ID: 962210287

View in Genome Browser
Species Human (GRCh38)
Location 3:133471898-133471920
Sequence TTTCAGCAGCAGAGGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 560
Summary {0: 1, 1: 0, 2: 5, 3: 47, 4: 507}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962210283_962210287 -6 Left 962210283 3:133471881-133471903 CCAAATGATGGATGGGGTTTCAG 0: 1
1: 0
2: 0
3: 8
4: 102
Right 962210287 3:133471898-133471920 TTTCAGCAGCAGAGGGAGAAGGG 0: 1
1: 0
2: 5
3: 47
4: 507
962210282_962210287 -2 Left 962210282 3:133471877-133471899 CCAGCCAAATGATGGATGGGGTT 0: 1
1: 0
2: 0
3: 8
4: 72
Right 962210287 3:133471898-133471920 TTTCAGCAGCAGAGGGAGAAGGG 0: 1
1: 0
2: 5
3: 47
4: 507

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962210287 Original CRISPR TTTCAGCAGCAGAGGGAGAA GGG Intronic
900277447 1:1840718-1840740 TGTCAGCAGGAGAGGGACAGAGG - Intronic
900773804 1:4566458-4566480 TTGCAGCAGGAGAGGGAAATAGG - Intergenic
901500720 1:9651401-9651423 TTTCAGCAGGAGCGGGAGAAAGG - Intergenic
902566621 1:17315682-17315704 GTTCAACAGGAGAGAGAGAAGGG + Intronic
902697813 1:18152059-18152081 ATATAGCAACAGAGGGAGAAAGG - Intronic
902918807 1:19654566-19654588 TCACAGCATCAAAGGGAGAAAGG + Intronic
903352367 1:22725387-22725409 TTTCATGAGTAGAGGGACAATGG + Intronic
903884835 1:26535162-26535184 TCTCAGCAGCCTGGGGAGAAGGG - Intronic
905342543 1:37289229-37289251 TCTCAGGAGCTGAAGGAGAAGGG + Intergenic
905440003 1:37989683-37989705 TTTTACCAGCTGAGGCAGAAAGG + Intronic
905605349 1:39293657-39293679 TAACAGCAGCAGAAGGAGACAGG + Intronic
905651633 1:39660801-39660823 TTTGAGCTGCAGAGGGGGGATGG + Intronic
905869753 1:41396391-41396413 TTTCCGCAGCAGATGGAGCGAGG + Intergenic
905970112 1:42135351-42135373 CACCAGCAGCAGAGGAAGAAAGG - Intergenic
906155918 1:43613825-43613847 TTTCAGGAGCACAGAGAGGAGGG + Intronic
906672136 1:47664120-47664142 TTTCAAAACCAGAGGGAGATAGG - Intergenic
906755396 1:48309203-48309225 TTCCAGAAAAAGAGGGAGAAAGG - Intronic
907573234 1:55503352-55503374 TTTCAACTGCTGAGGGAGAGGGG + Intergenic
908186714 1:61659290-61659312 TTTCATCACTAGAGGGAGACAGG - Intergenic
908774521 1:67627308-67627330 TCTCAGCAGGAGAAGGAGGATGG + Intergenic
909398564 1:75198469-75198491 TTTCAGCAGCACTGTGAGGAGGG + Intergenic
910294817 1:85633806-85633828 TTTGAGTAAAAGAGGGAGAAGGG - Intergenic
910514014 1:88037573-88037595 TGGCAGCAGCAGTGGCAGAAGGG - Intergenic
910528702 1:88210985-88211007 TCTCAGCAGCAGATGGATGAAGG + Intergenic
911380158 1:97104686-97104708 AATAAACAGCAGAGGGAGAAGGG + Intronic
911569620 1:99507599-99507621 CTTCAGCAACAGAGGGAGAGGGG - Intergenic
912509899 1:110182171-110182193 TTTCAGAAGCAGAGTCAAAAGGG + Intronic
912864961 1:113248538-113248560 TGGCAGGGGCAGAGGGAGAAAGG - Intergenic
913387258 1:118272160-118272182 ATCTAGCTGCAGAGGGAGAAAGG + Intergenic
914460692 1:147880957-147880979 TTTCAGCACCATATGGGGAAAGG + Intergenic
915193233 1:154169434-154169456 TTTCAGAAGCAGATGAAGAGAGG + Intronic
915457680 1:156051484-156051506 GTAAACCAGCAGAGGGAGAAAGG + Intronic
915602761 1:156932553-156932575 CTTCAGCAGGAGAGAGTGAAAGG - Intronic
915825654 1:159073237-159073259 CTTCAGGAGGAGAAGGAGAAAGG - Exonic
915942565 1:160128165-160128187 TTTCAGCAGCAGAGTTAGGGAGG - Intronic
916352118 1:163862468-163862490 ATGCAGTGGCAGAGGGAGAAGGG + Intergenic
916456104 1:164972443-164972465 AGGCAGCAGCAGAGGCAGAAGGG - Intergenic
916880593 1:169016499-169016521 TTGCAGCAGGAGTAGGAGAAAGG - Intergenic
917447778 1:175121247-175121269 TTACAGAAGAAGGGGGAGAATGG + Intronic
920623966 1:207577905-207577927 TCTTGGAAGCAGAGGGAGAAAGG + Exonic
920636605 1:207710482-207710504 TCTTGGAAGCAGAGGGAGAAAGG + Intronic
920676086 1:208039706-208039728 ATCAAGCAGCAGATGGAGAAGGG - Exonic
920928393 1:210364524-210364546 TTTTAGCTGCAGAGGAACAATGG + Intronic
921079806 1:211730206-211730228 TTTAAGCAAAAGAGGGAAAAGGG + Intergenic
921702733 1:218285740-218285762 TTACAGTAGCAAAGGGTGAAAGG + Intronic
922421715 1:225464996-225465018 GTTCAGCTGCAGAGGGAGGCTGG + Intergenic
922427947 1:225517301-225517323 GGGCAGCTGCAGAGGGAGAAGGG + Exonic
1063080847 10:2765887-2765909 TCTCAGGAGCACAGGGAGGAGGG - Intergenic
1064005517 10:11696062-11696084 TTTTACCAAGAGAGGGAGAAAGG - Intergenic
1064915105 10:20448041-20448063 TTTCTCCAGCAGATGAAGAAAGG + Intergenic
1066461984 10:35620303-35620325 TGTCTGAAGCAGAGGGAGACTGG - Intergenic
1067099033 10:43321460-43321482 TTTCTTCAGCAGTGTGAGAACGG + Intergenic
1067168576 10:43885133-43885155 TACAAGCAGAAGAGGGAGAATGG - Intergenic
1067344530 10:45427995-45428017 CTGCAGAAGCAGAGGGGGAAGGG - Intronic
1069782013 10:70962830-70962852 TTTCCCCAGCAGAGGGGCAACGG - Intergenic
1071810036 10:89169478-89169500 TTTCTTCAGATGAGGGAGAAAGG + Intergenic
1071815481 10:89228114-89228136 TTCCAGCAGAAGAGGTAGATAGG - Intronic
1073063905 10:100747361-100747383 TTACAGAAGAAAAGGGAGAAGGG + Intronic
1073201502 10:101739369-101739391 TTCCCAAAGCAGAGGGAGAATGG + Intergenic
1073631531 10:105154540-105154562 TTTCAGCAGTCCAGGGAGAAGGG - Intronic
1073659541 10:105459636-105459658 CTTCAGCAGGATAGGGAAAAAGG + Intergenic
1073710138 10:106027470-106027492 TTTTATCAGCAGTGTGAGAATGG - Intergenic
1074415386 10:113262858-113262880 TTTCAGCAGCACAAGGAGAATGG + Intergenic
1074548038 10:114417022-114417044 TTACAGCCCCAGAGGGAGACAGG + Intergenic
1076352262 10:129825369-129825391 CTGCAGCAGCAGAGGGAGGGAGG + Intergenic
1076607644 10:131700010-131700032 TTTGAGCTGCAGAGGGAGCATGG - Intergenic
1078162289 11:8851958-8851980 TTTCAGGAGCCCAGGGATAATGG - Intronic
1078312155 11:10255048-10255070 TCACAGAAGCAGAGGGTGAATGG + Intronic
1078397819 11:10997186-10997208 TTTCTGCAGCATGGGAAGAAGGG + Intergenic
1079765988 11:24393907-24393929 TTACATCAGCAAAGAGAGAAAGG + Intergenic
1080879796 11:36308869-36308891 ATTCTGGAGCACAGGGAGAAAGG - Intronic
1081868452 11:46372356-46372378 TGGGAGCAGCAGAGGGAGAGGGG - Intronic
1083202831 11:61130866-61130888 TTACATCAACAGAGTGAGAAGGG + Exonic
1083318806 11:61832684-61832706 TTTCTGCAGCAGAGAGAGGCAGG - Intronic
1084175007 11:67418479-67418501 CTCCAGCAGCACAGGCAGAAAGG - Exonic
1084566678 11:69932585-69932607 TTCCAGCTGCAGGTGGAGAATGG - Intergenic
1084683637 11:70681197-70681219 GCTGAGCAGCAGAGAGAGAACGG - Intronic
1084989367 11:72909070-72909092 TATCGGCAACAGAGGGAGACCGG - Intronic
1085446815 11:76606298-76606320 TTGCAGCAGAAGAGTGAGAAGGG - Intergenic
1087091162 11:94274569-94274591 CTCCAGCAGCAGAAGGAGAGAGG - Intergenic
1087901204 11:103643741-103643763 TCTCAACAGCAGAGAAAGAAGGG + Intergenic
1088704686 11:112451373-112451395 TTTCAGTGGCAGATGGAAAAGGG - Intergenic
1088723649 11:112616152-112616174 TTTCAGAAGAAGAGAGACAAAGG + Intergenic
1089650766 11:119911228-119911250 CTTCAGCAGCAGAGGGAGGAGGG + Intergenic
1089970054 11:122686058-122686080 TTCCATGAGCAGAGGGAGAAGGG - Intronic
1090072968 11:123560364-123560386 TAACAGCAGCAGAGGGAGGTGGG + Intronic
1090455906 11:126849607-126849629 AATCAGCTGCAGAAGGAGAAAGG + Intronic
1090511155 11:127376640-127376662 TTCCAGCAGCTGTGTGAGAATGG - Intergenic
1091206789 11:133827036-133827058 TGGCTGCAGCAGAGGGAGCAAGG - Intergenic
1091562935 12:1628719-1628741 TTTCATCAGCATGGGCAGAATGG - Intronic
1091854706 12:3730155-3730177 TTTTTCCAGCAGAGGGAGGAGGG - Intronic
1091917198 12:4278202-4278224 TTTGAGCAGCAGAGAGATAAAGG + Intronic
1092389823 12:8066557-8066579 TTTCTGCAGCACACAGAGAATGG + Intergenic
1092555780 12:9560160-9560182 TTTTGGCAGCAGAGTCAGAAAGG + Intergenic
1093613487 12:21191694-21191716 TTTCAGGAACAAAGGAAGAATGG - Intronic
1094082795 12:26555876-26555898 TTTCATTAACATAGGGAGAAAGG - Intronic
1094152001 12:27295008-27295030 TTTCAGGATCAGATGCAGAAAGG - Intronic
1095282305 12:40368759-40368781 TTTCAGTTGCTGAAGGAGAAAGG + Exonic
1095489538 12:42718593-42718615 TTTAAGGAGGAGAGAGAGAAAGG - Intergenic
1095663234 12:44762574-44762596 TTTCAGCTGAAGAGGTAGGATGG - Intronic
1095842533 12:46709874-46709896 TCCCAGCAGAAGAGGGAGGAGGG + Intergenic
1096023569 12:48342258-48342280 TTTCAGCAGGTGAGGGTGAGAGG + Exonic
1096979794 12:55721815-55721837 TTGCTGCAGCAGAGGCAGCAGGG - Exonic
1097419123 12:59352177-59352199 TATCAGCAGCTCAGGGATAAGGG + Intergenic
1097759479 12:63445467-63445489 ATTCATCAGCTGAGAGAGAAAGG + Intergenic
1097813015 12:64038738-64038760 TTTCAGCAGTTGAGGAAAAATGG + Intronic
1098755348 12:74355498-74355520 TTTCAGCAGCAGTGGAATACTGG + Intergenic
1099540132 12:83897763-83897785 TTTCAGCAATGGAGGGAGATGGG + Intergenic
1099837596 12:87927011-87927033 TTTAAGAAGAAGAGGGAGCATGG - Intergenic
1100001370 12:89840374-89840396 TTTCAGCAGCAGGTGGTGAGAGG - Intergenic
1100154440 12:91781212-91781234 ATTCACCAGGAAAGGGAGAAGGG - Intergenic
1100390403 12:94141806-94141828 TTACAGCAGCAGAGGCTGGAAGG + Intergenic
1100461458 12:94804014-94804036 ATTCTGGAGCAGAGAGAGAATGG - Intergenic
1100924125 12:99524486-99524508 TATAAGTAGAAGAGGGAGAAAGG + Intronic
1101138172 12:101767405-101767427 TTTCAGCAGCAGATTGTGATAGG - Intronic
1101211464 12:102539117-102539139 TTTCAGCAGCAGCAGCAGCAGGG + Intergenic
1101310338 12:103572944-103572966 TTCAAGCAGGAGAGGGAGAGAGG + Intergenic
1102385448 12:112505268-112505290 TTCCAGCAGCAGAGCTGGAAGGG - Intronic
1102433322 12:112900537-112900559 TGCCAGGAGCACAGGGAGAATGG - Intergenic
1102505634 12:113383089-113383111 TTCCAGCAGGAAATGGAGAAGGG + Intronic
1102966935 12:117135151-117135173 ATTCAGGAGCAGAGGCAGGAGGG - Intergenic
1103046964 12:117744152-117744174 TTCAAGCAGCAGAGGCAGGATGG - Intronic
1103617939 12:122166876-122166898 TTTCAGTGACAGAAGGAGAAAGG + Intergenic
1104002998 12:124872365-124872387 TCTCAACAGCAGCTGGAGAAAGG + Intronic
1104678050 12:130729231-130729253 TCTCACCTGCAGAGGGAGACCGG - Intergenic
1106343169 13:28850610-28850632 GTTAAACAGTAGAGGGAGAAGGG + Intronic
1106360761 13:29028511-29028533 CTGAAGCAGCAGAGTGAGAAAGG - Intronic
1106500482 13:30323630-30323652 TTGCAGCAGCAGTAGGAGGAGGG + Intergenic
1106683643 13:32033916-32033938 TTTGAGCAGCAAAGAGAGAAAGG + Intronic
1107462368 13:40616505-40616527 TTTCAGAAGAAGAGGGACCATGG + Intronic
1107737879 13:43417181-43417203 CCTCAGCAACAGAGGGAGACGGG + Intronic
1107925524 13:45257811-45257833 TTTCAGCAGAAGAGCGGAAATGG + Intronic
1108889554 13:55237069-55237091 TTCCAGCAGGAGAGGGAAAGGGG - Intergenic
1109403811 13:61871403-61871425 TTGCAGAAACAGAAGGAGAATGG + Intergenic
1110583471 13:77159656-77159678 TGGCAGCAGGAGAGAGAGAAGGG - Intronic
1110646492 13:77891643-77891665 TATCAACATCAGAGTGAGAAGGG - Intergenic
1111448285 13:88379260-88379282 TATCATCAGCAGGGGCAGAAAGG + Intergenic
1112736725 13:102429428-102429450 TTCCAGAAGAAGAGGGGGAAAGG - Intergenic
1112824906 13:103381319-103381341 CTTTAGCAGCAGTGTGAGAAGGG - Intergenic
1113046974 13:106167186-106167208 TTTCAGAATCCAAGGGAGAAAGG - Intergenic
1113232333 13:108226550-108226572 TTTTATCTGAAGAGGGAGAAAGG + Intronic
1114751726 14:25211440-25211462 TTTATGCAGAAGAGGGAGAGAGG + Intergenic
1114788016 14:25623331-25623353 CTTCTGCAGCAAAGGGAGGAAGG + Intergenic
1115183606 14:30658205-30658227 AGTCAGTAGCAGAGGGTGAAAGG - Intronic
1115803897 14:37029660-37029682 TTTCAGCAAGATAGGGAGTAGGG + Intronic
1116780086 14:49227564-49227586 TTTAAGAAAGAGAGGGAGAATGG - Intergenic
1116782489 14:49251297-49251319 TTCCAGCAGCAGCGGCAGCATGG - Intergenic
1118364276 14:65081139-65081161 TTTCAGCAGAGGATGGAGGAAGG - Intronic
1119002742 14:70897768-70897790 GTACAGAAGCAGAGGGAGGAAGG + Intergenic
1119592098 14:75899563-75899585 TTTCTACATCACAGGGAGAATGG + Intronic
1120540245 14:85742218-85742240 TTTCAGAAGCAGAGAGAGAGAGG - Intergenic
1120689605 14:87577874-87577896 TTGCAGAAGCAGAGAGAAAATGG + Intergenic
1121214731 14:92238977-92238999 ATTCAGCAGCACAGGGCCAAGGG + Intergenic
1121743867 14:96272762-96272784 TTTCTACAGCAGAGAAAGAATGG - Intergenic
1122114033 14:99518773-99518795 TTTCTGCAGCACAGGCAGGAGGG + Intronic
1122578428 14:102756235-102756257 TTTAAGCAGCATAGGGATACAGG - Intergenic
1123430561 15:20211990-20212012 TTTGAGCAGGAGGGTGAGAAAGG - Intergenic
1124129877 15:26974085-26974107 TTTCAGGATTTGAGGGAGAAGGG + Intronic
1124375844 15:29128210-29128232 CCTTAGCAGCAGAGGGAGAAAGG - Intronic
1124425412 15:29558669-29558691 TTTCAACTGCAGAGGGAGTCAGG - Intronic
1125390431 15:39186618-39186640 CTCCAGGAGCAGAGGAAGAACGG - Intergenic
1125967650 15:43887226-43887248 TCTCCGCAGCAGAGAGAGGAAGG - Intronic
1126456926 15:48873264-48873286 TTTCTGGAGCACAGGAAGAAGGG + Intronic
1126515991 15:49538560-49538582 TTTCAGATGAAGAGAGAGAAAGG - Intronic
1127776213 15:62266068-62266090 TTTCAGGAGCACAGGGAGTCTGG - Intergenic
1127840899 15:62830673-62830695 TTTCAGCAGTAGAGGTAGGGTGG + Intronic
1128703977 15:69825236-69825258 TCTCAAAAGCACAGGGAGAAAGG - Intergenic
1128769243 15:70269422-70269444 TTTCAGAAGCCAAGGGGGAAAGG + Intergenic
1129665355 15:77576498-77576520 TTTCAGCTGGAAGGGGAGAAAGG + Intergenic
1130127022 15:81102558-81102580 CTTCAGAGGCAGAGGTAGAAGGG + Intronic
1131482716 15:92795561-92795583 TTTCAGGAGCAGGGGGAGCATGG + Intronic
1131547793 15:93330445-93330467 TTTCAGCAGAAAAGGGAAGAAGG - Intergenic
1132530950 16:449146-449168 TGTCAGGAGCAGAGTGAGCAGGG - Intronic
1132762479 16:1517050-1517072 TTTCAGAAGCAGAGGAAAAAAGG + Intronic
1133574752 16:7078176-7078198 TTCCTGCAGAAGAAGGAGAAAGG + Intronic
1134494635 16:14723044-14723066 TCTCACAAGCAAAGGGAGAATGG - Intronic
1134500018 16:14762164-14762186 TCTCACAAGCAAAGGGAGAATGG - Intronic
1134545843 16:15107563-15107585 TCTCACAAGCAAAGGGAGAATGG + Intronic
1135162635 16:20110890-20110912 TGTCAACAACACAGGGAGAATGG - Intergenic
1135953070 16:26933386-26933408 CTTCACTAGCAGATGGAGAACGG - Intergenic
1136506857 16:30710007-30710029 TTCCAACAGCTGAGGGGGAAGGG - Exonic
1136550446 16:30979846-30979868 CTGCAGCAGCAGCGGGAGGAGGG + Exonic
1136854072 16:33639220-33639242 TTTGAGCAGCAGGGTGAGAAAGG + Intergenic
1137572419 16:49575542-49575564 GTTCAGCAGCACAGGGAGATAGG + Intronic
1139240693 16:65388969-65388991 TACCAGCATCAGAGGGAAAAAGG - Intergenic
1139691843 16:68646234-68646256 TTCCAGCTGCCGAGGAAGAAGGG - Intronic
1140125365 16:72113536-72113558 TCCCAGGAACAGAGGGAGAAAGG - Intronic
1140735636 16:77895517-77895539 TGGCAGAAGCAGAGGAAGAAGGG + Intronic
1140970495 16:80007802-80007824 TTTTAGCAGCAGAAGGCGAATGG - Intergenic
1140995899 16:80259379-80259401 TTTCAGCAGTGCAGGGAGGAGGG + Intergenic
1141124909 16:81394408-81394430 TGGCAGCAGGAGAGAGAGAACGG + Intergenic
1141257400 16:82415464-82415486 TTTCAGAAGGAGGGGGACAAAGG + Intergenic
1141297389 16:82782767-82782789 CTTCACCAGCAGCGGGAGTAAGG - Intronic
1141608366 16:85168470-85168492 GGTCACCAGCAGAGGTAGAAAGG - Intergenic
1142107389 16:88311920-88311942 CTTCATCAGCAGTGTGAGAATGG - Intergenic
1203115649 16_KI270728v1_random:1487659-1487681 TTTGAGCAGCAGGGTGAGAAAGG + Intergenic
1142637942 17:1269536-1269558 AGTCAGCAGCAGAGGGTGACGGG - Intergenic
1142882844 17:2894893-2894915 TGCAAGCAGCAGAGAGAGAACGG - Intronic
1142909747 17:3079078-3079100 TGGCAGCAGGAGAGAGAGAAGGG + Intergenic
1142924755 17:3224740-3224762 TGGCAGCAGGAGAGAGAGAAGGG - Intergenic
1143343485 17:6232393-6232415 GTTCTCCAGCAGAGGGAGAGGGG + Intergenic
1143810612 17:9468632-9468654 TCCCAGCAGCTGAGGCAGAAAGG - Intronic
1144995614 17:19266077-19266099 ATCAAGCAGCAGTGGGAGAAAGG - Intronic
1145201695 17:20951331-20951353 TTTCAGCAGGAGAAGGTGACAGG - Intergenic
1146149267 17:30453227-30453249 TTACAGCCTCAGAGGCAGAAGGG - Intronic
1147034221 17:37668076-37668098 TTTGAGCAGGATAGGCAGAAGGG - Intergenic
1147741619 17:42673718-42673740 GTTCAGCAGCAGCGGGAAAGGGG - Exonic
1148210748 17:45807011-45807033 GTTCAGCCCCAGAAGGAGAAGGG - Exonic
1148733834 17:49853397-49853419 TTTCAGAAGCAGAGGGAGCCAGG + Intergenic
1148852897 17:50563258-50563280 TTTCTGCAGCTCAGAGAGAAAGG - Intronic
1148943642 17:51238616-51238638 TTGCAGCAGCATGGGGAAAAAGG + Intronic
1149366958 17:55954182-55954204 TTTCATCAGCAGTGTGAAAACGG + Intergenic
1149626759 17:58084928-58084950 CAACAGCAGCACAGGGAGAAAGG - Intronic
1149642231 17:58210567-58210589 TTTCAGCAGAGGAGTGGGAAAGG + Intronic
1152028944 17:77830044-77830066 TTACTGGGGCAGAGGGAGAAGGG - Intergenic
1152182073 17:78828707-78828729 CTTCAGTAACAGATGGAGAATGG + Intronic
1153294249 18:3530665-3530687 TCTCAGCAGCAGTGGGAGCAGGG - Intronic
1153596584 18:6731636-6731658 GTTCTGCAGCAGAGGAACAATGG - Intronic
1153956192 18:10098415-10098437 TTTAGGAAGCAGAGGCAGAAGGG - Intergenic
1154196565 18:12271540-12271562 TTACAGCAGCAGTAGGAGATGGG + Intronic
1154223156 18:12474863-12474885 TTTGAGGAGGAGAGGGAAAATGG + Intronic
1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG + Intergenic
1156546793 18:37971747-37971769 TTTTAGCAGAAGGGGGAAAATGG - Intergenic
1157562890 18:48661004-48661026 TTTCAGCCACAGAGGCAGTAGGG + Intronic
1158132106 18:54163608-54163630 TTTCAGCAGCAAATGGTAAAAGG - Intronic
1158305018 18:56095696-56095718 CTTCATGAGCAAAGGGAGAATGG - Intergenic
1160408571 18:78659702-78659724 TGCCAGGAGCTGAGGGAGAAAGG - Intergenic
1160623085 18:80184442-80184464 TCTCAGCCACAGAGGGAGCAAGG + Intronic
1161644512 19:5444743-5444765 TGGCTGCAGCAGAGGGAGCAAGG - Intergenic
1161888193 19:7012981-7013003 TGTCTCCACCAGAGGGAGAAAGG + Intergenic
1162182018 19:8876431-8876453 ACTGAGCTGCAGAGGGAGAAGGG + Exonic
1162461560 19:10816924-10816946 CTGGAGCAGCAGTGGGAGAAGGG + Intronic
1162991276 19:14303980-14304002 TTTAAACAGCAGAGAGATAAGGG - Intergenic
1163178973 19:15585012-15585034 TTTGAGCAGGAGAGGGACCAGGG + Intergenic
1163228145 19:15979472-15979494 TTTGAGCAGGAGAGGGACCAGGG - Intergenic
1163242936 19:16075622-16075644 GGTCAGAACCAGAGGGAGAAAGG + Intronic
1164833091 19:31338152-31338174 TTGCAGCAGAAGAGGTGGAAAGG + Intronic
1165545627 19:36533066-36533088 TGTCTACAGCAGAAGGAGAATGG - Intergenic
1165740626 19:38203294-38203316 CTGCAGCTGCAGAGGGAGATGGG - Intronic
1165822519 19:38685585-38685607 TTTCAGAAGCAGAGTGAGTTTGG - Intronic
1166109745 19:40614659-40614681 CTTCAGCTGCAGAGGGGGAATGG - Intronic
1166831389 19:45641822-45641844 CTCCAGCAGCAGAGGGTGCAGGG - Intronic
1166853739 19:45772176-45772198 TTTGAGCAGCAGAGGGACATAGG - Intronic
1167722502 19:51187961-51187983 TTTCAGCTGTAGAGGAAGACAGG - Intergenic
1168201330 19:54817807-54817829 TGTCAGCAGCAGAGAAAGAGAGG + Intronic
1168206062 19:54851494-54851516 TGTCAGCAGCAGAGAAAGAGAGG + Intronic
926028335 2:9564138-9564160 TTTCAGGAGAAAAGGCAGAAGGG - Intergenic
926292305 2:11540869-11540891 TTTCAACAGCTGAGGAAGGATGG - Intronic
927405733 2:22764264-22764286 TCACAGAAGCAGAGAGAGAATGG - Intergenic
927957602 2:27218467-27218489 TTTTAGCAGCAGAGTCAGATGGG + Intronic
928129711 2:28640910-28640932 TTCCAGCTGGAGAGAGAGAAAGG - Exonic
928673661 2:33628524-33628546 TTGTTGTAGCAGAGGGAGAATGG - Intergenic
929262750 2:39883884-39883906 TTTTAGATGCAGAGGAAGAAGGG + Intergenic
929857297 2:45648062-45648084 TTCCAGCAGCAAAGAGGGAAGGG - Intergenic
930212991 2:48662568-48662590 TTGCAGCGGCAGAGAGAGACTGG + Intronic
930755789 2:54970737-54970759 TTTTAGCACCATATGGAGAAAGG - Exonic
931940954 2:67252013-67252035 TTTGAGCCCCTGAGGGAGAAAGG + Intergenic
933156929 2:78986432-78986454 TTTCATCAGCAGTGTGAAAATGG - Intergenic
934539260 2:95160458-95160480 ATTCAGGGGCAGATGGAGAAAGG - Intronic
934545137 2:95207864-95207886 TGCCCGCTGCAGAGGGAGAAAGG + Intronic
934953773 2:98599179-98599201 TTTTAGAGGCTGAGGGAGAAGGG + Intergenic
935445201 2:103149049-103149071 TTTCAGTTTCAGAGGTAGAATGG + Intergenic
935957025 2:108387314-108387336 TTTCAGGGGCAGTGGGAGACTGG + Exonic
936166721 2:110127156-110127178 TCCCTGCAGAAGAGGGAGAATGG - Intronic
937344378 2:121115389-121115411 CGTCAGCAGCAGAGGGAGTGAGG + Intergenic
937386330 2:121436774-121436796 TTTAAGAAGAAGAGGGAGAATGG - Intronic
937420321 2:121748955-121748977 TTTCTGAAGAAGAGAGAGAAGGG + Intronic
937740632 2:125348531-125348553 TTTCTGCAGTAGAAGGAGGAAGG + Intergenic
937864026 2:126734667-126734689 TTTCAGCAGCAGAGATGGCAGGG + Intergenic
939131396 2:138240026-138240048 TTTCAGCAGCAGACTCTGAAAGG + Intergenic
939565765 2:143784883-143784905 TTTTATCAGGAGAGGAAGAAAGG + Intergenic
939991776 2:148882593-148882615 TGTGAGCAGCTGAGGGAAAAGGG - Intronic
940120577 2:150260147-150260169 TTTTAGCAAAGGAGGGAGAAGGG + Intergenic
940882317 2:158959123-158959145 TGTCAGTGGCTGAGGGAGAATGG + Intergenic
941032900 2:160533241-160533263 ATTGTGCAGGAGAGGGAGAAAGG + Intergenic
941369801 2:164650762-164650784 TTTCAGAAGAAGAGAGAGACTGG - Intergenic
941577252 2:167248529-167248551 TTTCCGGAGCAGAGGAGGAAAGG - Exonic
941888250 2:170551918-170551940 TGGCAGCAGGAGAGAGAGAAGGG - Intronic
942856832 2:180558766-180558788 TTTCAGGGGCAGGGGGAGAGAGG + Intergenic
943293392 2:186105607-186105629 CTCCAGCAGCAGAGAAAGAAGGG + Intergenic
943295222 2:186129806-186129828 TTTCAGCAGGAAATAGAGAAGGG - Intergenic
943317251 2:186405392-186405414 ATTCAGCTGCAGAGGAAGTATGG - Intergenic
943828300 2:192425158-192425180 TTTCATAAGAAGAGGGATAAGGG + Intergenic
943848815 2:192689223-192689245 TTTTATCAGCAGAGTGAAAATGG + Intergenic
944256860 2:197631963-197631985 TTTAATTAGAAGAGGGAGAATGG - Intronic
944479299 2:200138969-200138991 TTTCAGCACCACAGGGAAAAAGG - Intergenic
946116747 2:217469430-217469452 TATCAACAGCAAAGGGAGGAGGG + Intronic
947932252 2:233973747-233973769 TGTCAGCAGCAGCGAGGGAATGG + Intronic
948454053 2:238096597-238096619 TTTGTGCAGCCAAGGGAGAAAGG + Intronic
948632812 2:239312872-239312894 CTTCATCTGCAGAGGGAGACCGG + Intronic
949004662 2:241638133-241638155 TTTCCGCAGCTGAGCGTGAAGGG + Intronic
1168888180 20:1274969-1274991 GTGCAGCCCCAGAGGGAGAAGGG + Intronic
1168889623 20:1286402-1286424 CTGCAGCTGGAGAGGGAGAAGGG + Intronic
1169163812 20:3406467-3406489 TTTGAGAAGGAGAGGGAGAGGGG - Intronic
1169553742 20:6727934-6727956 GTAGAGCAGCAGAGGTAGAAAGG + Intergenic
1170503993 20:17005019-17005041 TTTAAATAGCAGATGGAGAAAGG - Intergenic
1170571562 20:17635633-17635655 CTTCAGGAGCAGCTGGAGAATGG - Exonic
1171519795 20:25766897-25766919 TTTCAGCAAGGGAGGGAGGAAGG - Intronic
1171890733 20:30711576-30711598 TTTCAACAGCACAGGGATCAGGG + Intergenic
1171966986 20:31538003-31538025 TTTCTGCAGCTGTGGGGGAAAGG - Intronic
1172240416 20:33409093-33409115 TTCCAGCAGCACAAGTAGAAAGG + Intronic
1172783257 20:37449836-37449858 TTTCAGACGCAGAAGGAGATTGG - Intergenic
1172844790 20:37923463-37923485 ATTCTGCAGGAGAAGGAGAATGG - Intronic
1172998421 20:39088320-39088342 TTCCAGCTGCAGAGGGAGAAGGG - Intergenic
1173010138 20:39174942-39174964 TTCCAGCAGGAGAGGGCCAATGG - Intergenic
1173898668 20:46570906-46570928 TTTTATTAGCAGAGCGAGAATGG - Intronic
1177285430 21:19042460-19042482 TTTCAGTAGCAGATGGGGAGAGG - Intergenic
1179822111 21:43942988-43943010 TTTCCACAGCAGAGGGAGGGAGG + Intronic
1179968953 21:44823749-44823771 TTTCTTCAGCAGAGGGAAAGTGG + Intergenic
1180149256 21:45939362-45939384 TTGAAGCAGCTGAGGGAGGAGGG - Intronic
1180831567 22:18909638-18909660 ACACAGCACCAGAGGGAGAAGGG - Intronic
1181405195 22:22679513-22679535 TTTGACCAGCTGTGGGAGAAAGG - Intergenic
1181529977 22:23511856-23511878 TTCCAGCAGCATGGGGAGGAAGG + Intergenic
1181777956 22:25173105-25173127 TGGCAGCAGGAGAGAGAGAACGG + Intronic
1182692445 22:32173531-32173553 TGTGAGCAGCAGAGAGAGAATGG - Intergenic
1184457324 22:44618569-44618591 CTCCAGGTGCAGAGGGAGAAGGG + Intergenic
1184481191 22:44748358-44748380 CTTCATCAGCAGCGTGAGAATGG + Intronic
1184556956 22:45238672-45238694 GTTCAGCAGCAGGGGAAGAGGGG + Intronic
1184964750 22:47963113-47963135 TTTCATCTGCAGAGGGGTAAGGG + Intergenic
1203281651 22_KI270734v1_random:134909-134931 ACACAGCACCAGAGGGAGAAGGG - Intergenic
949200680 3:1375323-1375345 TTTCAGTAGCAGAATGAGACTGG + Intronic
949446522 3:4140521-4140543 TTTCAGCAGGAAAGAAAGAAAGG - Intronic
949999816 3:9648475-9648497 TGTGAGCAGCAGGGGGAGAAAGG + Intergenic
950115660 3:10448994-10449016 TTTCTGAGGCAGAGGCAGAAGGG - Intronic
950227697 3:11249429-11249451 ATTTAGGAGGAGAGGGAGAAGGG + Intronic
950397779 3:12747096-12747118 TTTCAGCAGGCGAGGGAGAGTGG - Intronic
950762303 3:15242748-15242770 ATTAAGCAGAATAGGGAGAAAGG - Intronic
951587283 3:24228363-24228385 ATTCAGCAGTAGAGTCAGAATGG - Intronic
952114186 3:30159562-30159584 TTGCAGCAGCAAAGGGATTAAGG - Intergenic
952764577 3:36943859-36943881 TTTAAGAAGCAGAAAGAGAATGG - Intronic
953605628 3:44411441-44411463 TGGCTGGAGCAGAGGGAGAATGG - Intergenic
954115575 3:48465348-48465370 TTGCAGTAGCTGAGGGAGCAGGG + Intronic
954800632 3:53185116-53185138 TTTAGGCAGCAGAGGGAGGGGGG + Intronic
955281117 3:57596137-57596159 TTTGCTCAGCTGAGGGAGAAGGG - Intronic
956784439 3:72630672-72630694 TTTTAGCTGCAGTGGGAGAAAGG + Intergenic
957233429 3:77551798-77551820 TTTCACCATCAGAGAAAGAAGGG - Intronic
957766238 3:84628816-84628838 TTTCAGCATCAGAAGAATAAAGG + Intergenic
958525957 3:95259378-95259400 TTTCAGTAGCTGAGACAGAATGG + Intergenic
958946928 3:100372872-100372894 TCTCAGCAGCAGAGAGCCAAAGG + Intronic
961456669 3:127027979-127028001 ATCAAGCAGCAGATGGAGAAGGG + Exonic
962044211 3:131738507-131738529 TTTAAGCAACAGATGGGGAAGGG + Intronic
962187888 3:133279420-133279442 TTCCGGCAGCAAAGGGAGACCGG - Intronic
962210287 3:133471898-133471920 TTTCAGCAGCAGAGGGAGAAGGG + Intronic
962273797 3:133997233-133997255 TTGCAGAGGCAGAGGGAGTAGGG - Intronic
963249760 3:143092276-143092298 TGGCAGCTGCAGAGGGAGAAAGG + Intergenic
963573819 3:147033461-147033483 TTTCAGCAGGAGAGGGGCAAAGG + Intergenic
963781642 3:149492507-149492529 TTTCAGCAGCTCAGGGTCAAGGG - Intronic
964597839 3:158456682-158456704 TTTCAGCAAGAAAGTGAGAATGG + Intronic
964880824 3:161420783-161420805 TTCTAACAGAAGAGGGAGAAAGG - Intergenic
965722598 3:171678060-171678082 TTTCAGGGGCAGAGTGGGAAGGG + Intronic
966641864 3:182200761-182200783 TTTCACCAGTACAGAGAGAACGG + Intergenic
966895602 3:184442550-184442572 TGTCAGCAGCACAGGAACAAAGG + Intronic
967417311 3:189233422-189233444 TTTCACCAGCAGAGGGCAACAGG - Intronic
967840072 3:193998009-193998031 TATGAACAGCAGAGGGAGGAGGG + Intergenic
968178677 3:196573422-196573444 TTTGAACAGCAGAGTGACAAAGG + Intronic
969087077 4:4664471-4664493 TGTCAGCAACAGGGGGAGTAGGG - Intergenic
969358107 4:6643110-6643132 TTCTAGCAGCTGAGGCAGAAAGG - Intergenic
970020973 4:11568205-11568227 TTTTTACAGCAGAGTGAGAATGG - Intergenic
970054461 4:11954762-11954784 CACCAGTAGCAGAGGGAGAAAGG - Intergenic
970200564 4:13600366-13600388 TTGCTGCAGCAGTGGAAGAAAGG - Exonic
971134674 4:23855253-23855275 CTTTAGCAGCAGAGTGAGACTGG + Intronic
972087972 4:35243103-35243125 GTTCAGCAGAAGAGGGGGTAAGG - Intergenic
972709275 4:41578239-41578261 TGGCAGCAGGAGAGAGAGAAGGG + Intronic
973795024 4:54416386-54416408 TATCAGCAGCAGAGGCATGAGGG - Intergenic
975646162 4:76548186-76548208 TTCCAGCGGCACAGGGAGCATGG - Intronic
975655443 4:76636797-76636819 TCTCAGCAGCTCAGGGTGAAAGG - Intronic
976807260 4:89062389-89062411 TTTGAGTACCAGAAGGAGAAGGG - Intronic
976871655 4:89801170-89801192 TATCAGAAAAAGAGGGAGAAAGG - Intronic
978084093 4:104628932-104628954 TGTGGGCAGCAGAAGGAGAAAGG + Intergenic
978150808 4:105432581-105432603 TATTAGCAGTAGAGGCAGAAGGG + Intronic
979203018 4:118002043-118002065 TTTTAGCTGCAGAGTCAGAAAGG - Intergenic
979238692 4:118429520-118429542 TGTGAGCAGCAAAGGAAGAAAGG - Intergenic
981089810 4:140720953-140720975 TTCCAGGAGCAAAGAGAGAAAGG - Intronic
981152731 4:141397924-141397946 CTCCAACAGCAGAGGGAGAAGGG - Intergenic
982103628 4:151992643-151992665 CTTCAGGAGCAGAGGTGGAAGGG - Intergenic
983766442 4:171490011-171490033 TTGCAGGAGCACAGGCAGAAAGG + Intergenic
983912764 4:173258504-173258526 TTGCAGCAGCTGATGGAGATGGG + Intronic
984499572 4:180542187-180542209 TTTTATCTGCAGTGGGAGAAAGG - Intergenic
984711825 4:182892190-182892212 GTTCAGCAGCAGTGGGACCATGG - Intronic
984849001 4:184136904-184136926 TCACAGCAGGAGAGGGAAAATGG - Intronic
984872984 4:184343778-184343800 TTTCAACAGCAGTGGGGGCAGGG - Intergenic
985314501 4:188642048-188642070 TTTCTGCAGTAAAGGGATAAGGG - Intergenic
985706915 5:1406590-1406612 TACCAGCAGCAGAGGGAGACAGG - Intronic
985719475 5:1481743-1481765 TTTCCGCAGCGGAGGCAGGAAGG + Intronic
986417961 5:7547332-7547354 TTTCATCAGCAGGGAAAGAAAGG - Intronic
986805527 5:11305281-11305303 TGTCAGGAGCAGAGTCAGAATGG + Intronic
986805743 5:11307215-11307237 ATTCAGGAGCAGAGAAAGAAGGG - Intronic
988202550 5:28086230-28086252 ATTCAGAAGAAGAGAGAGAAAGG + Intergenic
989267064 5:39487087-39487109 TTTCAGCAGCTGATGGATAGTGG + Intergenic
990507622 5:56460165-56460187 TTTTTACAGCTGAGGGAGAAAGG + Intronic
990956130 5:61341271-61341293 TCCCAGCAGCTCAGGGAGAAAGG - Intronic
991047801 5:62240957-62240979 TTTGAGCAGGAGGGTGAGAAAGG - Intergenic
991323336 5:65401447-65401469 TCCCAGCAGCAGAAGGGGAAAGG - Intronic
993537395 5:89103693-89103715 TTTCAGCATCATAGGGAAAATGG + Intergenic
993761640 5:91802930-91802952 CTTCACCAGCAGAGGGCAAAGGG - Intergenic
993856709 5:93085333-93085355 TTTCTGCTTCAAAGGGAGAAGGG - Intergenic
994008493 5:94871038-94871060 TTTCAGCAGCTGGGGGTCAAAGG - Intronic
994732167 5:103505051-103505073 TTTCAATAGGAGAAGGAGAAAGG + Intergenic
995555156 5:113320303-113320325 TTTCAGTAGCAGAGAGGGTAAGG + Intronic
996417125 5:123222573-123222595 TCTCAGCAGCAGCCTGAGAAGGG - Intergenic
996491927 5:124108057-124108079 TGGCAGCGGCAAAGGGAGAAGGG - Intergenic
996540680 5:124628032-124628054 TGTCTGCAGAAGCGGGAGAACGG + Intergenic
997487089 5:134240386-134240408 TTTCAGAAGCTGAGCGAGAAGGG + Intergenic
998043758 5:138970135-138970157 TTGCAGAAGCAGAGGCAGAGAGG + Intronic
998430090 5:142063244-142063266 GTTCAGCAGCTTAGGGAAAAGGG - Intergenic
999721519 5:154402241-154402263 GGGCAGGAGCAGAGGGAGAAAGG - Intronic
1000005877 5:157184502-157184524 TTTCAGCGGTAAAGGGAAAATGG + Intronic
1000268178 5:159657954-159657976 TTTCAAAAGCAGAGGAGGAAAGG + Intergenic
1000494758 5:161967909-161967931 ATTTGGCAGCAGAGGAAGAAAGG - Intergenic
1000597287 5:163230485-163230507 TTTCACCAGGAGACGCAGAAAGG - Intergenic
1000753598 5:165128900-165128922 TTACAGCAGCTCAGGGAGATAGG - Intergenic
1001021490 5:168186730-168186752 ATTCAACAGCAGAGGGAAAGCGG - Intronic
1001163952 5:169346644-169346666 TCTAAGGGGCAGAGGGAGAAGGG - Intergenic
1001295655 5:170496985-170497007 CCTCAGCAGCAGAGGTAGAGAGG + Intronic
1001397010 5:171424833-171424855 TATCCCCAGCAGAGGGGGAAGGG + Intronic
1002187819 5:177462745-177462767 TGTCAGGAGCACTGGGAGAAGGG + Intronic
1002563298 5:180096808-180096830 TTGCAGCCTCAGAGGGAGATGGG - Intergenic
1003127362 6:3366023-3366045 TGTCAGCATCAGAAAGAGAAGGG + Intronic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1004068661 6:12276282-12276304 TTCCAGTAGCAGAAAGAGAAAGG + Intergenic
1004402149 6:15298783-15298805 TTTCAGCAGCTCAGGGAAACTGG - Intronic
1004753131 6:18583916-18583938 TATCAGCAGCAGAGGCAGAGAGG + Intergenic
1005659767 6:27984696-27984718 TCCCAGCAGCAGAGGGAGTTGGG + Intergenic
1006455984 6:34132192-34132214 TTCCAGAAGGAAAGGGAGAAAGG + Intronic
1006622693 6:35377435-35377457 TTTATGCAGGAGAGGTAGAATGG - Intronic
1007981318 6:46161974-46161996 CTTAAGCAGCAGGGGAAGAAGGG + Intronic
1008048843 6:46879478-46879500 TGGCAGCAGGAGAGGGAGAGAGG - Intronic
1008079256 6:47177636-47177658 TGCCAGCAGCAGAGAGAGAATGG - Intergenic
1010126838 6:72442351-72442373 TTACAGAAGCAAAGGGAAAAAGG - Intergenic
1011246107 6:85322865-85322887 TTTCAGCAACAGAAGCAGACAGG + Intergenic
1011783879 6:90822021-90822043 TCTCAGGAGCAGAGTCAGAATGG - Intergenic
1012123819 6:95400869-95400891 CAACAGCAGCAGATGGAGAAGGG - Intergenic
1012521885 6:100131181-100131203 TTTTAGAAGGAGAGCGAGAAAGG - Intergenic
1013307295 6:108861159-108861181 TTTTGGTAGCAGAGGTAGAAGGG - Intronic
1013372309 6:109481926-109481948 TTTGAGGATCAGAGGAAGAAAGG - Exonic
1014363015 6:120504092-120504114 TTTTATTAGCAGAGTGAGAATGG + Intergenic
1014701560 6:124695254-124695276 TTTCAGAAGCAGAGGCAGAAAGG - Intronic
1015970702 6:138740439-138740461 CTTCAGCAGCAGCGTGAAAACGG - Intergenic
1015973507 6:138766676-138766698 GGTCAGAGGCAGAGGGAGAAAGG - Intronic
1016638941 6:146326435-146326457 TTTGAGGGGCAGAGGGTGAAAGG + Intronic
1017066566 6:150534698-150534720 TTTCAGCAGAATATGGAAAATGG - Intergenic
1017074747 6:150607238-150607260 TGATTGCAGCAGAGGGAGAATGG + Intronic
1017140647 6:151186619-151186641 TTTCAGCATCAGAGGATGGAGGG + Intergenic
1017207329 6:151817508-151817530 TTTCAGAAGCAGAGGGTAAAAGG + Intronic
1017995971 6:159531960-159531982 GAGCAGCAGCAGAAGGAGAAGGG - Intergenic
1018180195 6:161216585-161216607 CTTCAGCAGCAGTGTGAAAACGG - Intronic
1019706954 7:2501516-2501538 TCTCAGCTGCAGAGGGGGTATGG + Intergenic
1019942032 7:4299310-4299332 TTTAAGCAGCAGAGGGTGGGAGG + Intergenic
1020020673 7:4865802-4865824 TGGCAGCAGCGGAGGCAGAAAGG + Intronic
1020140811 7:5610637-5610659 TGGGGGCAGCAGAGGGAGAAGGG + Intergenic
1020695143 7:11404642-11404664 TTTCAGCAGCAGGAAGTGAAAGG + Intronic
1021414990 7:20373717-20373739 CTTCAGCAGGGGAAGGAGAAGGG - Intronic
1021795877 7:24253929-24253951 TTTCTGCTTCAGATGGAGAAAGG - Intergenic
1021992194 7:26150096-26150118 TTTTAGGAGCATGGGGAGAATGG - Intergenic
1022129997 7:27396157-27396179 TTTCAGGCACACAGGGAGAAGGG + Intergenic
1023362769 7:39432751-39432773 TCTCAGAACCAGAGGGAGGATGG - Intronic
1024041650 7:45560562-45560584 AATCAGCAGCAGAGAGAAAAGGG - Intergenic
1024242247 7:47444640-47444662 CCTCAGCTGCAGAGTGAGAAGGG + Intronic
1024404793 7:48966099-48966121 ATTCAGCAGCACAGGCAGAGAGG + Intergenic
1024885670 7:54139456-54139478 TTTCAACAGGAGATGCAGAAGGG - Intergenic
1025845627 7:65194075-65194097 ATTCAGGAGCACAGGCAGAATGG + Intergenic
1026192275 7:68140307-68140329 TCTGAGCAGCAGAGTGAGTAGGG - Intergenic
1026423910 7:70270470-70270492 TTTCAGAAGCAGAGGATGAGTGG + Intronic
1027996915 7:85435690-85435712 CTTTATCAGCAGAGGGAAAATGG + Intergenic
1028674486 7:93442936-93442958 TTTCAGCAGCCCTGGGGGAAAGG + Intronic
1028747840 7:94347699-94347721 TCTCAGCAGCAAAGGGTGATGGG - Intergenic
1029035670 7:97518554-97518576 TTTTGGCAGCGGAGGGATAATGG - Intergenic
1029865202 7:103620326-103620348 CTTCATCAGCAGCGTGAGAATGG + Intronic
1029872452 7:103709162-103709184 TTTCAGCAGGATAGGGAGATGGG + Intronic
1030217256 7:107057121-107057143 TTCAAGCAACAGAGGGAGGAAGG - Intronic
1031144969 7:117987361-117987383 TCTAGGCAACAGAGGGAGAACGG + Intergenic
1031614575 7:123865790-123865812 TTTCATTAGCAGTGTGAGAATGG - Intronic
1031974551 7:128085493-128085515 TGGGAGCAGAAGAGGGAGAAAGG - Intronic
1032184047 7:129708089-129708111 TTTCAGCTGCAGGGGCAGTATGG + Intronic
1032390705 7:131553757-131553779 TTTCAGTAGCTGAGGGAACACGG + Intronic
1032468921 7:132164227-132164249 ATCAAGCAGCAGATGGAGAAGGG - Exonic
1032673596 7:134107871-134107893 TTTTACCAGCTGAGGAAGAAAGG - Intergenic
1032713609 7:134485016-134485038 TCTCAGTAGAAGAGGGAGGAAGG - Intergenic
1032884507 7:136123496-136123518 TGTCACCAGCAGAGTAAGAAGGG + Intergenic
1032937639 7:136751780-136751802 TTACAGAAGCAGAGATAGAATGG + Intergenic
1032991619 7:137400669-137400691 TGTCAGCTGCAGAGGATGAAAGG - Intronic
1033174827 7:139114241-139114263 TTTGAGCAGCAGTGGGGGAGGGG + Intergenic
1033490948 7:141842881-141842903 TTAGAGCAGGAAAGGGAGAAAGG + Intergenic
1034432565 7:151048501-151048523 TTTCAGCAGTAGGGGGGAAAGGG - Intronic
1034494362 7:151410795-151410817 TCTCAGGAGCCTAGGGAGAAGGG + Intergenic
1034891183 7:154840487-154840509 TTTCATCAACAGAGTGAGCATGG - Intronic
1035606287 8:931709-931731 TTTCAGCAGCCCAGTAAGAAGGG - Intergenic
1035979352 8:4352073-4352095 TTCCAGCAGTAGAAGGAGAGTGG - Intronic
1036013878 8:4758930-4758952 TTTCAGTAGCAGACGGTGGAGGG + Intronic
1036129495 8:6095779-6095801 TTTCAGAAGGTTAGGGAGAATGG + Intergenic
1037426635 8:18762453-18762475 TGTTTGCAGCAGTGGGAGAATGG + Intronic
1037552813 8:19991657-19991679 TGTCAGCAGCAGATGCAGAGAGG - Intergenic
1037728895 8:21506956-21506978 TTTCCTCTGGAGAGGGAGAAAGG + Intergenic
1039517357 8:38145140-38145162 TTTCTGCAGCATGGGGGGAATGG + Intronic
1041344388 8:56881418-56881440 TTGCTTCAGCAGAGGGTGAATGG + Intergenic
1041823725 8:62068036-62068058 TATTAGCAGCAGTGTGAGAACGG + Intergenic
1042260417 8:66853785-66853807 TCTCAGCAGCTGATAGAGAAAGG + Intronic
1042516457 8:69663797-69663819 TTTCAGCAGGAGAGGGGTCATGG + Intergenic
1042650918 8:71040227-71040249 TTTGGCCAGCACAGGGAGAAAGG + Intergenic
1042788466 8:72576585-72576607 GTCCTGCTGCAGAGGGAGAAAGG - Intronic
1043333899 8:79150140-79150162 TTTCATCAGCAGTGTGAAAATGG - Intergenic
1043523197 8:81068448-81068470 TCTCAGCAGAAGAGGGAAAGGGG + Intronic
1044360520 8:91278068-91278090 TTTCAGTGGCAGGGGGAGGAGGG + Intronic
1047529051 8:125658729-125658751 GTACAGCAGTAGAGTGAGAAAGG - Intergenic
1047570692 8:126095511-126095533 TTACAGCAGGAAAGGGAGAAAGG + Intergenic
1048043654 8:130753771-130753793 TTTCTGAAGCAGAGGGAGGCTGG - Intergenic
1048581883 8:135735638-135735660 CATCAGCAGCAGTGGGACAAGGG - Intergenic
1050431539 9:5567438-5567460 TGTCTGCATAAGAGGGAGAATGG - Intronic
1051042069 9:12824052-12824074 TGTCAGCACCAGAAGGAAAAGGG + Intergenic
1052826457 9:33179365-33179387 TTTCAGCATCAGAGAGAATATGG + Intergenic
1053281121 9:36820312-36820334 TTTGAGCAGCAGAGGAGGAGAGG - Intergenic
1053290030 9:36873704-36873726 TTTGAGCATCAGATGGAGAGAGG - Intronic
1053455173 9:38227924-38227946 TCTCAGCAGCTCAAGGAGAAAGG - Intergenic
1055503520 9:76925380-76925402 TTGCAGCAGGGGAGGGAGATTGG - Intergenic
1057056620 9:91966479-91966501 ATACAGCAGCAAAGGGAGATGGG - Intergenic
1057501589 9:95600975-95600997 TCACAGCAGCAGAGGGGTAAAGG - Intergenic
1058469627 9:105264107-105264129 TATCTGCAGCAGAAGGATAAGGG - Intronic
1058489030 9:105475341-105475363 TCACAGCTGAAGAGGGAGAATGG + Intronic
1058995410 9:110294026-110294048 TTTGAGCAGAGGAGGGACAAAGG - Intergenic
1059244993 9:112842249-112842271 ATTCAGCAGCTGATGAAGAACGG - Intronic
1059443674 9:114325032-114325054 TGTCAGCTGCAGGGGGAGCAAGG - Exonic
1059444874 9:114331809-114331831 TGTCAGCTGCAGGGGGAGCAAGG - Exonic
1059933520 9:119284622-119284644 TTTCAGCAGCACAGGGTGAGGGG - Intronic
1060898102 9:127232260-127232282 CTTCAGTAGCTGAAGGAGAAGGG - Intronic
1061098437 9:128473566-128473588 TTACAGATGCAGGGGGAGAAGGG - Intronic
1061159967 9:128888066-128888088 TTACAGCAGCAGAGGGAGGTCGG + Intronic
1061247098 9:129406134-129406156 TTTCAGTAGAAAAGGGAGCAGGG + Intergenic
1062238580 9:135524187-135524209 TATCTGCAGCAGAGGCAGGAAGG + Intronic
1062703409 9:137920032-137920054 TCACAGCAGGGGAGGGAGAAGGG - Intronic
1185559771 X:1050591-1050613 TCCCAGCAGCAGGGGAAGAAAGG + Intergenic
1186880605 X:13862323-13862345 TCTCAGCAGAAGAGAGAGAAGGG - Intronic
1187010104 X:15269938-15269960 TTTCAGGAGCAGGGGGAGCATGG - Exonic
1187598299 X:20799217-20799239 CTTCATCAGCAGTGTGAGAATGG + Intergenic
1187737890 X:22323009-22323031 TTTTTGGAGGAGAGGGAGAAGGG + Intergenic
1188427194 X:30062588-30062610 TTTTAGGAGAAAAGGGAGAAAGG + Intergenic
1188547978 X:31331035-31331057 TTTCAACAGCAGAGACAGATGGG + Intronic
1188878625 X:35464542-35464564 TTTCAGTAGCACAGGTACAAAGG - Intergenic
1188990782 X:36817520-36817542 CTTTAGCAGCAGTGTGAGAATGG - Intergenic
1191075144 X:56445032-56445054 TGCCAGCAGCAGAGGGAGCATGG + Intergenic
1191908311 X:66119891-66119913 TATCAGCAGGTGAGGGAAAATGG - Intergenic
1192534767 X:71917836-71917858 ATTCAGGAGGAGAGGGAGCAAGG + Intergenic
1192903422 X:75523594-75523616 TTCAAGCAGCAGTGGGAGGATGG - Intergenic
1193913005 X:87328141-87328163 CTGTAGCAGCAGAGGCAGAAGGG - Intergenic
1194261296 X:91699401-91699423 TGTCAGCACAAGAGGGAGCAGGG + Intergenic
1195699047 X:107688659-107688681 TTTCAGCAGGAGAGTGATATGGG + Intergenic
1197320378 X:125021955-125021977 TGTCATCACCAGAGGGAAAAAGG - Intergenic
1197660083 X:129161299-129161321 TTGCACCAGCAGAGGGCCAAGGG + Intergenic
1197902944 X:131393026-131393048 TGTCACCAGCAGATGGAGAGAGG + Intronic
1198154156 X:133941396-133941418 TTTCAGATCCAGAGGAAGAAAGG + Intronic
1198471120 X:136948139-136948161 TGGCGGCAGCAGAGGCAGAAAGG + Intergenic
1199320587 X:146433535-146433557 CTTCACCAGCAGAGGCAGAGTGG - Intergenic
1200085243 X:153601038-153601060 TGTCAGCAGCACAGGGAGCTGGG - Intergenic
1200236185 X:154468862-154468884 ATCAAGCAGCAGATGGAGAAGGG + Exonic
1200579947 Y:4938202-4938224 TGTCAGCACAAGAGGGAGCAGGG + Intergenic
1201793965 Y:17874642-17874664 TTTCAACAGCGGAGGGTGAAAGG + Intergenic
1201807589 Y:18031343-18031365 TTTCAACAGCGGAGGGTGAAAGG - Intergenic
1202339796 Y:23851653-23851675 TTTCAACAGCGGAGGGTGAAAGG + Intergenic
1202355348 Y:24042457-24042479 TTTCAACAGCGGAGGGTGAAAGG + Intergenic
1202515430 Y:25627652-25627674 TTTCAACAGCGGAGGGTGAAAGG - Intergenic
1202530970 Y:25818429-25818451 TTTCAACAGCGGAGGGTGAAAGG - Intergenic