ID: 962194834

View in Genome Browser
Species Human (GRCh38)
Location 3:133352695-133352717
Sequence CCTCCCATATACCTTGCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 188}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962194834_962194839 5 Left 962194834 3:133352695-133352717 CCTAGGGCAAGGTATATGGGAGG 0: 1
1: 0
2: 2
3: 16
4: 188
Right 962194839 3:133352723-133352745 AGAGCTTCCATGCCCTTTCTGGG 0: 4
1: 40
2: 172
3: 417
4: 620
962194834_962194838 4 Left 962194834 3:133352695-133352717 CCTAGGGCAAGGTATATGGGAGG 0: 1
1: 0
2: 2
3: 16
4: 188
Right 962194838 3:133352722-133352744 CAGAGCTTCCATGCCCTTTCTGG 0: 4
1: 40
2: 104
3: 261
4: 546

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962194834 Original CRISPR CCTCCCATATACCTTGCCCT AGG (reversed) Intronic
900974989 1:6011351-6011373 CCTCCCGCACACCTGGCCCTGGG - Intronic
900975000 1:6011391-6011413 CCTCCCGCACACCTGGCCCTGGG - Intronic
900975011 1:6011431-6011453 TCTCCCACACACCTGGCCCTGGG - Intronic
901363253 1:8722252-8722274 GCACCCATCTACCTTCCCCTTGG + Intronic
904700829 1:32357147-32357169 CCTCCCCTCTGCCTTGTCCTAGG - Intronic
904769392 1:32872382-32872404 CCCGCCACATACCTTGTCCTGGG + Intronic
906260921 1:44389295-44389317 CCTCAAATATACCTTGCTGTTGG - Intergenic
906276019 1:44516614-44516636 CCTCCCATCTTCCTTTCTCTTGG - Intronic
907319153 1:53592035-53592057 CCTCCCATGGCCCTTGCCCTGGG - Intronic
907696735 1:56738413-56738435 CCTACTACATACCATGCCCTGGG - Intronic
907789667 1:57649763-57649785 CCTCCCATACACCAGGCACTGGG + Intronic
908472486 1:64457699-64457721 CCTCCCATATGCCCTGCCTCTGG - Intergenic
909440612 1:75691671-75691693 CCTCCCATCTTCCTTGCCTCAGG - Intergenic
910746174 1:90577199-90577221 TCTCCCATATGCATTTCCCTGGG + Intergenic
911777939 1:101838894-101838916 TCTCCCGTATACTTTGTCCTAGG + Intronic
913694988 1:121316124-121316146 CCTCCCAAATACCCGTCCCTGGG - Intronic
916059078 1:161086627-161086649 CCTCCCCCATCTCTTGCCCTGGG - Intronic
916170249 1:161996498-161996520 TCTCCCATTTTTCTTGCCCTTGG - Intronic
916847958 1:168672667-168672689 CCTCCCATACCCATTGCCATTGG + Intergenic
920482321 1:206334507-206334529 CCTCCCAAATACCCGTCCCTGGG - Intronic
920699274 1:208205379-208205401 CCTCCCCTACATCTGGCCCTAGG + Intronic
920978193 1:210805754-210805776 CCTCCCAAGCCCCTTGCCCTAGG + Intronic
921476551 1:215617157-215617179 CTTCCCACACACCTTACCCTGGG + Intronic
922035986 1:221848631-221848653 CTACTCATATACCTTGCACTTGG - Intergenic
923628855 1:235636406-235636428 GCTCCCCTAGACCTTGCCCCAGG - Intronic
924810958 1:247401697-247401719 CCTCCCAAATCCCCAGCCCTAGG + Intergenic
1063664126 10:8051609-8051631 CCTCCCAGGTACCTGGGCCTCGG - Intergenic
1073363405 10:102918156-102918178 CCACCCACTTACCTTGCCATTGG + Intergenic
1076433945 10:130426742-130426764 TCTCCCATGCACCTGGCCCTGGG - Intergenic
1078549151 11:12268553-12268575 CCACCCATATGCCTTGGCATGGG - Intergenic
1079695272 11:23474632-23474654 CTTCCCACATACTTTGCCCCAGG + Intergenic
1079791986 11:24749726-24749748 CCTCCCATTTCTCCTGCCCTTGG + Intronic
1080878418 11:36297592-36297614 CCTCCCTCTTCCCTTGCCCTGGG + Intronic
1080938334 11:36885653-36885675 TCTTCCATATACCTGGCCCCAGG + Intergenic
1081785196 11:45741637-45741659 CCTCCCTTTTCCCTTGTCCTCGG + Intergenic
1083261636 11:61526250-61526272 CCTCCCAGGGACCTTGCCCAGGG + Intronic
1084427283 11:69091829-69091851 CCACCCACATTCCTTGCCATAGG + Intergenic
1089105566 11:116000617-116000639 CTTCCCATACACTTTGCCCCAGG - Intergenic
1089384009 11:118056290-118056312 TCTCCCCTGTCCCTTGCCCTGGG - Intergenic
1089455224 11:118621893-118621915 CCTCCCATATTCCCTTCACTCGG + Intronic
1090048439 11:123357097-123357119 CCTCCCAAATGCCCTTCCCTCGG - Intergenic
1090832071 11:130427110-130427132 CATCCCATCTGCCTTTCCCTGGG + Intronic
1091885806 12:4016183-4016205 CCTACCATGAACCTGGCCCTGGG + Intergenic
1095335582 12:41021386-41021408 CCTCCCTTATCCCTTGTCCATGG + Intronic
1097294041 12:57943866-57943888 CCTCCCAGCCACCCTGCCCTTGG - Intronic
1106003756 13:25749629-25749651 CCTCCCATCTCCCTTGCCCCAGG - Intronic
1106715575 13:32384560-32384582 TCTCCCACACACCTTGCCTTGGG - Intronic
1108089325 13:46830355-46830377 CATCCCATATGCCATTCCCTTGG - Intergenic
1111706906 13:91761669-91761691 CTTGCCCCATACCTTGCCCTAGG - Intronic
1116473689 14:45315555-45315577 CCTCCCATTCACCTGGACCTGGG - Intergenic
1118036941 14:61877966-61877988 CTGCCAGTATACCTTGCCCTGGG + Intergenic
1119102293 14:71891232-71891254 CTTCCCAAATTCCTGGCCCTGGG - Intergenic
1119842488 14:77803737-77803759 CCTCCCACATGCCTGGCACTGGG + Intronic
1120839134 14:89067794-89067816 CCTCACATACACCTCTCCCTTGG + Intergenic
1121089943 14:91174232-91174254 CTTCCCCCACACCTTGCCCTGGG + Intronic
1121642138 14:95492598-95492620 CCTCCCACCTCCCTAGCCCTAGG - Intergenic
1122118785 14:99540897-99540919 CATCCCAGATACCCTGCACTGGG + Intronic
1125499448 15:40230056-40230078 CCTCCCATGTGCCTTGCCCTGGG - Intergenic
1128776011 15:70321138-70321160 CCTCCCAGTAACTTTGCCCTTGG - Intergenic
1129380821 15:75165002-75165024 CACCCCACATACCTTGACCTAGG + Intergenic
1129515036 15:76152190-76152212 ACCCCCATGTGCCTTGCCCTGGG + Intronic
1129579630 15:76793639-76793661 CTTTCCATTTAGCTTGCCCTAGG + Intronic
1131989508 15:98079824-98079846 GCTCCCAGAGACCCTGCCCTTGG + Intergenic
1134893412 16:17861816-17861838 CCTCCCATGCACCTTGCACCAGG + Intergenic
1137488104 16:48908555-48908577 AGTTCCAAATACCTTGCCCTTGG + Intergenic
1138461312 16:57149558-57149580 CCTCCCTTACACCTTCCCGTGGG + Intergenic
1141753934 16:85978828-85978850 CCTCCCTTTCTCCTTGCCCTTGG + Intergenic
1147477540 17:40727004-40727026 CTTCCCAGATATCTGGCCCTGGG - Intergenic
1149598945 17:57880943-57880965 CCTCCCATATTCTTTGATCTTGG - Intronic
1150316831 17:64175915-64175937 CTACCCATATGCCTTGACCTGGG + Intronic
1151517176 17:74604156-74604178 GCTCCCACAGACCTTTCCCTAGG + Intergenic
1153652755 18:7255776-7255798 ACTGCCATTTACCTTGCGCTGGG - Intergenic
1154141856 18:11831240-11831262 CCTCCCCTAGACCGTGCCCATGG - Intronic
1154356505 18:13625910-13625932 CCTCCCATGTCCCTTGGCCTGGG + Intronic
1158489000 18:57893349-57893371 TCTCCCCTATACCTTGCTCTAGG + Intergenic
1159007626 18:63026528-63026550 CCTCCCATATACCATCACCTGGG - Intergenic
1159633548 18:70778677-70778699 CCTTCCACATACCTTACTCTAGG - Intergenic
1160261355 18:77297284-77297306 CCTGCCACACACTTTGCCCTTGG - Intergenic
1162248474 19:9422931-9422953 CCATCCATATACCTTTTCCTAGG - Intronic
1162373768 19:10293436-10293458 CCGCCCAAATACCACGCCCTAGG - Intronic
1162376997 19:10310670-10310692 CCACCCAGCTAGCTTGCCCTCGG - Intronic
1164767075 19:30780449-30780471 CCTCCCAGATTTCCTGCCCTGGG + Intergenic
1164827202 19:31292534-31292556 CCATCCATTTACCTTCCCCTTGG - Intronic
1165508338 19:36249442-36249464 CTTCCCACATATGTTGCCCTAGG - Intergenic
1165632208 19:37311336-37311358 CTTCCCACATATTTTGCCCTAGG + Intergenic
1167345404 19:48942548-48942570 CCTCACCTGTACCATGCCCTTGG - Exonic
1168318187 19:55493389-55493411 TCCCCCATATCCCTTGCCTTGGG - Intronic
1168571304 19:57473115-57473137 CTTCCCATATAGCTGGCACTCGG + Exonic
1168713878 19:58516233-58516255 TCCCCCACATACCTTGCACTTGG + Intronic
925683022 2:6443183-6443205 TCTCCCATATGCCTTACCATTGG - Intergenic
926977197 2:18526759-18526781 CCTCCCAGAAACCTCACCCTGGG - Intergenic
927037389 2:19193243-19193265 AGTCCCATATAACTTGCTCTAGG + Intergenic
927041365 2:19233989-19234011 CCTCCCACTTGCCTTACCCTAGG + Intergenic
927281200 2:21308425-21308447 CTTACCATATACCTTACCATAGG - Intergenic
927685751 2:25169156-25169178 CCTCCCCTAAACCAGGCCCTTGG - Intergenic
930167632 2:48219094-48219116 GCTTCCAGATACCTTGACCTGGG - Intergenic
930675578 2:54197255-54197277 CCTCAGATATACAGTGCCCTGGG - Intronic
932231228 2:70086293-70086315 CCTCCCCTGTTCCTTACCCTTGG - Intergenic
933768991 2:85730872-85730894 CCTTCCCTCTCCCTTGCCCTTGG - Intergenic
933851734 2:86372848-86372870 CCTCCCATATCCCTTCTCCAGGG + Intergenic
938910768 2:135883893-135883915 ACCCCCACATACCATGCCCTTGG - Intergenic
943503286 2:188719336-188719358 CCTCCAATGCACTTTGCCCTGGG - Intergenic
943943490 2:194028977-194028999 CCCCACTTAGACCTTGCCCTAGG - Intergenic
944551607 2:200849615-200849637 CCTCCCTGGTACCTTGCCCTAGG - Intergenic
944648503 2:201804703-201804725 CCTCCCAAATAGCTGGCACTGGG - Intronic
947604222 2:231473631-231473653 CCTCCCATCTCCCCAGCCCTTGG - Intronic
947699112 2:232217716-232217738 CTTCCCCCATACCTCGCCCTAGG - Intronic
1168858468 20:1027801-1027823 CCTCCCATATACCGTGCCCACGG + Intergenic
1168929646 20:1610753-1610775 CCTCCCAGAAATCTTGCCCGTGG + Intronic
1169347168 20:4837984-4838006 TCTTCCATATGCCTTGACCTTGG - Intergenic
1170646647 20:18202813-18202835 CTGCCCATGTACCTTGCCCAAGG - Intergenic
1170940488 20:20844472-20844494 CCTCCCATCTCCCTCTCCCTGGG - Intergenic
1172182689 20:33013243-33013265 TCTCTCATGTGCCTTGCCCTGGG - Intronic
1172688960 20:36777688-36777710 CCTCCCATGGGCCTTGCCCTGGG + Exonic
1175118808 20:56702820-56702842 CCTGCCTTAGACCTTGTCCTTGG + Intergenic
1175517323 20:59577697-59577719 CCTCCTGAATCCCTTGCCCTTGG + Intronic
1175676622 20:60951686-60951708 CCTCCAACACACCTTGTCCTTGG + Intergenic
1177651925 21:23968750-23968772 CCTGCCATATACCCAGCCCCTGG + Intergenic
1180160299 21:45996161-45996183 CCTCCCACTTACCTGGCCCAGGG + Intronic
1183277511 22:36908654-36908676 TCTCCTATTTACCTTGCCCTGGG - Intergenic
1183277919 22:36912970-36912992 CCTCCCAAATACCTAGCACATGG - Intergenic
1183376377 22:37467775-37467797 CATCCCATAAACCCAGCCCTGGG + Intergenic
1183414426 22:37674420-37674442 CCTACTATGTACCTGGCCCTGGG - Intergenic
1184109208 22:42385127-42385149 CCGCTCATAGAGCTTGCCCTGGG - Exonic
952324911 3:32312487-32312509 CTGCCCACATGCCTTGCCCTGGG - Intronic
952742943 3:36751788-36751810 CCTACCACATACCTGGCACTAGG - Intergenic
958594155 3:96200844-96200866 CCCCCCAGCTTCCTTGCCCTGGG + Intergenic
959975291 3:112452218-112452240 CTTCCCATATCCCTAGCCCTAGG - Intergenic
960738285 3:120804298-120804320 CTTCCCACATGCCTTGCCCTAGG - Intergenic
960803361 3:121560364-121560386 CTTCCCACAAACCTTGCCATAGG - Intergenic
961043714 3:123694733-123694755 CCTGCCCCATGCCTTGCCCTGGG - Intronic
961789546 3:129365876-129365898 CCTCCCATATGCCTGGGGCTGGG - Intergenic
962194834 3:133352695-133352717 CCTCCCATATACCTTGCCCTAGG - Intronic
964072239 3:152648570-152648592 CCTCCCCAATTCCTTGCCCCTGG - Intergenic
967529077 3:190528966-190528988 TCTCCCAAATATCCTGCCCTAGG - Intronic
967856840 3:194124431-194124453 CTTCCCACGTACCTTACCCTGGG + Intergenic
972419816 4:38876825-38876847 CCACCCATATTCCTTGGCTTTGG + Intronic
976719924 4:88159305-88159327 CCACCCATTTAACTTGCTCTGGG - Intronic
976844189 4:89468667-89468689 ACTCCCAAATACCATGACCTTGG - Intergenic
978248596 4:106604409-106604431 CCTCCCATCTACAGTGCCCATGG + Intergenic
982694105 4:158580188-158580210 CTTCCCAGCTACCTGGCCCTAGG + Intronic
985887063 5:2687941-2687963 CCTCCCTCATAGCTTGCCATGGG - Intergenic
987112547 5:14701182-14701204 CTTCCCATGTACCTTGACCAAGG + Intergenic
988597463 5:32608028-32608050 CCTTCCCCATACCTTGCCCTGGG - Intergenic
988882316 5:35516845-35516867 GCTCCCATATAACTGGCCCCTGG + Intergenic
993058953 5:83016068-83016090 CCTCCCAGCTACCTTTCCCAGGG - Intergenic
993539066 5:89125437-89125459 CTTACCATAAATCTTGCCCTTGG - Intergenic
994943884 5:106360471-106360493 CCTCCCTTATACTTTTGCCTTGG - Intergenic
995033345 5:107505421-107505443 TTTCCCATATAGCATGCCCTAGG - Intronic
996159295 5:120143301-120143323 CCTCCCATAATGCTAGCCCTTGG - Intergenic
996580921 5:125031410-125031432 CCTCCCAAAGCCCTTCCCCTGGG + Intergenic
997350479 5:133227437-133227459 ACTTCCCTATACCTTGCCTTGGG + Intronic
999468364 5:151828741-151828763 CCTCCCATAAATAATGCCCTAGG - Intronic
1000364116 5:160475173-160475195 CAACCCATACACCTTGTCCTGGG - Intergenic
1002499545 5:179638927-179638949 CATTCCATTTGCCTTGCCCTAGG - Intergenic
1003148088 6:3525880-3525902 CCTCCCATTTGACTGGCCCTGGG - Intergenic
1003706942 6:8543086-8543108 CTTCCCAAACACCTTGCCCTAGG - Intergenic
1007094760 6:39206380-39206402 CCTCAGATTTACCTTGACCTTGG + Intronic
1007574523 6:42916338-42916360 CCTCCCAGCCACCTTGCTCTGGG + Intronic
1007831575 6:44642963-44642985 CCTCCCCTCTACCTTCACCTTGG - Intergenic
1007951075 6:45872959-45872981 CCTCCCATCTCCCTAGCCCAGGG + Intergenic
1008288132 6:49679592-49679614 CCTTCCATATTCCATGCCTTAGG + Intergenic
1008546834 6:52590582-52590604 CCTCCCCAAGACTTTGCCCTGGG - Intergenic
1008577670 6:52876802-52876824 CCTTCCCCATATCTTGCCCTAGG - Intronic
1008723528 6:54388557-54388579 CCTCCCATTTACCCTACCCTGGG - Intronic
1008922902 6:56861673-56861695 CCTGCCATATAGCTTCCTCTAGG - Intronic
1012832629 6:104224837-104224859 CCTTCAATATCCTTTGCCCTAGG + Intergenic
1013368628 6:109452615-109452637 CCTCTCATACCCCCTGCCCTAGG - Exonic
1017165982 6:151408783-151408805 CCACCCATATTCCTTGCTCATGG - Intronic
1017995510 6:159528522-159528544 CCTACCAAATACCTTGCCTGGGG + Intergenic
1020126134 7:5533345-5533367 CCACCCAGCCACCTTGCCCTGGG + Intronic
1020290623 7:6719806-6719828 CCTCCCATCCACCTCGCCCATGG - Intergenic
1020340969 7:7110665-7110687 CCTCCTTTATACGTTGCTCTGGG + Intergenic
1021052797 7:16009931-16009953 CCTCCCAGAACCCTGGCCCTAGG - Intergenic
1024605257 7:51017807-51017829 CCTCCCAGTTCCCTTGACCTCGG - Intronic
1024668246 7:51566605-51566627 CCTGCCACCTACCTTGACCTGGG - Intergenic
1025978443 7:66388118-66388140 CTCCCCACTTACCTTGCCCTGGG + Intronic
1026953855 7:74364551-74364573 CCCCCCATCTGCCCTGCCCTGGG - Intronic
1027162867 7:75814999-75815021 CCACCCCCATACCTTGTCCTGGG - Intronic
1028844320 7:95462107-95462129 CCTCATAAATACCTTGGCCTGGG - Intergenic
1029001463 7:97159428-97159450 CCCCCAATATCCCTTGCCCCAGG + Intronic
1031360461 7:120843551-120843573 CCTCACCTATACCTTCCCATAGG + Intronic
1032204881 7:129853887-129853909 CCTGCCATTTACCTTGCCCCAGG - Intronic
1036430191 8:8682516-8682538 CCTTCCATATACCATTTCCTGGG - Intergenic
1036630620 8:10511700-10511722 CTTCCCCCATACCTTGCCCTGGG - Intergenic
1038102112 8:24389051-24389073 CTTCTCATAAATCTTGCCCTTGG - Intronic
1039916143 8:41861741-41861763 CCTCCCAGATACCTGTCCATGGG - Intronic
1045906462 8:107351694-107351716 CTTTCCACATACCTGGCCCTAGG - Intronic
1046427744 8:114077446-114077468 CCTTTCCTATACCTTTCCCTTGG - Intergenic
1050125400 9:2352289-2352311 TGTTCCAGATACCTTGCCCTGGG - Intergenic
1050616910 9:7410791-7410813 TGTCCCTTATACCCTGCCCTTGG + Intergenic
1051608435 9:18938999-18939021 CCTCTCTTCCACCTTGCCCTAGG - Intronic
1053443617 9:38135462-38135484 CCTCCCATTCTCCTTTCCCTGGG + Intergenic
1055419694 9:76125789-76125811 CCCCACATAGACCTTGGCCTTGG - Intronic
1057293027 9:93819192-93819214 CCGCCCATCCATCTTGCCCTTGG + Intergenic
1058818832 9:108710586-108710608 CCTACCACATTCCTTGCCCCAGG + Intergenic
1059323055 9:113483949-113483971 CCTCCAATGTCTCTTGCCCTGGG + Intronic
1059325961 9:113504128-113504150 CCTTCCTTATGCCTGGCCCTGGG + Intronic
1060323243 9:122585713-122585735 ACTCCCATTTACCTTCCCCGTGG - Intergenic
1060628032 9:125131039-125131061 CCTCCCAAATACCTGGGACTGGG + Intronic
1062278381 9:135741188-135741210 CCTCCCATCTACTCTGCCCAAGG - Intronic
1196018853 X:110967987-110968009 CCTCCAACATTCCTTACCCTTGG + Intronic
1196686267 X:118513097-118513119 TCTCCCTTCTACCATGCCCTGGG + Intronic
1197825448 X:130585243-130585265 CCTCCAAGATTCCTGGCCCTTGG + Intergenic
1200377194 X:155795400-155795422 CTTCCCCAATACCTTGCCCTAGG + Intergenic
1200386680 X:155898768-155898790 CCTCCCCTACACTTTGCCCCAGG + Intronic
1201990793 Y:20023175-20023197 CCTTCCTTATACCATGTCCTTGG - Intergenic