ID: 962215526

View in Genome Browser
Species Human (GRCh38)
Location 3:133517661-133517683
Sequence CTGCAGAGTTACACAGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962215526_962215528 -5 Left 962215526 3:133517661-133517683 CCCTCTGCTGTGTAACTCTGCAG No data
Right 962215528 3:133517679-133517701 TGCAGTTCCTCCACAAATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962215526 Original CRISPR CTGCAGAGTTACACAGCAGA GGG (reversed) Intergenic
No off target data available for this crispr