ID: 962193462

View in Genome Browser
Species Human (GRCh38)
Location 3:133335980-133336002
Sequence TAGCCGACACCCACCCATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 70}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962193459_962193462 11 Left 962193459 3:133335946-133335968 CCTGTCACAACAGAAAGCAAAAC 0: 8
1: 32
2: 104
3: 307
4: 1437
Right 962193462 3:133335980-133336002 TAGCCGACACCCACCCATCAAGG 0: 1
1: 0
2: 0
3: 2
4: 70
962193458_962193462 12 Left 962193458 3:133335945-133335967 CCCTGTCACAACAGAAAGCAAAA 0: 11
1: 34
2: 135
3: 445
4: 4065
Right 962193462 3:133335980-133336002 TAGCCGACACCCACCCATCAAGG 0: 1
1: 0
2: 0
3: 2
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962193462 Original CRISPR TAGCCGACACCCACCCATCA AGG Intronic
900663241 1:3796491-3796513 TGGCAGGCACCCACCCACCAGGG + Exonic
901083215 1:6595371-6595393 GAGATGAGACCCACCCATCATGG + Intronic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
910379385 1:86609484-86609506 CAGCTGACACCCACCCATGAAGG - Intergenic
913199001 1:116481394-116481416 TAGCCTCCACCCACCCATGCAGG + Intergenic
915062696 1:153199382-153199404 TGGCCAACACCCAGCCAGCAGGG + Intergenic
920292452 1:204933345-204933367 TAGCCCATACCCAGGCATCAAGG - Intronic
923879115 1:238084198-238084220 CAGCTGACACCCACCCACAAAGG - Intergenic
1065426997 10:25616109-25616131 CAGCTGACACCCGCCCATAAAGG - Intergenic
1065656411 10:27956121-27956143 TACCCCTCACCAACCCATCATGG + Intronic
1073299090 10:102459909-102459931 TAGCCGACAACCATCAATGAAGG + Intergenic
1074565480 10:114573684-114573706 TAGTCCACTCCCACCCATCCAGG + Intronic
1077129285 11:962034-962056 TCGCCGCCACCTGCCCATCAGGG + Intronic
1077303776 11:1858825-1858847 TAGCCGTGTCCCACCCAGCACGG + Intronic
1082110918 11:48272814-48272836 AAGCCCAGACCCACCCAGCAAGG + Intergenic
1083822986 11:65182979-65183001 TAGCCGAGTCCCACCCAGGATGG - Intronic
1092194314 12:6540219-6540241 TAGCAGACACCCACGCGTGAAGG + Exonic
1093538101 12:20247348-20247370 CAGCCAACACCCACTCATGAAGG + Intergenic
1101764207 12:107683258-107683280 CAGCTGAGACCCAGCCATCATGG - Intergenic
1110501181 13:76230754-76230776 TAGCTGATGCCCACCCATGAAGG + Intergenic
1114612710 14:24052797-24052819 TACCCACCACCCACACATCAAGG + Intronic
1116079308 14:40153692-40153714 TAGCTGATACCCACCCATGGAGG + Intergenic
1122531670 14:102432139-102432161 TAGCTGGCACACACCCATCTGGG + Intronic
1123009503 14:105340946-105340968 TAGCCGTCACCCAGCTAGCATGG + Intronic
1123192298 14:106583020-106583042 TGGGCCAAACCCACCCATCAGGG - Intergenic
1137390949 16:48081190-48081212 TAGCAGACACCTACCCCACAGGG + Intergenic
1139633951 16:68246720-68246742 TACTTGACACCCACCCATCCAGG - Intronic
1141287473 16:82685913-82685935 TGGCCGCCACCCACATATCATGG + Intronic
1141296196 16:82772074-82772096 TAACCGACACCAGCACATCAAGG - Intronic
1152789406 17:82270800-82270822 TCCCAGACAGCCACCCATCAGGG - Intronic
1156378720 18:36537514-36537536 TCTCTGACACCCACCCAGCAAGG - Intronic
1161308284 19:3578956-3578978 AAGCCGGCCCCCACCCATCTGGG - Exonic
925361261 2:3282179-3282201 TTGCCGACACCAACCCAGCAGGG - Intronic
932135950 2:69228810-69228832 TAGCAGACACCTACCCATTTAGG + Intronic
939297221 2:140282843-140282865 TAGAAAACACCCAACCATCAAGG + Intronic
948640796 2:239375006-239375028 TAGCTCACACCCACCCGTCCAGG - Intronic
948771329 2:240252663-240252685 TGGCCGCCACCCACCCAGCTGGG - Intergenic
1170601044 20:17841888-17841910 GAGCTGAGACCCAGCCATCACGG - Intergenic
1174747942 20:53082798-53082820 TAGCCAACACCTTCCCATAACGG - Intronic
1184459343 22:44628285-44628307 TCCCTGTCACCCACCCATCAAGG + Intergenic
949895352 3:8764202-8764224 TAGCCAATGGCCACCCATCAAGG - Intronic
950312050 3:11967301-11967323 TAGATGACACCCACCCATATTGG - Intergenic
951819477 3:26791861-26791883 CAGCTGACACCCACCCATGGAGG - Intergenic
952149117 3:30567314-30567336 CAGCTGACACCCACCCATAGAGG + Intergenic
952495784 3:33914747-33914769 TGGGCGACACCCACTCTTCATGG + Intergenic
959409144 3:105998318-105998340 CAGCTGACACCCACCCATGGAGG - Intergenic
962193462 3:133335980-133336002 TAGCCGACACCCACCCATCAAGG + Intronic
962699135 3:137979670-137979692 CAGCTGACACCCACCCATGGAGG - Intergenic
967128784 3:186451574-186451596 TCGCCTACATCCACTCATCAAGG + Intergenic
970440960 4:16080910-16080932 CCGCAGCCACCCACCCATCAGGG + Intronic
971758576 4:30734889-30734911 TTGGAGACACCCACCCAGCAGGG - Intronic
975723663 4:77271766-77271788 TGCCCCAAACCCACCCATCATGG - Intronic
976899120 4:90152317-90152339 TAACCTACACACACCAATCAAGG - Intronic
981203913 4:142016188-142016210 CAGCAGACACCCACACATGAAGG - Intergenic
987663096 5:20903355-20903377 CACCCGACACCCTCCCCTCAAGG + Intergenic
988759591 5:34298827-34298849 CACCCGACACCCTCCCCTCAAGG - Intergenic
989133459 5:38130190-38130212 TAACCCACCCCCACCCATCTAGG - Intergenic
991205155 5:64041700-64041722 TAGCTGACAGCCACCCACGAAGG + Intergenic
998281187 5:140808931-140808953 TGGCCCACACCCACCGACCATGG - Exonic
1001092025 5:168748586-168748608 TAGGCGACACCCGCCAACCACGG - Intronic
1004769520 6:18766021-18766043 GAGCCAACACCTACCCAACAAGG - Intergenic
1004868032 6:19873480-19873502 AAGAAGACACCCACACATCAGGG - Intergenic
1007383989 6:41508341-41508363 TTGCTGACACCTTCCCATCACGG - Intergenic
1009771321 6:68145810-68145832 CAGCTGACACCCACCCATAGAGG - Intergenic
1019412341 7:911832-911854 GAGCCGACACCCACCCAGAGAGG + Intronic
1038042135 8:23732476-23732498 CAGCCAAGACCCACACATCATGG - Intergenic
1044905100 8:96992054-96992076 TTGCTGCCACACACCCATCAAGG - Intronic
1055421836 9:76151390-76151412 CAGCTGACACCCAGCAATCATGG + Intronic
1055734807 9:79315280-79315302 TACTCGACATCCACCCAGCATGG - Intergenic
1188146380 X:26618827-26618849 TAGCAGGGAACCACCCATCAAGG - Intergenic
1190221193 X:48513398-48513420 TAGACAACACCAAGCCATCAGGG - Intronic
1191149974 X:57209909-57209931 CAGCTGACACCCACCCATGGAGG - Intergenic
1198611880 X:138411051-138411073 CAGCTGACACCCACCCATGGAGG + Intergenic