ID: 962212326

View in Genome Browser
Species Human (GRCh38)
Location 3:133489736-133489758
Sequence TGCCAGGTCAATAGTGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962212326_962212337 28 Left 962212326 3:133489736-133489758 CCTGGGCCACTATTGACCTGGCA No data
Right 962212337 3:133489787-133489809 AATCCTCTTCTGCCCTGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962212326 Original CRISPR TGCCAGGTCAATAGTGGCCC AGG (reversed) Intergenic
No off target data available for this crispr