ID: 962206579 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:133440039-133440061 |
| Sequence | AACCCACAGTTCCCCACGGC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 5202 | |||
| Summary | {0: 1, 1: 0, 2: 19, 3: 475, 4: 4707} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 962206576_962206579 | 16 | Left | 962206576 | 3:133440000-133440022 | CCTGAGACTGGGTAATTCATAAA | 0: 172 1: 6943 2: 13513 3: 14104 4: 10977 |
||
| Right | 962206579 | 3:133440039-133440061 | AACCCACAGTTCCCCACGGCTGG | 0: 1 1: 0 2: 19 3: 475 4: 4707 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 962206579 | Original CRISPR | AACCCACAGTTCCCCACGGC TGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||