ID: 962194310

View in Genome Browser
Species Human (GRCh38)
Location 3:133347027-133347049
Sequence CGATAAAGGTTCAGTAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962194310_962194312 -7 Left 962194310 3:133347027-133347049 CCTTCATTACTGAACCTTTATCG 0: 1
1: 0
2: 0
3: 6
4: 121
Right 962194312 3:133347043-133347065 TTTATCGTAAGTCTTGAAGTTGG 0: 1
1: 26
2: 130
3: 227
4: 600

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962194310 Original CRISPR CGATAAAGGTTCAGTAATGA AGG (reversed) Intronic
909159032 1:72120922-72120944 AAAAAAAGGATCAGTAATGAAGG + Intronic
911775170 1:101800731-101800753 CTATAAACATTAAGTAATGAAGG + Intergenic
913525433 1:119687568-119687590 GGAAAAAAGTACAGTAATGAAGG - Intronic
914729407 1:150357486-150357508 CTGTAAAGCTACAGTAATGAAGG + Intergenic
916783478 1:168062235-168062257 CTTTAAAGGGACAGTAATGATGG + Intronic
916937985 1:169649992-169650014 CTATAAAGCTACAGTAATCAAGG + Intergenic
918538156 1:185597599-185597621 CGATAAGGTTTCAGTTATTACGG - Intergenic
919317578 1:195992952-195992974 AGATAAAGATTCACTAAGGAAGG - Intergenic
920220424 1:204394925-204394947 CTATAAAGTTACAGTAATCAAGG + Intergenic
1063446386 10:6120624-6120646 AGATAAGGGGTCAGAAATGAAGG - Intergenic
1065603962 10:27396621-27396643 ATAAAAAGCTTCAGTAATGAAGG + Intergenic
1066525173 10:36270600-36270622 CTATAAAGCTACAGTAATCAAGG + Intergenic
1068889887 10:62137818-62137840 CTATAAAGTTACAGTAATTATGG - Intergenic
1073728453 10:106263313-106263335 CTATAAAGTTACAGTGATGAAGG + Intergenic
1077729256 11:4711441-4711463 TTATAAATGTTCAATAATGAGGG + Intronic
1085356891 11:75846777-75846799 CTATAAAGCTACAGTAATCAAGG - Intronic
1085842875 11:80033295-80033317 ATATAAAGGTTCAGTTATGCAGG + Intergenic
1087852592 11:103049583-103049605 CAATAAAGGTTCTATAAAGAAGG - Intergenic
1097513390 12:60571595-60571617 CAATAAAAGTACAGTAATTAAGG + Intergenic
1098829537 12:75343698-75343720 GGATAAAGGTTTAGCAAAGATGG + Exonic
1100430313 12:94526373-94526395 TAAAAAATGTTCAGTAATGAAGG - Intergenic
1106497267 13:30291733-30291755 CTATAAAGTTACAGTAATCATGG + Intronic
1110350159 13:74497473-74497495 CTATAAAGCTTCAGTAATCAAGG - Intergenic
1120069501 14:80087103-80087125 CCGAAAAGGTTCACTAATGAAGG - Intergenic
1121094969 14:91211431-91211453 CTATAAAGCTACAGTAATCAAGG + Intronic
1129828708 15:78652848-78652870 CAATAAATGCTCAGAAATGATGG + Intronic
1130164995 15:81446301-81446323 CTATAAAGCTGCAGTAATCAAGG + Intergenic
1130731223 15:86494033-86494055 CGTCAAGGGTTCAGAAATGAAGG - Intronic
1142158264 16:88542885-88542907 CTGTAAATGTTCATTAATGAGGG + Intergenic
1144319352 17:14099118-14099140 AGAGCAAGGTTCAGGAATGAGGG - Intronic
1149525287 17:57350913-57350935 GGTTAAAGGTTCAGCAAGGAAGG + Intronic
1150272624 17:63876475-63876497 CGGTAATGCTTCAGGAATGATGG - Intronic
1150273964 17:63884224-63884246 CGATAATGTTTCAGGAATGATGG - Intergenic
1151094674 17:71482858-71482880 CAATAAATGTTCAGTAATTATGG + Intergenic
1153365361 18:4249541-4249563 CAGTAACCGTTCAGTAATGATGG + Intronic
1153588474 18:6648089-6648111 GGATAAAGATTCCCTAATGAAGG + Intergenic
1157975446 18:52322227-52322249 AGATAATGATTCAGTAAGGATGG + Intergenic
1164797126 19:31042462-31042484 AAATAAAGCTTCAGTAATTAGGG + Intergenic
1167687057 19:50963031-50963053 AGATGAAGGTTCAATAAAGAGGG - Intronic
926875521 2:17472980-17473002 CGATAAAGATTCATTATTTATGG + Intergenic
928537106 2:32251508-32251530 GGATAAAAGTTCAGAAAAGATGG + Exonic
933418295 2:82015137-82015159 CTATAAAGCTACAGTAATCAAGG - Intergenic
935440314 2:103086725-103086747 CTATAAAGCTACAGTAATCAAGG + Intergenic
939025778 2:137012183-137012205 CTATGGAGGTTCAGTACTGATGG + Intronic
941718957 2:168793111-168793133 GGATTAAGGATAAGTAATGAGGG - Intronic
943301620 2:186209830-186209852 TGATAAAGGTACAGTAATCAAGG - Intergenic
1170512154 20:17088701-17088723 CGATAAAGAAACAGAAATGAAGG + Intergenic
1173407692 20:42780895-42780917 AGATAGAGGTTGAGTGATGAGGG - Intronic
1174334112 20:49845617-49845639 CGATAGAGGTTGAGGGATGAAGG - Intronic
1177168992 21:17634926-17634948 CCATCAAGGATCAGTAAAGAAGG - Intergenic
1182581623 22:31316350-31316372 TTATAAAGCTACAGTAATGAAGG + Intergenic
949686856 3:6583977-6583999 CTGTAAAGATTCAGTAATCAAGG - Intergenic
954590679 3:51778956-51778978 CCATAAAGATTCAGTCATGGTGG - Exonic
956217679 3:66866182-66866204 CTATAAAGCTACAGTAATCAAGG - Intergenic
957485424 3:80855629-80855651 GTATAAAGTTTCAGTAATGCAGG - Intergenic
960585953 3:119321993-119322015 CTATAAATGTCCAGTAATGGAGG - Intronic
962090840 3:132242587-132242609 GGAAAAAGGTTAAGTAATGGAGG + Intronic
962118701 3:132539814-132539836 CAATAAAGGTTAAGTATTGTTGG - Intergenic
962194310 3:133347027-133347049 CGATAAAGGTTCAGTAATGAAGG - Intronic
963367004 3:144348081-144348103 AAAAAAAGGTTCAGTAATAATGG + Intergenic
968003370 3:195222921-195222943 AGATAAAGAATCAGTAATGATGG + Intronic
972778031 4:42261348-42261370 CAATAAAGGTTCAAAGATGAAGG + Intergenic
973099844 4:46252476-46252498 TGATATAGGTTCAAAAATGAAGG + Intronic
976061393 4:81131832-81131854 CAATAAAGCTACAGTAATCAAGG - Intronic
978678675 4:111350946-111350968 CAATCAAGGTTCAGTAGTGAGGG + Intergenic
980061022 4:128129630-128129652 CTGTAAAGCTGCAGTAATGAAGG + Intronic
981523456 4:145688950-145688972 TTATAAAGCTTCAGTAATTAAGG + Intronic
982433586 4:155354141-155354163 CGATAATGCGTCAGTAGTGAAGG - Intronic
985163551 4:187069217-187069239 CTATAAAGCTACAGTAATCAAGG - Intergenic
985315267 4:188652278-188652300 CAATAAAGATTCAGTATAGATGG - Intergenic
985988192 5:3534983-3535005 AGATAAGGATTCAGTAAGGAAGG - Intergenic
987642199 5:20627259-20627281 TGATAGATCTTCAGTAATGAAGG - Intergenic
987871516 5:23624926-23624948 ATATAACTGTTCAGTAATGATGG + Intergenic
988262678 5:28908901-28908923 CTATAAAAGTTCAGAAATGGAGG - Intergenic
989561277 5:42854722-42854744 TAATGAAGGTTCAGTAATTATGG - Intronic
990142007 5:52716331-52716353 CAATAAAGTTACAGTAATTAAGG - Intergenic
990785244 5:59411323-59411345 CAATAAAGTGTCAGTAATAAAGG - Intronic
992328316 5:75686133-75686155 AGATTAAGGTTCAGTTTTGAGGG - Intronic
1001870065 5:175146115-175146137 CTATAAAGCTGCAGTAATAAAGG + Intergenic
1004943076 6:20581619-20581641 GGCAAAAGGGTCAGTAATGATGG + Intronic
1006889314 6:37411720-37411742 CTATAAAGCTACAGTAATCAAGG - Intergenic
1008235497 6:49042428-49042450 CTATAAAGCTACAGTAATCAAGG - Intergenic
1014853322 6:126368351-126368373 CAGTAAAGGTTCTGTAATTAAGG + Intergenic
1014875924 6:126659184-126659206 CTATACAGTTTCTGTAATGAGGG + Intergenic
1016608135 6:145958549-145958571 AAATAAAGGTTCAGTCATCAGGG - Intronic
1018874623 6:167810383-167810405 TTATAAAGCTTCAGTAATTAAGG + Intergenic
1022360554 7:29652639-29652661 GAATGAAGGTTCAGGAATGAAGG + Intergenic
1022633835 7:32112195-32112217 TGACAAAGGCTGAGTAATGAGGG - Intronic
1023037488 7:36145850-36145872 CTATAAAGCTACAGTAATCAAGG + Intergenic
1023325189 7:39047088-39047110 CTATAAAGCTACAGTAATCAAGG - Intronic
1023700343 7:42886300-42886322 AAATAAATGATCAGTAATGATGG + Intergenic
1024810321 7:53203322-53203344 GGATAAAGGTTAAGAAATGCTGG - Intergenic
1027724445 7:81786155-81786177 TGCCAAAGGTTCAGTAATAATGG + Intergenic
1028897700 7:96060843-96060865 CAATGACGCTTCAGTAATGAAGG + Intronic
1029406772 7:100379951-100379973 CTGTAAAGTTTCAGTAATGCTGG + Intronic
1029898309 7:104010354-104010376 CGATAAAGGTTCAGCATCAATGG + Intergenic
1031292584 7:119955726-119955748 AGAGAAAGGTTAAGTAATAAAGG + Intergenic
1032955394 7:136964894-136964916 CTAAAAAGGTTCAGAAAGGAAGG - Intronic
1037895961 8:22655654-22655676 CTACAAAGCTACAGTAATGAAGG - Intronic
1042662446 8:71169955-71169977 TGAAAAAGGAACAGTAATGAGGG - Intergenic
1042988629 8:74613089-74613111 GGGTAGAGGTTCAGTTATGAGGG + Intronic
1046171888 8:110519841-110519863 GGAAAAAGGTTCAATAATAATGG + Intergenic
1052599685 9:30609447-30609469 CAATAAAGCTACAGTAATCAAGG + Intergenic
1056111518 9:83400635-83400657 CTATAAAGTTACAGTGATGAAGG + Intronic
1057691014 9:97285714-97285736 CTACAAAGTTACAGTAATGAAGG - Intergenic
1057754881 9:97825256-97825278 CTATAAAGCTACAGCAATGAAGG + Intergenic
1203371899 Un_KI270442v1:314786-314808 CAATAGATGATCAGTAATGATGG - Intergenic
1203375584 Un_KI270442v1:373294-373316 CAATAGATGATCAGTAATGATGG - Intergenic
1186666125 X:11719507-11719529 TTATAAAGGTTCATTCATGATGG - Intergenic
1186862895 X:13690706-13690728 CAATAAATGGTCAGAAATGAGGG - Intronic
1187989778 X:24857312-24857334 CTATAAAGCTACAGTAATCAAGG - Intronic
1188236574 X:27739050-27739072 TGATAATGATTCAGTAGTGAGGG - Intronic
1189641175 X:43072655-43072677 CTATAAAGCTACAGTAATCAAGG + Intergenic
1190344560 X:49325641-49325663 CGATAAAGTTTCAGGTATTATGG + Intronic
1190345653 X:49335201-49335223 CGATAAAGTTTCAGGTATTATGG + Intronic
1190346758 X:49344751-49344773 CGATAAAGTTTCAGGGATTATGG + Intronic
1190348007 X:49535778-49535800 CGATAAAGTTTCAGGGATTATGG + Intronic
1190349108 X:49545334-49545356 CGATAAAGTTTCAGGGATTATGG + Intronic
1190350212 X:49554890-49554912 CGATAAAGTTTCAGGGATTATGG + Intronic
1190351314 X:49564449-49564471 CGATAAAGTTTCAGGGATTATGG + Intronic
1190352414 X:49574002-49574024 CGATAAAGTTTCAGGGATTATGG + Intronic
1190353515 X:49583550-49583572 CGATAAAGTTTCAGGGATTATGG + Intronic
1190354617 X:49593072-49593094 CGATAAAGTTTCAGGGATTATGG + Intronic
1190355721 X:49602622-49602644 CGATAAAGTTTCAGGTATTATGG + Intronic
1190743438 X:53306073-53306095 AGATAGAGGTTCAGCCATGATGG + Intronic
1191820640 X:65302759-65302781 CTATAAAGCTACAGTAATCAAGG + Intergenic
1195583489 X:106534653-106534675 CAATAAAGCTACAGTAATCAAGG - Intergenic
1199425759 X:147699002-147699024 GCATAAGGGTTCAGTAAAGATGG + Intergenic