ID: 962204435

View in Genome Browser
Species Human (GRCh38)
Location 3:133423511-133423533
Sequence CAAAGTACGGAAAAGTTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 192}

Found 19 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962204435_962204445 -9 Left 962204435 3:133423511-133423533 CCAGCCAACTTTTCCGTACTTTG 0: 1
1: 0
2: 0
3: 7
4: 192
Right 962204445 3:133423525-133423547 CGTACTTTGGGGGCGGGCGGTGG 0: 1
1: 0
2: 0
3: 4
4: 114
962204435_962204462 20 Left 962204435 3:133423511-133423533 CCAGCCAACTTTTCCGTACTTTG 0: 1
1: 0
2: 0
3: 7
4: 192
Right 962204462 3:133423554-133423576 GGGGGAGGCGGCGGGGGCGGGGG 0: 2
1: 24
2: 369
3: 3186
4: 9480
962204435_962204451 1 Left 962204435 3:133423511-133423533 CCAGCCAACTTTTCCGTACTTTG 0: 1
1: 0
2: 0
3: 7
4: 192
Right 962204451 3:133423535-133423557 GGGCGGGCGGTGGGGTGGTGGGG 0: 1
1: 1
2: 34
3: 260
4: 1938
962204435_962204447 -7 Left 962204435 3:133423511-133423533 CCAGCCAACTTTTCCGTACTTTG 0: 1
1: 0
2: 0
3: 7
4: 192
Right 962204447 3:133423527-133423549 TACTTTGGGGGCGGGCGGTGGGG 0: 1
1: 0
2: 2
3: 36
4: 334
962204435_962204446 -8 Left 962204435 3:133423511-133423533 CCAGCCAACTTTTCCGTACTTTG 0: 1
1: 0
2: 0
3: 7
4: 192
Right 962204446 3:133423526-133423548 GTACTTTGGGGGCGGGCGGTGGG 0: 1
1: 0
2: 0
3: 23
4: 332
962204435_962204460 18 Left 962204435 3:133423511-133423533 CCAGCCAACTTTTCCGTACTTTG 0: 1
1: 0
2: 0
3: 7
4: 192
Right 962204460 3:133423552-133423574 GTGGGGGAGGCGGCGGGGGCGGG 0: 1
1: 2
2: 47
3: 573
4: 4593
962204435_962204455 11 Left 962204435 3:133423511-133423533 CCAGCCAACTTTTCCGTACTTTG 0: 1
1: 0
2: 0
3: 7
4: 192
Right 962204455 3:133423545-133423567 TGGGGTGGTGGGGGAGGCGGCGG 0: 1
1: 9
2: 58
3: 569
4: 4972
962204435_962204457 13 Left 962204435 3:133423511-133423533 CCAGCCAACTTTTCCGTACTTTG 0: 1
1: 0
2: 0
3: 7
4: 192
Right 962204457 3:133423547-133423569 GGGTGGTGGGGGAGGCGGCGGGG 0: 1
1: 3
2: 32
3: 284
4: 2676
962204435_962204453 5 Left 962204435 3:133423511-133423533 CCAGCCAACTTTTCCGTACTTTG 0: 1
1: 0
2: 0
3: 7
4: 192
Right 962204453 3:133423539-133423561 GGGCGGTGGGGTGGTGGGGGAGG 0: 1
1: 8
2: 103
3: 884
4: 6210
962204435_962204454 8 Left 962204435 3:133423511-133423533 CCAGCCAACTTTTCCGTACTTTG 0: 1
1: 0
2: 0
3: 7
4: 192
Right 962204454 3:133423542-133423564 CGGTGGGGTGGTGGGGGAGGCGG 0: 1
1: 11
2: 46
3: 446
4: 3734
962204435_962204461 19 Left 962204435 3:133423511-133423533 CCAGCCAACTTTTCCGTACTTTG 0: 1
1: 0
2: 0
3: 7
4: 192
Right 962204461 3:133423553-133423575 TGGGGGAGGCGGCGGGGGCGGGG 0: 1
1: 1
2: 58
3: 559
4: 3596
962204435_962204458 14 Left 962204435 3:133423511-133423533 CCAGCCAACTTTTCCGTACTTTG 0: 1
1: 0
2: 0
3: 7
4: 192
Right 962204458 3:133423548-133423570 GGTGGTGGGGGAGGCGGCGGGGG 0: 1
1: 4
2: 124
3: 1188
4: 9328
962204435_962204463 24 Left 962204435 3:133423511-133423533 CCAGCCAACTTTTCCGTACTTTG 0: 1
1: 0
2: 0
3: 7
4: 192
Right 962204463 3:133423558-133423580 GAGGCGGCGGGGGCGGGGGTAGG 0: 1
1: 6
2: 71
3: 624
4: 3970
962204435_962204459 17 Left 962204435 3:133423511-133423533 CCAGCCAACTTTTCCGTACTTTG 0: 1
1: 0
2: 0
3: 7
4: 192
Right 962204459 3:133423551-133423573 GGTGGGGGAGGCGGCGGGGGCGG 0: 2
1: 2
2: 120
3: 1641
4: 9179
962204435_962204452 2 Left 962204435 3:133423511-133423533 CCAGCCAACTTTTCCGTACTTTG 0: 1
1: 0
2: 0
3: 7
4: 192
Right 962204452 3:133423536-133423558 GGCGGGCGGTGGGGTGGTGGGGG 0: 1
1: 2
2: 42
3: 399
4: 3423
962204435_962204456 12 Left 962204435 3:133423511-133423533 CCAGCCAACTTTTCCGTACTTTG 0: 1
1: 0
2: 0
3: 7
4: 192
Right 962204456 3:133423546-133423568 GGGGTGGTGGGGGAGGCGGCGGG 0: 1
1: 1
2: 35
3: 354
4: 3022
962204435_962204448 -4 Left 962204435 3:133423511-133423533 CCAGCCAACTTTTCCGTACTTTG 0: 1
1: 0
2: 0
3: 7
4: 192
Right 962204448 3:133423530-133423552 TTTGGGGGCGGGCGGTGGGGTGG 0: 1
1: 1
2: 17
3: 216
4: 1455
962204435_962204449 -1 Left 962204435 3:133423511-133423533 CCAGCCAACTTTTCCGTACTTTG 0: 1
1: 0
2: 0
3: 7
4: 192
Right 962204449 3:133423533-133423555 GGGGGCGGGCGGTGGGGTGGTGG 0: 1
1: 9
2: 72
3: 649
4: 4902
962204435_962204450 0 Left 962204435 3:133423511-133423533 CCAGCCAACTTTTCCGTACTTTG 0: 1
1: 0
2: 0
3: 7
4: 192
Right 962204450 3:133423534-133423556 GGGGCGGGCGGTGGGGTGGTGGG 0: 1
1: 1
2: 23
3: 233
4: 2057

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962204435 Original CRISPR CAAAGTACGGAAAAGTTGGC TGG (reversed) Intronic
903326926 1:22574138-22574160 AAAAATACAAAAAAGTTGGCCGG - Intronic
903463304 1:23534294-23534316 CAAAATACAGAAAAATTAGCTGG + Intergenic
904188510 1:28724831-28724853 AAAAGTATGGAAAATTTGCCAGG - Intergenic
905711379 1:40107272-40107294 CAAAGTGAAGAAAAGTTGGGGGG - Intergenic
908414535 1:63900155-63900177 TATAGAAAGGAAAAGTTGGCCGG + Intronic
909424826 1:75510979-75511001 AAAAGTACAGAAAAATTAGCTGG + Intronic
910573202 1:88729188-88729210 TAAAAGACGGAAATGTTGGCTGG - Intronic
912320556 1:108708916-108708938 CAATGGAATGAAAAGTTGGCAGG - Intergenic
914818769 1:151083470-151083492 AAAAGTACAGAAAAATTAGCTGG + Intronic
915154070 1:153859857-153859879 CAAAGAAAGGAAAAATTGCCTGG - Intronic
918243786 1:182642022-182642044 CCAGGTATGGAAAAGGTGGCTGG - Intergenic
918557974 1:185827467-185827489 GAAATCAAGGAAAAGTTGGCAGG + Intronic
918932448 1:190872295-190872317 CAGGGTACTGAAAAGTTGGTTGG - Intergenic
922112249 1:222572055-222572077 AAAAGTACGAAAAAATTAGCTGG + Intronic
1063064542 10:2594966-2594988 GAAAGTGAGGAAAAGCTGGCTGG - Intergenic
1065901495 10:30212207-30212229 TAAAGTACTCAAAAGTTGGCAGG + Intergenic
1066112752 10:32211700-32211722 AAAAATACAGAAAAGTTAGCCGG - Intergenic
1066752073 10:38668278-38668300 CAGAGTTTGGAACAGTTGGCAGG - Intergenic
1067075975 10:43182582-43182604 CAAAGGACAGAAAATGTGGCTGG + Intronic
1067109810 10:43392242-43392264 AAAAATACAGAAAAATTGGCCGG + Intronic
1069261830 10:66407873-66407895 AAAAATATGTAAAAGTTGGCCGG - Intronic
1074151518 10:110763623-110763645 AAAAGTAAAAAAAAGTTGGCAGG + Intronic
1074430180 10:113387588-113387610 GAAAGTCTGGAAAAGTTTGCAGG + Intergenic
1074856059 10:117474425-117474447 AAAAGTACAAAAAAGTTAGCTGG + Intergenic
1075127837 10:119715009-119715031 AAAAATACGAAAAAGTTAGCTGG - Intergenic
1076677492 10:132154694-132154716 CAAAGCAAGGGAAAGTGGGCTGG + Intronic
1077968303 11:7159761-7159783 CATAGTAAGAAAATGTTGGCTGG + Intergenic
1079170544 11:18090764-18090786 CAAAGTAAGGAAATGATTGCTGG - Intronic
1080173419 11:29333635-29333657 TAAAGTACACATAAGTTGGCTGG - Intergenic
1083460839 11:62810524-62810546 CAAACTACAGAAAAGTTGGGAGG - Intronic
1085663414 11:78391131-78391153 CAAAATACAGAAAAATTAGCTGG + Intronic
1088055357 11:105569631-105569653 CAAAATATTGAAAAGTTAGCCGG + Intergenic
1088097015 11:106113174-106113196 GAAAGTATGGAAAAGTTATCTGG - Intergenic
1092259883 12:6947102-6947124 GGAAGTGCGGAGAAGTTGGCTGG - Intronic
1092818442 12:12331353-12331375 CAAATTAAGGAAAAGGTGGGAGG + Intronic
1096325630 12:50658431-50658453 CAAAATCCAGAAAAATTGGCCGG - Intronic
1096659770 12:53117118-53117140 AAAAGTACAAAAAAGTTAGCTGG - Intronic
1100678708 12:96895525-96895547 AAAAGTACAAAAAAATTGGCTGG + Intergenic
1101110542 12:101481810-101481832 AAAAGTACAAAAAAATTGGCTGG - Intronic
1102283270 12:111635034-111635056 CAAAATAAGAAAAAGTTAGCTGG + Intergenic
1103350935 12:120283120-120283142 AAAAATACGGAAAAGTAGCCGGG + Intergenic
1103597234 12:122031186-122031208 AAAAATACGAAAAAATTGGCTGG - Intronic
1104486213 12:129152982-129153004 CAGAGCTCGGAAGAGTTGGCAGG - Intronic
1107744107 13:43486874-43486896 AAAAGTTAGGAAATGTTGGCGGG + Intronic
1116835294 14:49764321-49764343 AAAAATACAGAAAAGTTAGCCGG + Intergenic
1118310795 14:64691349-64691371 CAAAGAACACAAAAATTGGCTGG - Intergenic
1118690082 14:68329818-68329840 AAAAGTACGAAAAAATGGGCTGG + Intronic
1119378956 14:74216747-74216769 AAAATTACGTAAAAGTTGGCCGG + Intergenic
1122469125 14:101954270-101954292 AAAAGTACGTAAAAATTCGCTGG - Intergenic
1125081355 15:35677368-35677390 AAAAGTACAGAAAAATTAGCCGG + Intergenic
1125783751 15:42296220-42296242 CAAAGCAAGGAAAATTTGGGGGG - Intronic
1125975855 15:43950840-43950862 CAAAGTACCAAAATGATGGCAGG - Intronic
1126174231 15:45720975-45720997 AGAAGGAGGGAAAAGTTGGCAGG + Intergenic
1127182277 15:56434119-56434141 CAAAGTAAGAAAAAGTTGTGGGG - Exonic
1129071840 15:72957847-72957869 TTAAGAATGGAAAAGTTGGCCGG - Intergenic
1129101246 15:73266127-73266149 CACAGTACAGAAAAACTGGCTGG - Intronic
1130212166 15:81934488-81934510 CAAAATACGAAAAAATTAGCTGG - Intergenic
1132504204 16:298667-298689 CAAAGTACAAAAAAATTAGCTGG - Intronic
1134257676 16:12625501-12625523 AAAAGTACAAAAAAGTTAGCTGG + Intergenic
1138048257 16:53748923-53748945 AAAAATACAAAAAAGTTGGCCGG - Intronic
1139867890 16:70078230-70078252 AAAAGTACAGAAAAATTAGCCGG + Intergenic
1140387444 16:74553632-74553654 AAAAGTACAGAAAAATTAGCCGG - Intronic
1141196139 16:81862708-81862730 GAAAGTACAAAAAAGTTAGCTGG + Intronic
1143557101 17:7668666-7668688 CAAAACATGCAAAAGTTGGCTGG + Exonic
1143558767 17:7679211-7679233 CAAACAACAGAAAAGTGGGCTGG - Intronic
1147203360 17:38819182-38819204 GAAAGAAAGGAAAAGTTAGCTGG - Intronic
1149769581 17:59309641-59309663 CAAAATACGAAAAAATTAGCTGG + Intergenic
1150694509 17:67392966-67392988 AAAAATACAGAAAAGTTAGCCGG + Intronic
1150786118 17:68164154-68164176 CAATGTAAAGAAAAGGTGGCCGG + Intergenic
1152346456 17:79755307-79755329 AAAAGTACAAAAAAGTTAGCCGG + Intergenic
1152387583 17:79984181-79984203 AAAAGTATTGAAAAATTGGCTGG - Intronic
1155259350 18:24026211-24026233 CAAAGTTAGGAAGAGTTGGGTGG - Intronic
1156648289 18:39194266-39194288 GAAAATACGAAAAAATTGGCTGG - Intergenic
1157165963 18:45358736-45358758 AAAAATACGAAAAAGTTAGCTGG - Intronic
1158020381 18:52834494-52834516 AAAAGTTCGGAAACGTTGCCTGG - Intronic
1159418435 18:68183719-68183741 AAAAATACGAAAAAATTGGCCGG + Intergenic
1159524070 18:69565668-69565690 CAATGTATGGAATACTTGGCTGG - Intronic
1160019627 18:75170379-75170401 CAAATGACGGAAAACATGGCTGG - Intergenic
1160848165 19:1175905-1175927 AAAAGTACAAAAAAGTTAGCTGG + Intergenic
1161093224 19:2373794-2373816 CAAAGAAAGCAAAAGTTGGCCGG - Intergenic
1162855449 19:13464842-13464864 CAAAAATAGGAAAAGTTGGCCGG - Intronic
1163319940 19:16568690-16568712 AAAAGTACAAAAAAATTGGCCGG - Intronic
1164232941 19:23307079-23307101 TAAAGAAGGAAAAAGTTGGCCGG - Intronic
929282818 2:40100954-40100976 CAAAGTATGTAAAAGGAGGCTGG - Intronic
930865850 2:56121277-56121299 AAAAGTGGGGAAAAGTTAGCTGG - Intergenic
931009882 2:57898172-57898194 CAAAGTAGAGAAATGTTAGCAGG - Intergenic
931168361 2:59775783-59775805 CAAAGAAGGGTAGAGTTGGCAGG - Intergenic
931879938 2:66557981-66558003 CAAAGAAAAGGAAAGTTGGCTGG + Intronic
934514844 2:94980341-94980363 CAAAGCCTGGAAAAGGTGGCAGG + Intergenic
939492537 2:142893896-142893918 AAAAATATGGAAAAGTTGGTTGG - Intronic
939893226 2:147761787-147761809 TAAAGTAATGAAAAGTTTGCTGG - Intergenic
943212562 2:184987094-184987116 CAAACTAGGGAAAAGTTGAAAGG + Intergenic
944407971 2:199407022-199407044 TGAAGTATAGAAAAGTTGGCTGG + Intronic
944530655 2:200664767-200664789 CAAAGTGAGGAAAATTTTGCCGG - Intronic
945200783 2:207278754-207278776 ATAAGTAGAGAAAAGTTGGCTGG - Intergenic
945244470 2:207705607-207705629 AAAAGTACAAAAAAGTTAGCTGG + Intergenic
946722578 2:222626085-222626107 AAAAATACAAAAAAGTTGGCTGG + Intronic
946730734 2:222707028-222707050 AAAAATACAAAAAAGTTGGCTGG + Intronic
1168840138 20:904786-904808 AAAAATACTGAAAAATTGGCTGG - Intronic
1169972674 20:11286014-11286036 CAAAGTATGGAACAGTTGAGTGG - Intergenic
1170265007 20:14456876-14456898 AAAAATACAAAAAAGTTGGCCGG - Intronic
1171103968 20:22414228-22414250 AAAAGTACTCAAGAGTTGGCTGG + Intergenic
1171346785 20:24471168-24471190 CCTAGCACGGAGAAGTTGGCCGG - Intronic
1172069496 20:32246122-32246144 AAAAATACAGAAAAGTTAGCTGG + Intergenic
1172214548 20:33225739-33225761 CAAAGGGCTGAAAAGTTGGCAGG - Intronic
1172589246 20:36105891-36105913 CAGAATAGGGAAAAGGTGGCAGG - Intronic
1172911694 20:38414285-38414307 AAAAGTACAAAAAAATTGGCTGG - Intergenic
1172995489 20:39067273-39067295 CAAAGCAAGGAAAAGCTGGGTGG + Intergenic
1173172571 20:40739485-40739507 CATAGTATGGAAAAGCTGTCTGG - Intergenic
1173201628 20:40959383-40959405 GAAAGTACTGAACAGATGGCTGG - Intergenic
1173339844 20:42143393-42143415 AAAAGTACAGAAAAATTAGCCGG + Intronic
1177804964 21:25866225-25866247 GAAAGAAAGGAAAACTTGGCAGG - Intergenic
1177972378 21:27806649-27806671 AAAAGTATGTAAAAGTGGGCGGG - Intergenic
1181154473 22:20910334-20910356 CAATATTCTGAAAAGTTGGCCGG + Intergenic
1183506625 22:38212867-38212889 AAAAGTTCTGAAAAATTGGCTGG + Intronic
1183777620 22:39977299-39977321 CAAAGTAAGTAACAGTTGTCTGG - Intergenic
1184736419 22:46400339-46400361 AAAAGTTAGGCAAAGTTGGCTGG + Intronic
950787020 3:15445333-15445355 CAAAATAAGGAATGGTTGGCCGG - Intronic
950913420 3:16618081-16618103 CAAAGAAGGGAAAACTTGACTGG - Intronic
951242502 3:20303522-20303544 AAAAGTACAGAAAAATTAGCTGG + Intergenic
951481100 3:23163386-23163408 AAAAGTACAAAAAAGTTGGCTGG - Intergenic
953800582 3:46019684-46019706 ATAAGAATGGAAAAGTTGGCTGG + Exonic
954033239 3:47835462-47835484 AAAAGTACAAAAAAATTGGCCGG - Intronic
954033265 3:47835599-47835621 AAAAGTACAAAAAAATTGGCCGG - Intronic
955821577 3:62901531-62901553 CAAAGTACAGAGAAGATGGTGGG - Intergenic
956076139 3:65508240-65508262 AAAAATACGAAAAAGTTAGCCGG + Intronic
956478055 3:69644280-69644302 CAAAGAATGCAAAAGTTAGCTGG + Intergenic
958579818 3:96003727-96003749 CAAAGTACTAAAAAGTTGAATGG - Intergenic
959780121 3:110221296-110221318 TAAATAACGGAAAAGTTGACTGG - Intergenic
962204435 3:133423511-133423533 CAAAGTACGGAAAAGTTGGCTGG - Intronic
965994478 3:174862938-174862960 CCAAGTACAGAGGAGTTGGCTGG + Intronic
966768042 3:183479819-183479841 CAAAGCAAAGAAAAGCTGGCAGG + Intergenic
972334360 4:38093827-38093849 AAAAATACAGAAAAATTGGCTGG - Intronic
974098482 4:57391064-57391086 CAAAGTACTGAAAAATGTGCAGG - Intergenic
975342020 4:73253186-73253208 CAAAGTATACAAATGTTGGCAGG - Intronic
975930264 4:79512943-79512965 TAAAATACAGAAAAGTTGGCCGG - Intergenic
978343639 4:107742684-107742706 CAAAATATGCAAAAATTGGCTGG + Intergenic
980610755 4:135159613-135159635 CAAAATACAGAAAAGATGCCAGG + Intergenic
983959651 4:173736867-173736889 CAAAGAACTGAAATGTTGCCCGG + Intergenic
987376334 5:17238649-17238671 CAAACTAGGGAAGAGATGGCAGG - Intronic
987593338 5:19962612-19962634 AAAAATACAAAAAAGTTGGCTGG + Intronic
987906948 5:24089557-24089579 CAAAGGTTGGAACAGTTGGCAGG - Intronic
991081729 5:62608239-62608261 CAAAGTAAGGAAAAATTGTAGGG - Intronic
991336368 5:65552119-65552141 CAAAGTACAAAAAAATTAGCTGG - Intronic
991653236 5:68877366-68877388 AAAAGTACAGAAAAATTAGCCGG + Intergenic
992661632 5:78967732-78967754 CAAATTACAGAAAAGTTGCATGG - Intronic
994422197 5:99535397-99535419 CAAAAAATGCAAAAGTTGGCCGG - Intergenic
994460644 5:100065183-100065205 CAAAAAATGCAAAAGTTGGCCGG + Intergenic
994484794 5:100378592-100378614 CAAAAAATGCAAAAGTTGGCTGG + Intergenic
995686821 5:114780862-114780884 CACAGTACAGAAAAGTGGGGTGG - Intergenic
996203945 5:120707816-120707838 CACAGTATGAAAAAGTTGCCAGG + Intergenic
997191118 5:131936753-131936775 AAAAGTACGAAAAAGTAGCCAGG - Intronic
998675287 5:144401007-144401029 CAAAGTTTGGAAAGGTAGGCAGG + Intronic
1003705245 6:8520777-8520799 AAAAATACGAAAAAGTTAGCCGG + Intergenic
1005045781 6:21640954-21640976 CAAAAAAAGGAAAAGATGGCCGG - Intergenic
1005074889 6:21897186-21897208 AAAAGTACAGAAAATTAGGCTGG + Intergenic
1005694211 6:28336096-28336118 CAAGCTACGGAACAGGTGGCGGG + Intronic
1005714809 6:28536583-28536605 AAAAGTTCAGAAAAGTGGGCAGG + Intergenic
1006016217 6:31083239-31083261 TAAAGTACAGAAAAATTAGCTGG + Intergenic
1006401058 6:33817658-33817680 CAGTGTAAAGAAAAGTTGGCTGG + Intergenic
1007040634 6:38718863-38718885 CAAAGCAGGGAAAATTTGGTTGG - Intronic
1008753189 6:54761733-54761755 CAAAGTACAGATAACTTGGTAGG - Intergenic
1012045256 6:94264569-94264591 AAAAGTTTGGAAAATTTGGCAGG - Intergenic
1013295076 6:108751747-108751769 CAAAGTGAGCAAAAGTAGGCTGG + Intergenic
1015142738 6:129954180-129954202 AAAAGTACAAAAAAGTTAGCTGG - Intergenic
1016137976 6:140569895-140569917 CACAGTACTGCAAAGGTGGCTGG + Intergenic
1016559340 6:145377814-145377836 AAAAGTAAGGAAAAATTGGGAGG + Intergenic
1017409370 6:154152013-154152035 AAAAATACAGAAAAGTTAGCCGG + Intronic
1017483548 6:154881794-154881816 CAAAATACAAAAAAGTTAGCTGG + Intronic
1017725956 6:157275935-157275957 AAAAGTACGAAAAATTAGGCTGG + Intergenic
1019651310 7:2160492-2160514 AAAAGTACAGAAAAATTAGCTGG - Intronic
1021908095 7:25355612-25355634 AAAAGTACAAAAAAGTTAGCTGG - Intergenic
1021930354 7:25574986-25575008 CAAATAAGGGAAAACTTGGCAGG + Intergenic
1025815178 7:64904248-64904270 TAAAATACAGAAAAGTTAGCTGG - Intronic
1027471350 7:78578098-78578120 TTAAGTAGGGAAAATTTGGCAGG + Intronic
1028328048 7:89550680-89550702 CAAAATGCTGAGAAGTTGGCTGG + Intergenic
1028576935 7:92362578-92362600 CAAAGTACAGAACAATTGGTTGG - Intronic
1029406634 7:100378929-100378951 CAAAGTACAAAAAAATTAGCTGG + Intronic
1029981024 7:104879252-104879274 CAAAATATGCAAAAGTTAGCTGG + Intronic
1037359280 8:18055601-18055623 CAAACTCCCGAAAACTTGGCAGG + Intergenic
1038967291 8:32588702-32588724 CAAAGTAGGGTTAAGATGGCTGG - Intronic
1039995440 8:42528298-42528320 AAAAGTACAAAAAAGTTAGCCGG + Intronic
1041310027 8:56507169-56507191 TAAAGTAAGGAAAAGTGGTCGGG - Intergenic
1045628200 8:104082598-104082620 AAAAGAATGTAAAAGTTGGCTGG + Intronic
1049123261 8:140759559-140759581 GAAAGAAAGAAAAAGTTGGCTGG + Intronic
1050752381 9:8955210-8955232 CAGAATATGAAAAAGTTGGCTGG + Intronic
1051277907 9:15414868-15414890 AAAAGTACAGAAAATTTGCCTGG - Intergenic
1051697051 9:19779899-19779921 AAAAGTACAGAAAAATTAGCTGG + Intronic
1053049502 9:34947810-34947832 AAAAATAAGAAAAAGTTGGCTGG + Intergenic
1055293491 9:74809817-74809839 AAAAATACAGAAAAGTTGCCGGG + Intronic
1058052115 9:100416761-100416783 GAAAGTAAGGAAGAGCTGGCCGG - Intergenic
1059971668 9:119674915-119674937 AAAAATACAAAAAAGTTGGCCGG - Intergenic
1188013082 X:25078281-25078303 TAAAGTAAGAAAAAGTTGACTGG + Intergenic
1189588692 X:42488823-42488845 CAAATGAAGGAAAAGATGGCTGG - Intergenic
1193676120 X:84454498-84454520 AAAAGTAGGGAAGAGTTGACAGG + Intronic
1193810739 X:86047936-86047958 GAAAGTACAGAAACGATGGCGGG - Intergenic
1195692746 X:107641515-107641537 AAAAGTACAAAAAAGTTAGCTGG - Intronic
1196097773 X:111818007-111818029 CAAAGCTCAGAAAGGTTGGCAGG - Intronic
1198115850 X:133544067-133544089 CAAAAAACAGAAAAGTTAGCTGG + Intronic
1198922030 X:141739850-141739872 CAAAGTAGAGAAAAGGTTGCTGG + Intergenic