - Intronic
991237577 5:64417546-64417568 GTGTTGCTTTCTGCTCTGATAGG - Intergenic
992454330 5:76902376-76902398 GTTTTCCTTTCTGCTCTAACAGG + Intronic
992544620 5:77800008-77800030 CTTGTGCTTTCTGTTTTGAAAGG - Intronic
992573724 5:78088842-78088864 TTTTTGCATTATTTTGTGACAGG + Intronic
992587022 5:78251577-78251599 GTTTTCCTTTCTGCTCTAACAGG - Intronic
992792314 5:80224469-80224491 GTTTTTTTTTCTTTTGAGACAGG - Intronic
992805550 5:80333699-80333721 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
993267540 5:85744985-85745007 GCTTTGCTCTTTGCTGTGACAGG + Intergenic
993446604 5:88020404-88020426 CCTTTGCCTTCTGATGTGACTGG - Intergenic
993447073 5:88026795-88026817 TTTTTGCTCTCTCATGTGACAGG + Intergenic
993543584 5:89183074-89183096 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
993932311 5:93954909-93954931 GTGTTGCCTTCTGCTGTGACAGG + Intronic
994177102 5:96722947-96722969 GTTTTGTTTTGTTTTGAGACAGG + Intronic
994217972 5:97159869-97159891 GTGTTGCTTTCTGCTGTGACAGG + Intronic
994233789 5:97338780-97338802 GTTTTGCTTTCCACTGTGACAGG - Intergenic
994320331 5:98387268-98387290 GTATTGCTTTCTGCTGTAACAGG + Intergenic
994343680 5:98661469-98661491 GTTCTGTTTTCTGCTGTGACAGG - Intergenic
994343750 5:98661885-98661907 GCTTTGGTCTCTGCTGTGACAGG - Intergenic
994381838 5:99080211-99080233 GTTTTCCTTTCTGCTATAACAGG + Intergenic
994438954 5:99777140-99777162 TTTTTGCTTTGTTTTGAGACAGG + Intergenic
994477770 5:100291673-100291695 GTTTTTCTTTCTGCTCTAACAGG + Intergenic
994529860 5:100955901-100955923 GTTTTTCCTTCTGCTGTAACAGG - Intergenic
994616286 5:102108059-102108081 GTTTTACTTTCTGTTATAAAAGG + Intergenic
994627662 5:102242081-102242103 GTTTTCCTTTCTGCTCTAACAGG - Intronic
994869899 5:105334458-105334480 GGTTTGCTTTCTGCTGTGACTGG + Intergenic
994881187 5:105498506-105498528 GCTGTGCTCTCTGCTGTGACAGG + Intergenic
994974008 5:106779382-106779404 GGTTTGCTTTTTGTTGTAACAGG - Intergenic
995019713 5:107352815-107352837 ATATTGCTTTCTGCTGTGACAGG + Intergenic
995096262 5:108239449-108239471 GTGTTGCTTTCCGCTATGACAGG - Intronic
995268738 5:110195680-110195702 GTGTTGCTTTCTGCTGTGACAGG + Intergenic
995373327 5:111445432-111445454 TTTTTGTTTTCTTTTGAGACAGG + Intronic
995557431 5:113344170-113344192 GTTTGGCTCCCTGCTGTGACAGG - Intronic
995770506 5:115664600-115664622 GTTTTGCTTTCTGCTGTGACAGG - Intergenic
996080629 5:119254910-119254932 GTTGTGTTTTCTTTTGAGACAGG - Intergenic
996107308 5:119519130-119519152 GTTTTGTTTTGTTTTGAGACAGG - Intronic
996544943 5:124668365-124668387 GTTTTGTTTTGTTTTGAGACAGG - Intronic
996726457 5:126676803-126676825 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
996860651 5:128061910-128061932 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
996961615 5:129256299-129256321 GTTTTGCTTTCTGCTACAACAGG + Intergenic
997002935 5:129784124-129784146 GTGTTGCTTCCTGCTGTGACAGG - Intergenic
997121267 5:131175538-131175560 GTTTTGTTTTGTTTTGAGACAGG + Intronic
998230063 5:140356062-140356084 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
998265394 5:140664271-140664293 GTTTTGCTTTGTTTTGAGACAGG - Intergenic
998310716 5:141127161-141127183 GTTTTGTTTTGTTTTGAGACAGG - Intronic
998689652 5:144572938-144572960 GTGTTGCTTTCCACTGTGACAGG + Intergenic
998716286 5:144888818-144888840 GTTTTCCTTTCTGCTTTAACAGG - Intergenic
999181641 5:149674046-149674068 TTTTTTTTTTCTTTTGTGACAGG - Intergenic
999225185 5:150016171-150016193 TTTTTGCTTTTTGTAGAGACGGG - Intronic
999331281 5:150675002-150675024 GTTTTGTTTTGTTTTGAGACAGG - Intronic
999559451 5:152785165-152785187 GTGTTGCTTTCCATTGTGATAGG - Intergenic
999650263 5:153759731-153759753 GTTTTCTTTTTTGTTGTGTCTGG - Intronic
999667314 5:153926799-153926821 GTTTTGCTTTCTCCTCTGATGGG - Intergenic
999724494 5:154424860-154424882 GTTTTGTTTTTTTTTGAGACAGG - Intergenic
1000230007 5:159307010-159307032 GTTTTGTTTTTTGTAGAGACAGG + Intergenic
1000453159 5:161415942-161415964 GTTTTGTTTTGTTTTGAGACTGG + Intronic
1000454819 5:161436874-161436896 GTTTTCCTTTCTATTCTAACAGG - Intronic
1000470295 5:161631694-161631716 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1000552818 5:162687734-162687756 GTTTTGCATTCTGTCCTCACAGG + Intergenic
1001040335 5:168330102-168330124 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1001072992 5:168603113-168603135 TTTTTGCTTTCTGTTTCAACGGG + Intergenic
1001177572 5:169486364-169486386 GTTTTCCTTTCTGCTCTAACAGG - Intergenic
1001209785 5:169799811-169799833 GTTTTTTTTTCTTTTGAGACAGG + Intronic
1001414679 5:171536794-171536816 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1001451466 5:171828160-171828182 GTTTTGTTTTTTGTAGAGACAGG - Intergenic
1001669212 5:173460140-173460162 TTTTTGTTTTCTTTTGAGACAGG + Intergenic
1001845260 5:174916492-174916514 GTTTTGCTTTCCGCTGTGATAGG - Intergenic
1002009886 5:176270717-176270739 GTGTTGTTTTCTGCTGTGACAGG - Intronic
1002216842 5:177641591-177641613 GTGTTGTTTTCTGCTGTGACAGG + Intergenic
1002317673 5:178354379-178354401 TTTTTACTTTCTGTAGAGACAGG + Intronic
1002561026 5:180082361-180082383 ATTTTGTTTTCTTTTGAGACAGG - Intergenic
1003173069 6:3735052-3735074 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1003315641 6:5008997-5009019 GTTCTGCTTTTTTTTGAGACAGG - Intergenic
1003332372 6:5140220-5140242 GTTTTTTTTTCTTTTGAGACAGG - Intronic
1003563056 6:7199667-7199689 GTTTTGTTTTGTTTTGAGACGGG + Intronic
1003575652 6:7292061-7292083 GTTTTTTTTTCTTTTGAGACAGG - Intronic
1003592709 6:7449098-7449120 GTTTTTTTTTCTTTTGAGACAGG + Intergenic
1003914687 6:10775792-10775814 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1003952485 6:11128783-11128805 GTCTTGCTTTCTCCTATGACAGG + Intronic
1003982120 6:11399765-11399787 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1004202880 6:13566039-13566061 GCTTTGATTTTTGTTGTGAAGGG + Intergenic
1004206596 6:13597224-13597246 TTTTTGCTTTGTGTTGTGGTAGG + Intronic
1004356461 6:14933627-14933649 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1004397512 6:15258774-15258796 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1004475809 6:15970068-15970090 GTTTTGTTTTATTTTGAGACAGG - Intergenic
1004499410 6:16196771-16196793 CTTTTGTTTTCTACTGTGACAGG - Intergenic
1004638100 6:17487782-17487804 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1004904702 6:20226455-20226477 GTTTTGTTTTCTTTTGAGACAGG + Intergenic
1005004890 6:21278111-21278133 GTTTTGTCTCCTATTGTGACAGG + Intergenic
1005664416 6:28036826-28036848 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1005684015 6:28234512-28234534 GTTTTGTTTTGTTTTGAGACGGG - Intergenic
1006292284 6:33147561-33147583 GTTTTTCTTTTTCTTGAGACAGG - Intergenic
1006495497 6:34420221-34420243 GTTTTCTTTTCTTTTGAGACAGG + Intronic
1006549406 6:34808587-34808609 TTTTTTTTTTCTGTTGAGACAGG + Intronic
1006803367 6:36773325-36773347 GTGTTGGTTTCTGTTGAGTCAGG - Intronic
1006966918 6:37996571-37996593 GTTTTGTTTTCTGTTGAGTATGG + Intronic
1006980064 6:38140493-38140515 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1007015509 6:38462802-38462824 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1007022211 6:38532178-38532200 GTTTTGTTTTCTGCTATGACAGG - Intronic
1007431216 6:41778449-41778471 GTTTTGGTGTTTGTTGTAACAGG - Intronic
1007448989 6:41928937-41928959 TTTTTGTTTTGTTTTGTGACAGG + Intronic
1007559654 6:42796542-42796564 GTTTTGATTTCTGTTTTAAAAGG + Intronic
1008017725 6:46540900-46540922 GTTTTCTTTTCTGTTATAACAGG - Intergenic
1008227410 6:48937089-48937111 GTTTTGCTTTCTACTATGACGGG + Intergenic
1008304630 6:49886400-49886422 TTTTTGCGTTCTGTTGTGCCAGG + Intergenic
1008584417 6:52935997-52936019 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1008642125 6:53474789-53474811 GTGTTGCTTTCTGCTGTGACAGG + Intergenic
1008711948 6:54237842-54237864 TTTTTGTTTGCTTTTGTGACAGG - Intronic
1008857782 6:56112606-56112628 GTTTTCCTTTCTGCTTTAACAGG - Intronic
1008880646 6:56377465-56377487 GTTTTCCTTTCTGCTGTAACAGG - Intronic
1009039460 6:58159054-58159076 GTGTTGCTTTCTGCTGTGACAGG + Intergenic
1009215352 6:60913894-60913916 GTGTTGCTTTCTGCTGTGACAGG + Intergenic
1009353274 6:62708337-62708359 GGTTTCCTTTCTGTTCTAACAGG + Intergenic
1009533137 6:64845917-64845939 TTTTTCCTTTCTGTTTTCACTGG + Intronic
1009618332 6:66039186-66039208 GGTTTGCTTTCCACTGTGACAGG - Intergenic
1009691466 6:67038782-67038804 TTTTTATTTTCTGTTGCGACAGG + Intergenic
1009771323 6:68145844-68145866 GTTTTTCTTTCTGCTATAACAGG + Intergenic
1009782820 6:68292708-68292730 GTTTTCCTTTCCGTTCTAACAGG - Intergenic
1010140040 6:72603034-72603056 GTTTTGCTTTCTGCTGTAACAGG + Intergenic
1010317072 6:74464160-74464182 GTTTTGCTTTCTGATGTAACAGG + Intergenic
1010324971 6:74554120-74554142 GTTTTCCTTTCTGCTTTAACAGG - Intergenic
1010483678 6:76383319-76383341 ATTTTCCTTTCTGCTGTAACAGG + Intergenic
1010676556 6:78752948-78752970 GCTTTGCTCTCTGCTGTGAGAGG - Intergenic
1010775285 6:79878341-79878363 GCTTTGCTTTCTGCTATGACAGG - Intergenic
1010825666 6:80470436-80470458 GTTTCCCTTTGTGTTATGACAGG + Intergenic
1011018861 6:82788654-82788676 GTATTGCTTTCTGCCATGACAGG - Intergenic
1011322933 6:86116687-86116709 GTTCTGCTTTCTGCTGCGATAGG + Intergenic
1011343140 6:86339862-86339884 CTGTTGCTTTCTACTGTGACAGG - Intergenic
1011505298 6:88035308-88035330 CTGGTGCTTTCTGTTTTGACAGG + Intergenic
1011598277 6:89037151-89037173 GTTTTTCTTTCTGTTGTGACAGG - Intergenic
1011647517 6:89473973-89473995 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1011818710 6:91224582-91224604 TTTTTATTTTCTGTAGTGACAGG + Intergenic
1012091352 6:94902175-94902197 GTTTTCCTTTCTGCTCTAACAGG - Intergenic
1012190674 6:96276427-96276449 GTGTTGCTTTCAGCTGTGACAGG - Intergenic
1012224380 6:96688039-96688061 GTTTTGTTTTCCCCTGTGACAGG - Intergenic
1012297760 6:97546213-97546235 GTTTTGCTTTCTGCTATAACAGG + Intergenic
1012483725 6:99696764-99696786 GTTTTCCTTTCTGCTATAACAGG + Intergenic
1012712792 6:102629387-102629409 ATGTTGCTTTCTCATGTGACAGG + Intergenic
1012715204 6:102660428-102660450 GTGTTGCTTTCTGTCATGACAGG - Intergenic
1012761523 6:103309159-103309181 ATTTTGCTTTCTGTTATAACAGG - Intergenic
1012783120 6:103589014-103589036 GTGTTACTTTCTGCTGTGACAGG + Intergenic
1012800353 6:103819711-103819733 GTTTTGCTTTCTGTTGTGACAGG - Intergenic
1012827548 6:104164818-104164840 GTTTTTCTTTCTGTTCTAACAGG - Intergenic
1012892008 6:104907625-104907647 GTGTTGCTTTCTGCTGTGACAGG - Intergenic
1013199311 6:107877442-107877464 GTTTTGTTTTTTGTTGAGACAGG + Intronic
1013250467 6:108328399-108328421 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1013341820 6:109222437-109222459 TTTTTTCTTTCTGTAGAGACAGG + Intergenic
1013687332 6:112600916-112600938 GTTTTTCTTTCTGCTGTGGCAGG - Intergenic
1014074035 6:117216115-117216137 AAGTTGCTTTCTGCTGTGACAGG + Intergenic
1014149652 6:118039984-118040006 GTCTTGCTTTCTGTTGGCAGTGG + Intronic
1014427765 6:121330062-121330084 ATTTTGTTTTATTTTGTGACAGG + Intronic
1014799961 6:125767888-125767910 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1014855649 6:126397311-126397333 ATTTTGCTTTCTGCTGTGATAGG + Intergenic
1014865357 6:126522014-126522036 GTTTTGTTTTCTGCTATAACAGG + Intergenic
1015460597 6:133487131-133487153 GTGTTGCTTTCTGCTGTGAAAGG - Intronic
1015492196 6:133838628-133838650 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1015817056 6:137221531-137221553 TTTTTTCTTTCTTTTGAGACAGG + Intergenic
1015866370 6:137730921-137730943 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1015936083 6:138407019-138407041 ATTTTTCTTTTTGTTGAGACAGG - Intronic
1016061696 6:139637182-139637204 GATTTGCTTTCTGCTGTGACAGG + Intergenic
1016118234 6:140314808-140314830 GTTTTGTTTTGTTTTTTGACAGG + Intergenic
1016228573 6:141772657-141772679 GTTCTGCTTTCCACTGTGACAGG + Intergenic
1016457458 6:144245715-144245737 GTTTTGCTTTCCACTGTGACAGG + Intergenic
1016744836 6:147567913-147567935 GTTTTGTTTTGTTTTGAGACGGG - Exonic
1017113476 6:150954378-150954400 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1017849286 6:158289945-158289967 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1018267041 6:162036316-162036338 GTTTTGTTTTGTTTTGAGACGGG - Intronic
1018316456 6:162561700-162561722 GTTTTCCTTTCTGCTGTAACAGG - Intronic
1018407430 6:163502315-163502337 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1018880488 6:167874224-167874246 GTTTTGGTTTATTTTGAGACAGG - Intronic
1019421125 7:951815-951837 GTTTTTCTTTTTTTTGAGACAGG + Intronic
1019679451 7:2337441-2337463 CTTTTGTTTTGTTTTGTGACAGG - Intronic
1019787727 7:2988715-2988737 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1019917350 7:4142325-4142347 GTTTTGTTTTCTGTTTTTGCTGG + Intronic
1020053780 7:5102491-5102513 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1020175547 7:5879193-5879215 GATTTTGTTTCTGTTGTGACAGG - Intergenic
1020262506 7:6538358-6538380 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1020262532 7:6538559-6538581 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1020572906 7:9889478-9889500 GTTTTTCTTTCTGCTGTAACAGG - Intergenic
1020613249 7:10427093-10427115 GTTTTCCTTTCTGCTCTAACAGG + Intergenic
1020736701 7:11958278-11958300 AGTTTGCTTTTTGTTGTGACAGG + Intergenic
1020798606 7:12705821-12705843 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1021034697 7:15784203-15784225 GTTTTGCTTTCTTCTGTGACAGG - Intergenic
1021131131 7:16913885-16913907 TTTTTTCTTTCTGCTCTGACAGG + Intergenic
1021178362 7:17476160-17476182 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1021272017 7:18600828-18600850 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1021382521 7:19984572-19984594 GTTTTCCTTTCTGCTGTAATAGG + Intergenic
1021595436 7:22311426-22311448 ATTTTGCTGTCTCTTGTGATTGG + Intronic
1021603970 7:22392586-22392608 GTTTGGCTTTCCATTGTGTCCGG - Intergenic
1021902467 7:25299977-25299999 TTTTTTCTTTCTATTGAGACAGG - Intergenic
1021978956 7:26036168-26036190 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1022266659 7:28762622-28762644 GTTTTGTTTTCTTTTGTGTTGGG - Intronic
1022296033 7:29054064-29054086 GTTTTGTTTTGTTTTGTGACAGG - Intronic
1022349209 7:29551220-29551242 GTTGTACTTTCTGTAGAGACAGG - Intergenic
1022542090 7:31146786-31146808 GTTTTGCTTTCTGCCGTGGCAGG + Intergenic
1022657557 7:32333954-32333976 GCTTTGCTTTCTGAAATGACAGG - Intergenic
1022708472 7:32829612-32829634 GCTGTGCTTTCTGTCCTGACAGG + Intergenic
1022741248 7:33123505-33123527 GTTTTCCTTTCTGCTATAACAGG + Intergenic
1022914702 7:34935865-34935887 GCTGTGCTTTCTGTCCTGACAGG - Intronic
1023240870 7:38146251-38146273 ATCTTGCCTTCTGTTGTGACAGG - Intergenic
1023384286 7:39640051-39640073 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1023430597 7:40087147-40087169 GTTTTTCTTTTTTGTGTGACAGG + Intronic
1023716139 7:43046351-43046373 GTGTTGTTTTCTGCTGTGACTGG - Intergenic
1023928749 7:44691350-44691372 GTTTTGTTTTGTGTAGAGACAGG - Intronic
1024362535 7:48483361-48483383 TTTTTGCTTTTTGTTAAGACAGG + Intronic
1024369219 7:48560276-48560298 ATTTTGCTCTCTGCTGTGACAGG + Intronic
1024520473 7:50301659-50301681 GTTTTGTTTTGTTTTGTGACAGG + Intergenic
1024788781 7:52938858-52938880 GTTCTGCTTGCTGTTGTTTCTGG + Intergenic
1024804542 7:53122004-53122026 GTTTTGCTTTAGGTTGTTAGGGG + Intergenic
1024831198 7:53460015-53460037 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1025160393 7:56654384-56654406 ATGTTGCTTTCTGCTATGACAGG - Intergenic
1025307082 7:57869831-57869853 GTTTTGCTTTAAGTTGTTAGGGG + Intergenic
1025481603 7:60991356-60991378 GTTTTGCTTTAAGTTGTTAGGGG - Intergenic
1025561584 7:62378903-62378925 GTTTTGCTTTAAGTTGTTAGGGG - Intergenic
1025726329 7:64064805-64064827 ATGTTGCTTTCTGCTGTGACAGG + Intronic
1025838632 7:65122636-65122658 GTTTTGCTTTAAGTTGTTAGGGG - Intergenic
1025878640 7:65510464-65510486 GTTTTGCTTTAAGTTGTTAGGGG + Intergenic
1025884440 7:65573346-65573368 GTTTTGCTTTAAGTTGTTAGGGG + Intergenic
1025935592 7:66033627-66033649 GTTTTGCTTTATTTATTGACTGG - Intergenic
1026111371 7:67461311-67461333 TTTTTTCTTTTTTTTGTGACAGG + Intergenic
1026177564 7:68011130-68011152 GTTTTGTTTTTTGTTGTTGCTGG - Intergenic
1026278461 7:68901032-68901054 GGTTTTCTTTTTGTTGAGACAGG - Intergenic
1026368908 7:69678480-69678502 GATATGATTTCTGTTGTGAGCGG + Intronic
1026782491 7:73278856-73278878 GTTTTGTTTTGTCTTGAGACCGG + Intergenic
1026864259 7:73813100-73813122 TTTTTGTTTTCTTTTGAGACAGG - Intronic
1026942436 7:74294964-74294986 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1027023254 7:74831681-74831703 GTTTTGTTTTGTCTTGAGACCGG + Intronic
1027064676 7:75113623-75113645 GTTTTGTTTTGTCTTGAGACCGG - Intronic
1027209163 7:76130385-76130407 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1027682540 7:81238377-81238399 GTTTTTCTTTATTTTGAGACAGG + Intergenic
1027726546 7:81812970-81812992 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1027820317 7:83034212-83034234 GTTTTGTTTTGTTTTGTGACAGG + Intronic
1027968410 7:85043350-85043372 GTTTTGTTTGCTTTTGAGACAGG - Intronic
1028022318 7:85792140-85792162 TTGTTGCTTTCTGCTGTGACAGG - Intergenic
1028072972 7:86475371-86475393 GTTTTGTTTTCTTTTGTTTCAGG + Intergenic
1028160813 7:87483163-87483185 GCTTTGCTTTATACTGTGACAGG - Intergenic
1028181385 7:87729474-87729496 GTGTTGCTTTCTGCTGTGACAGG - Intronic
1028264566 7:88706387-88706409 GTTTTTCTTTCTGCTTTAACAGG + Intergenic
1028307867 7:89289596-89289618 GTTTTGCTTTTTGCTATGACAGG - Intronic
1028338945 7:89694417-89694439 GTTTTCCTTTCTGTTCTAACAGG - Intergenic
1028342369 7:89737347-89737369 ATTTTTCTTTCTGTTTTAACTGG - Intergenic
1028405319 7:90467797-90467819 GTTTTGTTTTTTGTAGAGACAGG + Intronic
1028579933 7:92398190-92398212 GTTTTGCTTTCTGTTGCTTCAGG + Exonic
1028952547 7:96653215-96653237 GTTTTGTTCTGTGTTTTGACAGG - Intronic
1029018322 7:97337862-97337884 GTTTTGGTTTTTGTTGAGACAGG - Intergenic
1029083280 7:97991770-97991792 GATTTTGTTTCTGTTGTGACAGG + Intergenic
1029096242 7:98087053-98087075 GGTTTGCTTTCTGGTGAGATCGG - Intergenic
1029100912 7:98129381-98129403 GTTTTGTTTTGTTTTGTGATAGG + Intronic
1029137922 7:98387861-98387883 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1029277205 7:99413598-99413620 GTTTTGTTTTTTTTTGAGACAGG + Intronic
1029278376 7:99421021-99421043 GTTTTGCTTTCTGTGCTTTCAGG - Intronic
1029349861 7:100005527-100005549 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1029455593 7:100669685-100669707 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1029492681 7:100880901-100880923 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1029564383 7:101325930-101325952 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1029577882 7:101415634-101415656 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1029661608 7:101966068-101966090 GTTTTGTTTTGTTTTGGGACAGG + Intronic
1029976716 7:104841900-104841922 CTTTTGCTTTCTCTGGTGTCAGG - Intronic
1030222335 7:107110156-107110178 CTTTTGCTTCTTGCTGTGACAGG - Intronic
1030662625 7:112238295-112238317 GTGTTGCTTTCCACTGTGACAGG - Intronic
1030665498 7:112273308-112273330 GTGTTGCTTTCTGCTGTGACAGG + Intronic
1030828935 7:114197190-114197212 GTTTTGCTTTGTTTTGAGACAGG - Intronic
1031231733 7:119115255-119115277 GTTTTCCTTTCTGCTCTAACAGG + Intergenic
1031259973 7:119506521-119506543 GTGTTGTTTTCTGCTGTGACAGG - Intergenic
1031280900 7:119797915-119797937 GTTTTCCCTTCTGCTGTAACAGG + Intergenic
1031306152 7:120130368-120130390 ATTTTGCTTTCCACTGTGACAGG - Intergenic
1031546387 7:123054961-123054983 GTGTTGCTTTCTACTGTGACAGG + Intergenic
1031553502 7:123143484-123143506 GTTTTTCTTTCTGCTATGACAGG + Intronic
1031554204 7:123151322-123151344 GTTTTGTTTTGTTTTGAGACGGG - Intronic
1031758622 7:125681631-125681653 GTTTTGCTTTCAACTGTGACAGG - Intergenic
1031862201 7:126993721-126993743 CTTTTGCTTTCCACTGTGACAGG - Intronic
1031905639 7:127457525-127457547 GTGTTCCTTTCTGCTGTGACAGG - Intergenic
1031975529 7:128091232-128091254 GGTTTGGTTTCTTTTGAGACCGG + Intronic
1032034717 7:128513371-128513393 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1032136767 7:129286463-129286485 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1032712548 7:134473429-134473451 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1033035814 7:137875206-137875228 GTTTTGCTCTCTTTTGTAACAGG - Exonic
1033118854 7:138649298-138649320 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1033502570 7:141966440-141966462 GTTCTGCTTTCTGCTGTGACAGG + Intronic
1033887162 7:145963150-145963172 GTTTTCCTTTCTGCTGTAACAGG - Intergenic
1034003560 7:147443278-147443300 GTTTTCCTTTCTGCTATAACAGG + Intronic
1034154715 7:148946967-148946989 ATTTTGCTTTGTTTTGAGACAGG + Intergenic
1034251603 7:149696077-149696099 GTTTTGTTTCTTGTTGAGACAGG - Intergenic
1034485032 7:151354914-151354936 GTTTTATTTTCTGTGGAGACGGG + Intronic
1034521205 7:151621509-151621531 GTTTTGTTTTGTTTTGTGACAGG - Intronic
1034581915 7:152050876-152050898 CTTTTGCTTTCCACTGTGACAGG + Intronic
1035084652 7:156247662-156247684 GTTTTGTTTTCTGTTATAATAGG + Intergenic
1035138983 7:156738221-156738243 GCTTTACTGTCTGCTGTGACAGG - Intronic
1035754174 8:2018584-2018606 GTGTTGCTTTCCACTGTGACAGG + Intergenic
1035760263 8:2063901-2063923 GTTTTATTTCCTGTTCTGACAGG - Intronic
1035977563 8:4329932-4329954 CTTTTGCTTTCTGCCATGACTGG + Intronic
1036375576 8:8196665-8196687 TTTTTGTTTTCTTTTGAGACAGG + Intergenic
1036499485 8:9300197-9300219 GTTTTGCTCTCAGTAGTGAGAGG + Intergenic
1036700410 8:11009502-11009524 GTTTTGCCTTTTTTTGAGACAGG - Intronic
1036853956 8:12226479-12226501 TTTTTGTTTTCTTTTGAGACAGG - Intergenic
1036875328 8:12468988-12469010 TTTTTGTTTTCTTTTGAGACAGG - Intergenic
1036936094 8:13004043-13004065 GCTTTGCTTTCTACTGTGACAGG - Intronic
1036970742 8:13352386-13352408 GTCTTTCTTTCTCTTGAGACAGG + Intronic
1037337353 8:17804448-17804470 GTTTTGTTTTCTTTTGACACAGG - Intergenic
1037339709 8:17831463-17831485 CCTTTGCCTTCTGTTATGACTGG - Intergenic
1037423025 8:18724439-18724461 GTTTTATTTTCTGTTGAGATGGG - Intronic
1037449807 8:19005484-19005506 TTTTTGTTTTCTTTTGAGACAGG + Intronic
1037853081 8:22348739-22348761 GTTTTTCTTTCTTTTGAGACAGG - Intronic
1038112141 8:24511430-24511452 GTTTTGTTTTGTGTTGTCATTGG - Intronic
1038295753 8:26290237-26290259 GTTTTTGTTTTTGTTTTGACAGG + Intergenic
1038318795 8:26510241-26510263 TCTTTGCTTTCTGCTATGACTGG + Intronic
1038431785 8:27506157-27506179 TTTTTACATTCTGTTGTAACGGG + Intronic
1038668237 8:29560341-29560363 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1038727500 8:30094902-30094924 GTTTTGTTTTTTGTAGAGACAGG - Intergenic
1038804783 8:30780316-30780338 GTTTTGTTTTTTGTAGAGACGGG - Intronic
1038960652 8:32515450-32515472 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1039311160 8:36319873-36319895 GTTTTGTTTTTTCTTGAGACAGG + Intergenic
1039441884 8:37600727-37600749 GTTTTGTTTTGTTTTGTGACAGG - Intergenic
1039506078 8:38053327-38053349 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1039806228 8:41002062-41002084 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1040485618 8:47868915-47868937 GGGTTGGTTTCTGCTGTGACAGG - Intronic
1040944230 8:52865993-52866015 GTTTTGCAGTCTTTTGTGATAGG - Intergenic
1042082663 8:65071887-65071909 GTTTTGCTTTCTGCTGTAACAGG + Intergenic
1042230586 8:66550481-66550503 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1042297824 8:67241954-67241976 GTTTTGCTTTCTACTGTGACAGG - Intronic
1042428077 8:68672509-68672531 GTGTTGCTTTCCATTGTGACCGG - Intronic
1042437361 8:68783114-68783136 GTTTTGCTTTCTTTTGTAAAAGG + Intronic
1042551588 8:69998869-69998891 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1042558208 8:70051775-70051797 GTTTTGTTTTGTTTTGAGACAGG + Exonic
1042618551 8:70677149-70677171 TTTTTGTTTTGTTTTGTGACAGG + Intronic
1042749167 8:72139264-72139286 ATTTTACTTTTAGTTGTGACAGG - Intergenic
1042832569 8:73048164-73048186 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1042833124 8:73053200-73053222 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1043169541 8:76948356-76948378 CTTTTGATTTCTTTTATGACAGG + Intergenic
1043394541 8:79824140-79824162 GTTTTGTTTTTTGTAGAGACAGG + Intergenic
1043554085 8:81409764-81409786 CTTTTGCTTTCTGCTATAACAGG - Intergenic
1043567206 8:81561687-81561709 GTGTTGCTTTCGGCTTTGACAGG - Intergenic
1043626884 8:82273172-82273194 GTTTTCCTTTCTGCTCTAACAGG - Intergenic
1043765217 8:84122162-84122184 GTTGTCAGTTCTGTTGTGACCGG - Intergenic
1043873405 8:85460431-85460453 GTTTTGTTTTTTTTTGTGAGAGG - Intergenic
1043997901 8:86842435-86842457 GTTTCACTTTCTGTTGTGACTGG - Intergenic
1044026275 8:87175976-87175998 GTTTTGTCTTCTGCTGTGATAGG + Intronic
1044066149 8:87702890-87702912 GTGTTGCTTTCTGCTGTGACAGG - Intergenic
1044439369 8:92205362-92205384 AATATGCTTTCTTTTGTGACAGG - Intergenic
1044562623 8:93627822-93627844 GTTTTGTTTTTTGTAGTGACAGG - Intergenic
1044635547 8:94320157-94320179 GTGTTGTTTTCTGCTGTGAGAGG + Intergenic
1044891932 8:96845526-96845548 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1045223872 8:100225836-100225858 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1045402392 8:101832180-101832202 GATTTGCATTCCTTTGTGACAGG - Intronic
1045589551 8:103578523-103578545 TTTTTGTTTTTTGTTTTGACAGG - Intronic
1045800549 8:106096435-106096457 ATATTGCTTTCTGCTGTGACAGG - Intergenic
1045804044 8:106136095-106136117 TTTTTGCTTTCTGTAGAGATGGG + Intergenic
1046149902 8:110210724-110210746 GTTTTGCTTTCTGCTATGACAGG - Intergenic
1046380401 8:113442564-113442586 GTTTTGTTTTGTTTTGAGACGGG - Intergenic
1046381804 8:113460822-113460844 GTTTTTCTTTTTTTTGCGACAGG + Intergenic
1046438177 8:114222510-114222532 GTTTTGATTTGTGTTTTGAGAGG + Intergenic
1046448405 8:114356572-114356594 GTTTTCCTTTCTGCTTTAACAGG - Intergenic
1046463411 8:114571181-114571203 GTGTTGCTTTCTGCTGTGGCAGG + Intergenic
1046522146 8:115339266-115339288 TTTTTGTTTTGTGTTGAGACAGG + Intergenic
1046557195 8:115789989-115790011 GTGTTTCTTTCTGCTGTGACAGG - Intronic
1046652274 8:116849689-116849711 GTTGTGGTTTCTGTTATGGCTGG - Intronic
1046811538 8:118538510-118538532 GTATTGCTTTCCACTGTGACAGG + Intronic
1046926385 8:119793932-119793954 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1047146424 8:122204362-122204384 GTTTTGTTTTTTGTTTTGAGAGG - Intergenic
1047273111 8:123381493-123381515 GTTTTGTTTTGTTTTGTGGCAGG - Intronic
1047352536 8:124089263-124089285 GTGTTTCTTTCTGCTGTGACAGG + Intronic
1047451348 8:124967800-124967822 GTTTTGTTTTGTTTTTTGACAGG + Intergenic
1047600321 8:126419658-126419680 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1047841082 8:128754195-128754217 ATTTTGTTTTCTGCTGTGACAGG - Intergenic
1048030020 8:130622043-130622065 ATGTTGCTTTCTGCTGTGACAGG + Intergenic
1048118676 8:131554867-131554889 GCAATGCTTTCTGCTGTGACAGG - Intergenic
1049647737 8:143743231-143743253 GTTTTGTTTTTTTTTGAGACAGG + Intergenic
1049975103 9:853971-853993 ATTTTTCTTTCTGTGGAGACAGG + Intronic
1050185549 9:2968991-2969013 ATTTTGCTTTGTGTTTTGATAGG - Intergenic
1050238930 9:3613586-3613608 GTGTTGCTTTCTTCTGTCACAGG + Intergenic
1050355648 9:4780637-4780659 GTTTGGCTTTCTGCGATGACGGG - Intergenic
1050508104 9:6368453-6368475 GTGTTGCTTTCCACTGTGACAGG - Intergenic
1050539511 9:6658187-6658209 GTTTTGTTTTGTTTTGAGACTGG + Intergenic
1050578840 9:7028819-7028841 GGTTTGCTTTCTCTTGTAACTGG + Intronic
1050618725 9:7430134-7430156 ATGTTGCTTTCTGCTGTGACAGG + Intergenic
1050865308 9:10489760-10489782 GTTTTGTTTTCTGTTATGATAGG + Intronic
1050907010 9:11016845-11016867 TTCTTGCTTTCTGCTGTGACAGG + Intergenic
1051205823 9:14687673-14687695 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1051306621 9:15717229-15717251 GTGTTGCTTTCCACTGTGACAGG - Intronic
1051376729 9:16409709-16409731 GTTTTGCTTTTTGTTTTTATTGG - Exonic
1051464944 9:17367237-17367259 GTTTTGCTCTCTGCTATGACAGG - Intronic
1051617111 9:19016897-19016919 TTTTTGGTTTCTGTAGTGGCGGG - Intronic
1051625434 9:19094773-19094795 GTTTTTTTTTCTTTTGAGACAGG - Intronic
1051923911 9:22299768-22299790 CTTTTCCTTTCTGTTCTAACAGG + Intergenic
1051991980 9:23162747-23162769 GCTTTGCTCTCTGTTGTGAATGG - Intergenic
1052020846 9:23523553-23523575 GTTTTGCTTTGTTTTGTGTGTGG - Intergenic
1052063204 9:23986382-23986404 GTTTTTCTTTCTGCTCTAACAGG - Intergenic
1052258895 9:26491751-26491773 GTTTTCCTTTCTGCTCTGCCAGG + Intergenic
1052585607 9:30424525-30424547 GTTTTCCTTTCTACTGTGACAGG - Intergenic
1052585788 9:30425736-30425758 GTTTTTCTTCCTACTGTGACAGG - Intergenic
1052914149 9:33911096-33911118 GTTTTGTTTTGTTTTTTGACAGG - Intronic
1053280482 9:36817210-36817232 CTTTTTCTTTCTTTTTTGACAGG - Intergenic
1053581244 9:39406751-39406773 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1053697730 9:40652170-40652192 GTTTTGCTTTAAGTTGTTAGGGG + Intergenic
1053838837 9:42170935-42170957 GTTTTGTTTTGTTTTGAGACTGG - Intergenic
1053845730 9:42234805-42234827 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1053943756 9:43281028-43281050 GTTTTGCTTTAAGTTGTTAGGGG + Intergenic
1054102831 9:60965550-60965572 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1054309021 9:63451578-63451600 GTTTTGCTTTAAGTTGTTAGGGG + Intergenic
1054407816 9:64775696-64775718 GTTTTGCTTTAAGTTGTTAGGGG + Intergenic
1054440962 9:65259526-65259548 GTTTTGCTTTAAGTTGTTAGGGG + Intergenic
1054489315 9:65761960-65761982 GTTTTGCTTTAAGTTGTTAGGGG - Intergenic
1054583528 9:66941310-66941332 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1054608610 9:67210496-67210518 GTTTTGCTTTTTTTTTAGACAGG + Intergenic
1054790463 9:69251998-69252020 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1054833775 9:69654473-69654495 TCTTTGCTTTCTTTTGAGACAGG - Intronic
1055161408 9:73133052-73133074 TTTTTCCTTACTGTTGTGAAAGG + Intergenic
1055227266 9:74014612-74014634 ATTTTGCTTTCTGTTATGACAGG - Intergenic
1055339360 9:75264494-75264516 GTTTTCCTTTCTGCTCTGACAGG + Intergenic
1055580081 9:77699035-77699057 ATTTTGCTTTCCACTGTGACAGG + Intergenic
1055618596 9:78099454-78099476 GTTTTAATTTCTTTTGAGACAGG - Intergenic
1055692429 9:78846705-78846727 GTTTTGCTTTCTGCTGTGATAGG + Intergenic
1056230690 9:84539680-84539702 GTATTGCTTTCTGCTGTGACAGG + Intergenic
1056424820 9:86465711-86465733 GTTTTCCTTTCTGCTCTAACAGG + Intergenic
1057121740 9:92582057-92582079 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1057346702 9:94258197-94258219 GTTTTGCTTTCTGGTATAACAGG - Intergenic
1057593208 9:96391774-96391796 GTTTTGCTTTGTTTTGAGACAGG + Intronic
1057603466 9:96480167-96480189 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1057823909 9:98357634-98357656 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1057984517 9:99698179-99698201 CTTTGGCTTACTGTTGTGGCTGG - Intergenic
1058003835 9:99895060-99895082 GTGTTGCTTTCCACTGTGACAGG - Intergenic
1058016401 9:100037223-100037245 ATTTTGCTTTCTGCTATAACAGG - Intronic
1058232561 9:102447303-102447325 ATTTTGCTTTCTGCTGTGACAGG - Intergenic
1058522915 9:105829394-105829416 GTGTTGCTTTCTGCTGTGACAGG + Intergenic
1058692901 9:107534290-107534312 TTTTTACTTTTTGTTGAGACAGG - Intergenic
1058780052 9:108324590-108324612 GTTTTCCTTTCTGCTCTAACAGG - Intergenic
1059028293 9:110661040-110661062 GTTTTGGTTTCTTGTGAGACGGG + Intergenic
1059276306 9:113100140-113100162 GTTTTCCTATTTGCTGTGACTGG + Intergenic
1059555595 9:115277083-115277105 GTATTGCTTTCTGCTGTGACAGG + Intronic
1059780082 9:117516926-117516948 GTTTGGCTTTCTGTTGTTTGTGG + Intergenic
1059855530 9:118393127-118393149 CTTTTGCCTTCTGTTATGATTGG + Intergenic
1060451595 9:123746795-123746817 GTTTTGTTTTCAGTGGTCACGGG + Intronic
1060595687 9:124847219-124847241 TTTTTGTTTTGTTTTGTGACAGG - Intergenic
1060988084 9:127831695-127831717 TTTTTTCTTTCTTTTGAGACAGG + Intronic
1061044742 9:128159206-128159228 TTTGTGCTTTCTGTAGAGACGGG + Intergenic
1061073529 9:128326753-128326775 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1061234558 9:129334919-129334941 GCTTTGCCTTCTGTTGGGAGAGG - Intergenic
1061239670 9:129362330-129362352 GTTTTGTTTTTTGTTTTGTCTGG + Intergenic
1061341915 9:129989254-129989276 GTTCTGTTTTCTGCTGTGAAAGG + Intronic
1062361064 9:136188389-136188411 GTATTGCTTTGTTTTGAGACAGG - Intergenic
1062509990 9:136899851-136899873 TTTTTGCTTTTTGTAGAGACAGG - Intronic
1202780109 9_KI270717v1_random:25570-25592 GTTTTGCTTTAAGTTGTTAGGGG + Intergenic
1203586874 Un_KI270747v1:10931-10953 GTTTTGCTTTAAGTTGTTAGGGG + Intergenic
1203616459 Un_KI270749v1:71752-71774 GTTTTGCTTTAAGTTGTTAGGGG - Intergenic
1186248144 X:7636783-7636805 TTTTTATTTTCTGTAGTGACGGG - Intergenic
1186630973 X:11348653-11348675 GTTTTGTTTTGTTTTGAGACGGG + Intronic
1186829285 X:13374792-13374814 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1186911800 X:14174945-14174967 GTTTTGCTTTCTGCTCTGACAGG + Intergenic
1187185729 X:16983506-16983528 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1187594948 X:20760609-20760631 GTTTTACTTTCTGCTGTGGCAGG + Intergenic
1187612761 X:20960679-20960701 GTTTTACTTTTAGTTGTGACAGG - Intergenic
1187636680 X:21237465-21237487 TTTTTGCTTTCTGCTCTGATAGG - Intergenic
1187639435 X:21272708-21272730 GTTTTCCTTTCTGCTATAACAGG - Intergenic
1187653095 X:21432877-21432899 ATTTTGCATTTTGTTGTGAAAGG + Intronic
1187844811 X:23524435-23524457 GTTTTCCTTTCTGCTATAACAGG - Intergenic
1188024454 X:25194175-25194197 GCTTTGTTTTCTGTTGGGAGTGG + Intergenic
1188040680 X:25367185-25367207 GTTTTCCTTTCTGCTCTAACAGG + Intergenic
1188078632 X:25808521-25808543 GTTCTGCTTTCTGCTGTGACAGG + Intergenic
1188131161 X:26434250-26434272 GTTTTCCTTTCTGCTCTAACAGG + Intergenic
1188421222 X:29992470-29992492 GTGTTGCTTTCAGCTATGACAGG + Intergenic
1188514442 X:30970212-30970234 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1188703504 X:33296165-33296187 GTAATGCTTTCTCTTGTGAAAGG + Intronic
1188721635 X:33529372-33529394 ATTTTGCTTTCTGCTATAACAGG + Intergenic
1188884067 X:35528215-35528237 TTTTGACTTTCTGTTATGACTGG + Intergenic
1188914150 X:35889659-35889681 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1188917980 X:35935324-35935346 GTTTTACTTTCTGCTGTGACAGG + Intronic
1188932157 X:36124529-36124551 GTTTTGTTTTCTATTATAACAGG + Intronic
1188943164 X:36264514-36264536 GTTTTCCTTTCTGCTCTAACAGG + Intronic
1188973263 X:36642507-36642529 GTGTTGCTTTCCACTGTGACAGG + Intergenic
1188996047 X:36887442-36887464 GTTTTGCTTTGTGCTCTGACAGG - Intergenic
1189019485 X:37319729-37319751 GTTTTGTTTTCTGCTATAACAGG - Intergenic
1189383173 X:40516363-40516385 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1189411999 X:40780548-40780570 GTGTTGCTTTCCACTGTGACAGG + Intergenic
1189493004 X:41484299-41484321 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1189593746 X:42542868-42542890 TTTTTGCTTTCTTCTGTGACAGG - Intergenic
1189744366 X:44154696-44154718 GTTTTGTTTTGTTTTGGGACAGG - Intronic
1189826132 X:44919918-44919940 CTTTTGATTTCTGTTTTGACTGG + Intronic
1189875794 X:45434460-45434482 TTCTTGCTTTCTGCTGTTACAGG + Intergenic
1189990788 X:46592373-46592395 GTTTTGTTTTGTTTTGAGACAGG + Intronic
1190014991 X:46819244-46819266 TTTTGGCTTTCTGCTGTGACAGG - Intergenic
1190026526 X:46928782-46928804 GTTTTGTTTTTTGTAGAGACAGG + Intronic
1190046078 X:47112550-47112572 TTTTTGCTTTCTGTTGTGACAGG - Intergenic
1190176743 X:48156750-48156772 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1190252154 X:48735270-48735292 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1190484923 X:50914410-50914432 GTTTTGTTTTTTGTAGAGACAGG - Intronic
1190537896 X:51447390-51447412 GTTTTGCTTTCTGCTATAACAGG + Intergenic
1190614469 X:52216677-52216699 GTTTTCCTTTCTGCTCTAACAGG - Intergenic
1190894017 X:54597806-54597828 GTTTTGCTTTCTGCTATAATAGG + Intergenic
1190908018 X:54747144-54747166 ATTTTGCTTTCTGCTATGACAGG + Intergenic
1191207542 X:57850314-57850336 GTTTTCCTTTCTGCTCTAACAGG + Intergenic
1191221825 X:57997919-57997941 GTTTTCCTTTCTGGTCTAACAGG - Intergenic
1191646580 X:63488193-63488215 GTGTTGCTTTCTGTTGGGACAGG - Intergenic
1191760081 X:64636994-64637016 ATGTTGCTTTCTATTGTGACAGG + Intergenic
1191826821 X:65375192-65375214 GTTTTGCTTTATGCTGTGACAGG - Intronic
1191834219 X:65446606-65446628 GTGTTGCTTTCCGCTGTGACAGG + Intronic
1191862101 X:65674116-65674138 GTTTTGCTTTGGCTTGTGACGGG + Intronic
1191924643 X:66296386-66296408 GTTTTCCTTTCTGTTCTAACAGG + Intergenic
1191986461 X:66986182-66986204 GTTTTGCTTTCTGCTGTGACAGG + Intergenic
1192046105 X:67675550-67675572 ATGTTGCTTTCTGCTGTGACAGG + Intronic
1192077740 X:68017583-68017605 GTTTTCCTTTCTGCTCTAACAGG - Intergenic
1192134947 X:68588562-68588584 GTTTTATTCTCTGCTGTGACAGG - Intergenic
1192374759 X:70548650-70548672 GTGTTACTTTCTGCTGTGACAGG - Intronic
1192380683 X:70613438-70613460 GTTTTCCTTCCTGCTGTGACAGG - Intronic
1192420920 X:71029426-71029448 TTTTTTCTTTTTGTTGAGACAGG - Intergenic
1192505769 X:71681261-71681283 GTTTTGCTTTCTGCTGTGACAGG + Intergenic
1192521301 X:71803870-71803892 GTTTTGCTTTCTGCTGTGACAGG - Intergenic
1192836498 X:74805001-74805023 GTTTTGCTTTCTGCTGTGATGGG + Intronic
1192872579 X:75198917-75198939 GTTTTGCTTTCTGCTGTGATAGG - Intergenic
1192890817 X:75389100-75389122 GTATTGCTTTCTGCTGTGACAGG - Intronic
1192908640 X:75579549-75579571 GTTTTCCTTTCTGCTCTAACTGG + Intergenic
1192958900 X:76104923-76104945 GTGTTGCTTTCTGCTGTGACAGG + Intergenic
1193063488 X:77232635-77232657 GTTTTGCTTTCTGTTATTATAGG - Intergenic
1193161991 X:78238622-78238644 GTTTTTCTTTCTGCTTTAACAGG + Intergenic
1193167986 X:78303181-78303203 GTTTTCCTTTCTGCTGTTACAGG + Intronic
1193175054 X:78383482-78383504 GTTTTCCTTTCTGCTCTAACAGG - Intergenic
1193213742 X:78838753-78838775 GTGTTGCTTTCTGCTATAACAGG - Intergenic
1193270554 X:79524742-79524764 GAGTTGCTTTCTGTTGTTTCAGG - Intergenic
1193344502 X:80388995-80389017 GTGTTGATTTCTGCTGTGAGAGG + Intronic
1193396509 X:80990277-80990299 GTTCTGCTTTCCGCTGTGATAGG - Intergenic
1193416968 X:81237477-81237499 GTTTTCCTTTCTGCTCTAACAGG - Intronic
1193561369 X:83021945-83021967 GTTTTACTTTCTCTTGTGTCAGG - Intergenic
1193741248 X:85220141-85220163 GTTTTCCTTTCTGCTTTAACAGG - Intergenic
1193756876 X:85419344-85419366 ATGTTGCTTTCTGCTGTAACAGG + Intergenic
1193828857 X:86262280-86262302 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1193831678 X:86295677-86295699 GTTTTGCTTTTTGTTGTAAGAGG + Intronic
1193856704 X:86611674-86611696 GTTTTCCTTACCGCTGTGACAGG + Intronic
1193896939 X:87126544-87126566 TTGTTGCTTTCCGCTGTGACAGG - Intergenic
1193901502 X:87183349-87183371 GTATTGGTTTCTGCTGTGACAGG + Intergenic
1193925335 X:87476964-87476986 GTTTTTCTTTCTGCTCTGACAGG + Intergenic
1193931697 X:87561419-87561441 GTGTTGATTTTTGCTGTGACAGG - Intronic
1193933201 X:87582428-87582450 GTTTTTCTTTCTGCTCTTACAGG - Intronic
1194016146 X:88624351-88624373 GTTTTGTTTTCTGCTATAACAGG - Intergenic
1194136528 X:90151303-90151325 GTTTTGTTTTCTGCTATAACAGG - Intergenic
1194157973 X:90416327-90416349 GTTTTCCTTTCTGCTCTAACAGG + Intergenic
1194219023 X:91168286-91168308 GTTTTCCTTTCTGCTCTAACAGG + Intergenic
1194265166 X:91744136-91744158 GTTTTCCTTTCTGCTCTAACAGG + Intergenic
1194285804 X:92008407-92008429 GTTTTGCTTTCTGCTTTAACAGG + Intronic
1194340750 X:92701710-92701732 GTTTTGCTTTTCTGTGTGACAGG + Intergenic
1194370756 X:93068962-93068984 GTTTTCCTTTCTGCTGTAACAGG - Intergenic
1194372608 X:93091992-93092014 GTTTTCCTTTCTGCTGTAACAGG + Intergenic
1194436399 X:93873206-93873228 GTTTCTCTTTCTGTTGGGAATGG + Intergenic
1194476782 X:94368729-94368751 GTTTTCCTTTCTGATCTAACAGG - Intergenic
1194493201 X:94577258-94577280 GTTTTGTTTTCTTCTGTGATAGG - Intergenic
1194495668 X:94614020-94614042 GTTTTTCTTTCTGCTCTAACAGG + Intergenic
1194507665 X:94752619-94752641 GTGTTGTGTTCTGCTGTGACAGG + Intergenic
1194520566 X:94914174-94914196 ATTTTGCTTTCTGCTATAACAGG - Intergenic
1194522182 X:94932319-94932341 GTTTTTCTTTCTGCTGTAACAGG + Intergenic
1194526371 X:94982891-94982913 GCTTTGCTCTCTGCTATGACAGG - Intergenic
1194550337 X:95290556-95290578 GTTTTACTTTCTGCTGTAACAGG - Intergenic
1194605783 X:95976192-95976214 GTTTTCCTTTCTGCTCTAACAGG - Intergenic
1194623491 X:96201550-96201572 GTTTTCCTTTCTGCTTTAACAGG - Intergenic
1194626225 X:96229567-96229589 GTTTTACTTTCTGCTGTGACAGG - Intergenic
1194724231 X:97375729-97375751 ATTTTGCCTCCTGTTATGACTGG + Intronic
1194839897 X:98727063-98727085 GTTTTCCATTCTGTTCTAACAGG + Intergenic
1194882688 X:99273506-99273528 GCTTTGCTGTCTGCTGTGACAGG - Intergenic
1194954844 X:100166675-100166697 GTTTTCCTTTCTGGTCTAACAGG + Intergenic
1194990546 X:100542870-100542892 GTTTTGTTTTCTGCTATAACAGG - Intergenic
1195060871 X:101192769-101192791 GTTTTGGTTCCTTTTGTGAGGGG + Intergenic
1195090234 X:101451323-101451345 GTTTTGCTTTCTGCTATAACGGG + Intronic
1195172478 X:102282302-102282324 GTTTTCCTTTCTGCTCTAACAGG + Intergenic
1195186386 X:102404793-102404815 GTTTTCCTTTCTGCTCTAACAGG - Intronic
1195322535 X:103731267-103731289 GTGTTGCTTCCTGTTGTTACAGG - Intergenic
1195375913 X:104228133-104228155 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1195396044 X:104411715-104411737 GTGTTGCTTTCCACTGTGACAGG - Intergenic
1195477436 X:105302995-105303017 ATATTGCTTTCTGCCGTGACAGG + Intronic
1195501973 X:105612730-105612752 GTTTTGCTTTCTGCCGAGACAGG - Intronic
1195595334 X:106682753-106682775 GTGTTGCTTTCTTCTGTGACAGG - Intergenic
1195662744 X:107396987-107397009 GTTTTGCTTTCTGTTGTGACAGG + Intergenic
1195783154 X:108486066-108486088 GTTTTGCTTTCTGCTGTGACAGG + Intronic
1195852261 X:109295854-109295876 GTTTTCCTTTCTGCTCTAACAGG + Intergenic
1196056807 X:111364888-111364910 GTTTTGTTTTGTTTTGAGACGGG + Intronic
1196215748 X:113050096-113050118 GTTTTGCTTTCTGCTGTGACAGG - Intergenic
1196234600 X:113263277-113263299 GTGTTGCTTTCTGCTATGACAGG + Intergenic
1196253278 X:113486480-113486502 GTTTTCCTTTCTATTTTAACAGG + Intergenic
1196439783 X:115707983-115708005 CTTTTTCTTTTTTTTGTGACAGG - Intergenic
1196467724 X:115990465-115990487 GTTTTCCTTTCTGCTCTAACAGG - Intergenic
1196498155 X:116346798-116346820 GTTTTCCTTTCTGCTGTAACTGG + Intergenic
1196540185 X:116898925-116898947 GTGATGCTTTTTCTTGTGACTGG - Intergenic
1196573302 X:117288742-117288764 GTTTTCCTTTCTGCTCTAACAGG - Intergenic
1196625196 X:117870326-117870348 GTTTTTCTTTCTGCTCTAACAGG - Intergenic
1196824032 X:119726749-119726771 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1196825302 X:119735805-119735827 GTTTTGTTTTGTGATCTGACTGG - Intergenic
1196865245 X:120065449-120065471 GTTTTCCTTTCTGCTGTAACAGG - Intergenic
1196877848 X:120170831-120170853 GTTTTCCTTTCTGCTGTAACAGG + Intergenic
1197052669 X:122078186-122078208 TTTTTGCTTTCTGTTGTGACAGG + Intergenic
1197068780 X:122267645-122267667 GTTTTTCTTTCTGCTCTAACAGG + Intergenic
1197112803 X:122796995-122797017 GTTTTCCTTTCTGCTCTAACAGG - Intergenic
1197177967 X:123504827-123504849 ATGTTGCTTTCTGCTGTGATAGG - Intergenic
1197361236 X:125505543-125505565 GTGTTGCTTTCTGCTATGACAGG + Intergenic
1197392010 X:125878641-125878663 GTTTTTCTTTCTGCTGTAACAGG + Intergenic
1197399874 X:125977405-125977427 GTGTTGCTTTCTGCTCTGACAGG - Intergenic
1197437876 X:126455336-126455358 GTTTTCCTTTCTGTTCTAGCAGG - Intergenic
1197465364 X:126798715-126798737 GTTTTCCTTTCTGCTCTTACAGG - Intergenic
1197502527 X:127259783-127259805 GTTTTCCTTTCTGCTCTAACAGG - Intergenic
1197527846 X:127583750-127583772 GTTTTGTTTTCTGCTGTAACAGG + Intergenic
1197544395 X:127807722-127807744 GTTTTTCTTTCTGGTATGATAGG - Intergenic
1197558762 X:127991828-127991850 GTTTTGCTCTCTGCTGTGACAGG - Intergenic
1197634507 X:128900054-128900076 GTTTTGTTTTGTTTTGTGGCAGG + Intergenic
1197676279 X:129334438-129334460 GTTTTCCTTTCTGCTCTAACAGG - Intergenic
1197712695 X:129683137-129683159 GTTTGGGTTTCTCTTGTGGCAGG + Intergenic
1197810962 X:130442445-130442467 GTTTTCCTTTCTGCTCTAACAGG + Intergenic
1197932450 X:131709980-131710002 GTTTTGTTTTGTTTTGAGACAGG + Intergenic
1197987298 X:132279410-132279432 GTTTTCCTTTCTGTTCTAACAGG + Intergenic
1198274119 X:135085477-135085499 ATGTTGCTTTCTGCTGTGACAGG + Intergenic
1198430935 X:136565470-136565492 GTTTTGCTTTCTGCTGTGACAGG + Intergenic
1198446455 X:136721555-136721577 GTTTTGTTTTGTTTTGAGACAGG - Intronic
1198537483 X:137600863-137600885 GTTCTACTTTCCGCTGTGACAGG - Intergenic
1198578404 X:138036423-138036445 GTTTTGCTTTCTGCTGTAATAGG - Intergenic
1198628790 X:138611154-138611176 TATTTGCTTTATGTTGTTACTGG + Intergenic
1198663309 X:138995216-138995238 GTTTTACTTTCTGCTGAGTCAGG - Intronic
1198761564 X:140038393-140038415 GTCTTGTGTTCTGCTGTGACAGG - Intergenic
1198768350 X:140101458-140101480 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1198773446 X:140155132-140155154 GTTTTGCTTTCTGCTGTTACAGG - Intergenic
1198939030 X:141932215-141932237 ATTCTGCTTTCTGCTGTGACAGG + Intergenic
1198964754 X:142215459-142215481 GTTTTGCTTTCTGCTATGACAGG + Intergenic
1199005612 X:142693108-142693130 GTTTTGCTTTCTGCTGTGACAGG - Intergenic
1199026827 X:142949401-142949423 GTTTTCCTTTCTGCTGTAACGGG - Intergenic
1199058624 X:143327759-143327781 GTTTTCCTTTCTGTTCTAACAGG - Intergenic
1199104094 X:143841212-143841234 GTTTTTCTTTCTGCTTTAACAGG + Intergenic
1199148183 X:144396732-144396754 GTTTTCCTTTCTGCTATAACAGG - Intergenic
1199162253 X:144627630-144627652 GTTTTCCTTTCTGCTCTAACAGG - Intergenic
1199196525 X:145037581-145037603 GTTTTCCTTTCTGCTCTGATAGG + Intergenic
1199216118 X:145262353-145262375 GTTTTCCTTTCTGCTCTAACAGG - Intergenic
1199239039 X:145525640-145525662 GCTTTTCTTTCTGTTCTGATAGG - Intergenic
1199308798 X:146298279-146298301 GTTTTCCTTTCTGCTCTAACAGG + Intergenic
1199314812 X:146364080-146364102 GTTTTGCTTTCTGCTGTGACAGG + Intergenic
1199455306 X:148021150-148021172 GTTTTGCTTTCTGCTTTGACAGG + Intronic
1199908345 X:152259111-152259133 GTTTTGCTTTCTGTTGTAACAGG - Intronic
1199962823 X:152791821-152791843 GTGTTGCTTTCTGCTGTAACAGG - Intergenic
1200131491 X:153850529-153850551 TTTTTGCTTTTTGTAGAGACAGG + Intergenic
1200156133 X:153976523-153976545 GTTTTGGTTTTTTTTGAGACAGG - Intronic
1200364366 X:155645576-155645598 GTTTTGCTTTCTGCTGTGACAGG + Intronic
1200482280 Y:3721253-3721275 GTTTTGTTTTCTGCTATAACAGG - Intergenic
1200504296 Y:3993296-3993318 GTTTTCCTTTCTGCTCTAACAGG + Intergenic
1200603363 Y:5232946-5232968 GTTTTGCTTTCTGCTTTAACAGG + Intronic
1200649105 Y:5818442-5818464 GTTTTGCTTTTCTGTGTGACAGG + Intergenic
1200678551 Y:6180854-6180876 GTTTTCCTTTCTGCTCTAACAGG - Intergenic
1200680644 Y:6206035-6206057 GTTTTCCTTTCTGCTGTAACAGG + Intergenic
1201194862 Y:11482085-11482107 GTTTTGCTTTAAGTTGTTAGGGG + Intergenic
1201247612 Y:12021277-12021299 GTATTGCTTTCTGATGTCAAGGG - Intergenic
1201641117 Y:16178015-16178037 TTTTTGTTTTCTTTTGAGACAGG - Intergenic
1201661698 Y:16407311-16407333 TTTTTGTTTTCTTTTGAGACAGG + Intergenic
1201723040 Y:17123322-17123344 TTTTTGCTTTATGTTATGAATGG + Intergenic
1201762294 Y:17554176-17554198 GTTTTCCTTTCTGGTCTAACAGG - Intergenic
1201839258 Y:18351812-18351834 GTTTTCCTTTCTGGTCTAACAGG + Intergenic
1201999749 Y:20139603-20139625 GTTTTTCTTTCAGATGTGTCCGG + Intergenic
1202065620 Y:20936418-20936440 GTTTTGTTTTGTTTTGAGACAGG - Intergenic
1202082858 Y:21102630-21102652 GTTTTGCTATTTGTTGTGTGTGG + Intergenic
1202136645 Y:21672347-21672369 TTTTTTTTTTCAGTTGTGACGGG + Intergenic
1202268748 Y:23049063-23049085 GTATTTCTTTCTGTTTTGAGTGG + Intergenic
1202421740 Y:24682803-24682825 GTATTTCTTTCTGTTTTGAGTGG + Intergenic
1202449046 Y:24987275-24987297 GTATTTCTTTCTGTTTTGAGTGG - Intergenic
1203338629 Y_KI270740v1_random:35397-35419 GTTTTTCTTTCAGATGTGTCCGG + Intergenic