ID: 962205190

View in Genome Browser
Species Human (GRCh38)
Location 3:133428440-133428462
Sequence GAGTGAATGCACATGGAACG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 100}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962205182_962205190 8 Left 962205182 3:133428409-133428431 CCACAAATGAGCCACAGGGCCCA 0: 1
1: 0
2: 1
3: 24
4: 302
Right 962205190 3:133428440-133428462 GAGTGAATGCACATGGAACGTGG 0: 1
1: 0
2: 0
3: 10
4: 100
962205186_962205190 -3 Left 962205186 3:133428420-133428442 CCACAGGGCCCAGCTGTGGGGAG 0: 1
1: 0
2: 3
3: 73
4: 536
Right 962205190 3:133428440-133428462 GAGTGAATGCACATGGAACGTGG 0: 1
1: 0
2: 0
3: 10
4: 100
962205179_962205190 22 Left 962205179 3:133428395-133428417 CCTAGGGCACTGCTCCACAAATG 0: 1
1: 0
2: 2
3: 18
4: 177
Right 962205190 3:133428440-133428462 GAGTGAATGCACATGGAACGTGG 0: 1
1: 0
2: 0
3: 10
4: 100
962205178_962205190 23 Left 962205178 3:133428394-133428416 CCCTAGGGCACTGCTCCACAAAT 0: 1
1: 0
2: 0
3: 14
4: 192
Right 962205190 3:133428440-133428462 GAGTGAATGCACATGGAACGTGG 0: 1
1: 0
2: 0
3: 10
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962205190 Original CRISPR GAGTGAATGCACATGGAACG TGG Intronic
907443902 1:54495358-54495380 GAGTGAACGCTCATGGAAAGAGG - Intergenic
914802833 1:150973608-150973630 GAGTGGCTGCACATGTAAAGGGG - Intronic
916498996 1:165370278-165370300 GAGTGAGTTCACATGAAACCTGG + Intergenic
1063932552 10:11043702-11043724 GAGCGACTGCAGGTGGAACGCGG - Intronic
1064428968 10:15255133-15255155 GACTGCTTGCACATGGAACTTGG - Intronic
1064709646 10:18110424-18110446 GAGTGAATGTAAATGGAAAAGGG + Intergenic
1070700840 10:78600609-78600631 GAAGGAATGCACAGGAAACGAGG - Intergenic
1075136390 10:119789783-119789805 GAGTGAATGCAGATGAGAAGGGG + Intronic
1075211478 10:120494778-120494800 GAAAGAATGCACAGGGAAGGAGG - Intronic
1075447287 10:122521953-122521975 GAGGTGATGCCCATGGAACGTGG - Intergenic
1076078868 10:127559792-127559814 GAATGAATGCACAGTGAAGGGGG + Intergenic
1086087913 11:82974107-82974129 GAGTGATTGCAAATGGTATGGGG + Exonic
1087164456 11:94987166-94987188 CTGTGAATGCAAATGGAACAAGG + Intronic
1091754736 12:3044028-3044050 GAGCGAATGCACATGGCAGGCGG + Intergenic
1092519950 12:9260384-9260406 GAGTGAATGCACTTTGCATGAGG + Intergenic
1095849843 12:46790387-46790409 GGGTGAATGGAAATGGAAAGAGG - Intronic
1103500286 12:121396491-121396513 GAGTTAATGCAGCTGGAAAGTGG - Intronic
1103983017 12:124748975-124748997 GGGTGACTGCGCATGGAACAGGG + Intergenic
1104927782 12:132322547-132322569 GAGTGTTTGCACAGGGAATGGGG + Intronic
1109662730 13:65486007-65486029 GAGTGAAAGCAATTGGAGCGGGG + Intergenic
1117735782 14:58767106-58767128 GTGTGAATGTTCATGGTACGTGG + Intergenic
1120249510 14:82045649-82045671 AAGTGTATTCACATGTAACGTGG + Intergenic
1122378506 14:101285452-101285474 CAGTGAATGCACATTGATTGGGG - Intergenic
1127308970 15:57734714-57734736 GAGAGAATGCACATGGGCCATGG + Intronic
1128058277 15:64717036-64717058 GAGGGAATACACAGGGAACAGGG - Intergenic
1135208005 16:20499217-20499239 CAGTGCTTGCACATGGAACATGG + Intergenic
1135210894 16:20524483-20524505 CAGTGCTTGCACATGGAACATGG - Intergenic
1137514834 16:49134025-49134047 GAGTGAATGAGCATGAAACGAGG - Intergenic
1140913309 16:79473072-79473094 GAGTGAGGGGACATGGAACTGGG + Intergenic
1143598775 17:7930814-7930836 GTGTGAATGCACAAGGAATAAGG + Intronic
1143840266 17:9726205-9726227 GAGTGAATGCTGCAGGAACGCGG - Intronic
1144049364 17:11485393-11485415 GATTGCATGCTCATGTAACGGGG + Intronic
1148407315 17:47427758-47427780 GAGAGATTGCACATGCAAAGAGG - Intronic
1152438502 17:80290503-80290525 GTGTGCATGCACATGGCAGGTGG + Intronic
1203197962 17_KI270729v1_random:249492-249514 GAATGGATGCGCATGGAATGGGG + Intergenic
1203207566 17_KI270730v1_random:50246-50268 GAATGGATGCGCATGGAATGGGG + Intergenic
1159836280 18:73340262-73340284 CAGTGAATGAACATGAAGCGTGG + Intergenic
1163360800 19:16844931-16844953 GAGTGCATGGACATGGGAGGGGG + Intronic
1163718682 19:18887363-18887385 GAGTGACTGCTAATGGGACGGGG + Intronic
1165010223 19:32840629-32840651 GAGAGAAAGGACATGGAACTTGG - Intronic
927225221 2:20758016-20758038 GGATGTATGCACATGGAAAGAGG - Intronic
928093948 2:28392798-28392820 GAGTGAATCCACATGGTACAGGG + Intronic
929448717 2:42021676-42021698 GAGTGAATCCACACTGAACTGGG - Intergenic
929553148 2:42906897-42906919 GAGGGAATGGAGATGGAAGGAGG - Intergenic
931542683 2:63346794-63346816 GAGGGAATGCAAGTGGAACATGG - Intronic
933517777 2:83328043-83328065 GAATGAATGCACACGGAAACAGG + Intergenic
938015235 2:127861417-127861439 GAATGATTGCTCATGGAACTTGG + Intergenic
942054740 2:172172163-172172185 GATTCAATTCACAGGGAACGTGG + Intergenic
945943544 2:215972968-215972990 GAGTGAATGGACATGTAACTGGG + Intronic
1168801928 20:648936-648958 GAGTCAATGGACATGGTACAAGG + Intronic
1169597339 20:7215248-7215270 GAGTGAAAGAATATGGAACAAGG - Intergenic
1169798802 20:9494559-9494581 GAGTGGATGCAAATGAAACCAGG - Intergenic
1176372465 21:6070628-6070650 GAGTAAATGCACAGGGGCCGGGG - Intergenic
1179751011 21:43467617-43467639 GAGTAAATGCACAGGGGCCGGGG + Intergenic
1181361557 22:22341717-22341739 GAGGGAATGCACATAGGAAGAGG + Intergenic
1184335925 22:43853252-43853274 AAGTGAGTACACATGGGACGTGG - Intronic
1184574838 22:45355203-45355225 GAGTGGATGCACAGGGACCTGGG - Intronic
1184702451 22:46185185-46185207 GAGTGAAAACAGATGGAACATGG - Intronic
1184723821 22:46331705-46331727 GAGTCACTGCTCATGGAGCGGGG - Intronic
952370062 3:32713631-32713653 GAGTGACTGCAAATGGTACAGGG - Intronic
953660235 3:44886603-44886625 GAGGGAATGCACATGGACCCAGG - Intronic
960281493 3:115785401-115785423 GTGTGCATGCTCATGAAACGTGG - Intergenic
961374813 3:126457109-126457131 AATTAAATGCACATGGAACCTGG + Intronic
962205190 3:133428440-133428462 GAGTGAATGCACATGGAACGTGG + Intronic
964278675 3:155037531-155037553 GAGTGAAATCACAGAGAACGGGG + Intronic
970007951 4:11428547-11428569 GAGTGGATGCAGAGGGAACCAGG - Intronic
972196700 4:36661971-36661993 GAGTGAATACTAATGGAAAGAGG + Intergenic
974833125 4:67213488-67213510 GTGTGTATGCATATGGAATGTGG - Intergenic
976920830 4:90441004-90441026 TAATGAATGCACAAGGGACGAGG + Intronic
981575346 4:146198407-146198429 GAGAGAATGCTCATTGAACGGGG + Intronic
983504999 4:168543531-168543553 GATTGAATGCAAATGGCAGGAGG + Intronic
984447575 4:179856326-179856348 GAGTGGATGCATACGGAACCAGG - Intergenic
988914815 5:35881864-35881886 AAATGAATGCACATGGTACTGGG + Intergenic
988992389 5:36684173-36684195 GAGTGAGTGCACATGGCATCTGG - Intronic
989174177 5:38505004-38505026 GTGTTAATGCACATGGACCATGG + Intronic
989191649 5:38676173-38676195 TAGTGAATGCACATAGCAGGAGG + Intergenic
991558391 5:67922261-67922283 GATTGAATTCACATGGAATTAGG - Intergenic
995941559 5:117592104-117592126 GAGAGAATGCACATGTGAAGTGG - Intergenic
1004403095 6:15306794-15306816 GAGTGAAGGAAAATGGAAGGTGG + Intronic
1007388701 6:41537155-41537177 GAGTGAATGCGCCTAGAAGGAGG + Intergenic
1007933764 6:45715321-45715343 GAGTGATTGAACCTTGAACGTGG + Intergenic
1008124324 6:47651613-47651635 GAGCACATGCAGATGGAACGTGG + Intergenic
1013978758 6:116105245-116105267 GGGTGAATGCAGAGGGAATGGGG - Intronic
1020870263 7:13620580-13620602 AAGTCAATGCACAAGGAAAGAGG + Intergenic
1022857495 7:34329802-34329824 GAGGGAATACACATGGAGCATGG + Intergenic
1023848870 7:44139608-44139630 GAGTGACTGCACAGGGAAGGTGG + Intronic
1032007067 7:128311124-128311146 GAGTGAGTGCACAGGGAGCAGGG + Intronic
1032619782 7:133517421-133517443 GAGCTAATACACATGGAGCGGGG - Intronic
1034135977 7:148770350-148770372 GAGTGAAGGCAGATGCAACGTGG - Intronic
1034894772 7:154869448-154869470 GTGGGAATGCTCACGGAACGTGG + Intronic
1035689659 8:1551678-1551700 GCGTGAGTGCAGATGGAATGAGG - Intronic
1038659189 8:29482071-29482093 CAGTGAGTGCAAATGGAAGGTGG + Intergenic
1039898230 8:41731354-41731376 GATTGAATGCAAGTGGAAGGGGG + Intronic
1043511896 8:80958104-80958126 GAGTGAAAGCACAGGAAAAGAGG - Intergenic
1043662883 8:82767877-82767899 GAGTGAATATCCATGGAACAAGG + Intergenic
1049443837 8:142621119-142621141 GACTCAATCAACATGGAACGAGG - Intergenic
1050063149 9:1731428-1731450 GATTGAAACCACATGGAATGGGG - Intergenic
1059462953 9:114446751-114446773 GAGTTAAGGCAGATGGAAGGAGG - Intronic
1059506307 9:114802847-114802869 GCCTGAATGCACAGGGAAGGAGG + Intronic
1059727011 9:117018787-117018809 CATTGAATGCACATGGAAAATGG + Intronic
1061003669 9:127916587-127916609 GGGTGAAAGCACATGGCACCCGG + Intronic
1186175092 X:6918357-6918379 CAGTGAATGCCCATGGAACTGGG - Intergenic
1189087072 X:38036566-38036588 CAGTTAATGCAGATGGAACAAGG - Intronic
1189257202 X:39649772-39649794 GGATGACTGCACATGGAAGGAGG - Intergenic
1190968935 X:55330310-55330332 GGGTCAATGCACATGGCACTGGG + Intergenic
1194385687 X:93252047-93252069 GGGAGAATGGACATGGAAAGAGG - Intergenic
1195295357 X:103471189-103471211 GAGTGAATACACAAGGAAAATGG + Intergenic
1196259224 X:113558511-113558533 GAGAGAAGGAACATGGAAGGAGG + Intergenic
1198700527 X:139392651-139392673 GTGTGTGTGCACATGGAAGGAGG - Intergenic
1198769731 X:140117152-140117174 GAGTGAATGCTCAGGTAACCTGG - Intergenic
1199573771 X:149293050-149293072 GAGTACATGCACATGGAAGATGG - Intergenic