ID: 962206579

View in Genome Browser
Species Human (GRCh38)
Location 3:133440039-133440061
Sequence AACCCACAGTTCCCCACGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5202
Summary {0: 1, 1: 0, 2: 19, 3: 475, 4: 4707}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962206576_962206579 16 Left 962206576 3:133440000-133440022 CCTGAGACTGGGTAATTCATAAA 0: 172
1: 6943
2: 13513
3: 14104
4: 10977
Right 962206579 3:133440039-133440061 AACCCACAGTTCCCCACGGCTGG 0: 1
1: 0
2: 19
3: 475
4: 4707

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962206579 Original CRISPR AACCCACAGTTCCCCACGGC TGG Intronic
Too many off-targets to display for this crispr